Down-regulation of RNA Helicase II/Gu Results in the Depletion of 18 and 28 S rRNAs in Xenopus Oocyte
2003; Elsevier BV; Volume: 278; Issue: 40 Linguagem: Inglês
10.1074/jbc.m302258200
ISSN1083-351X
AutoresHushan Yang, Juhua Zhou, Robert Ochs, Dale Henning, Runyan Jin, Benigno C. Valdez,
Tópico(s)RNA and protein synthesis mechanisms
ResumoGenetic manipulations have revealed the functions of RNA helicases in ribosomal RNA (rRNA) biogenesis in yeast. However, no report shows the role of an RNA helicase in rRNA formation in higher eukaryotes. This study reports the functional characterization of the frog homologue of nucleolar RNA helicase II/Gu (xGu or DDX21). Down-regulation of xGu in Xenopus laevis oocyte using an antisense oligodeoxynucleotide results in the depletion of 18 and 28 S rRNAs. The disappearance of 18 S rRNA is accompanied by an accumulation of 20 S, indicating that xGu is critical in the processing of 20 to 18 S rRNA. The degradation of 28 S rRNA into fragments smaller than 18 S is also associated with a specific decrease in the level of xGu protein. These effects are reversed in the presence of in vitro synthesized wild type xGu mRNA but not its helicase-deficient mutant form. Similar aberrant rRNA processing is observed when antibody against xGu is microinjected. The involvement of xGu in processing of rRNA is consistent with the localization of Gu protein to the granular and dense fibrillar components of PtK2 cell nucleoli by immunoelectron microscopy. Our results show that xGu is involved in the processing of 20 to 18 S rRNA and contributes to the stability of 28 S rRNA in Xenopus oocytes. Genetic manipulations have revealed the functions of RNA helicases in ribosomal RNA (rRNA) biogenesis in yeast. However, no report shows the role of an RNA helicase in rRNA formation in higher eukaryotes. This study reports the functional characterization of the frog homologue of nucleolar RNA helicase II/Gu (xGu or DDX21). Down-regulation of xGu in Xenopus laevis oocyte using an antisense oligodeoxynucleotide results in the depletion of 18 and 28 S rRNAs. The disappearance of 18 S rRNA is accompanied by an accumulation of 20 S, indicating that xGu is critical in the processing of 20 to 18 S rRNA. The degradation of 28 S rRNA into fragments smaller than 18 S is also associated with a specific decrease in the level of xGu protein. These effects are reversed in the presence of in vitro synthesized wild type xGu mRNA but not its helicase-deficient mutant form. Similar aberrant rRNA processing is observed when antibody against xGu is microinjected. The involvement of xGu in processing of rRNA is consistent with the localization of Gu protein to the granular and dense fibrillar components of PtK2 cell nucleoli by immunoelectron microscopy. Our results show that xGu is involved in the processing of 20 to 18 S rRNA and contributes to the stability of 28 S rRNA in Xenopus oocytes. Nucleoli are distinct phase-dense organelles inside the nucleus, the major function of which is to synthesize, process, and package ribosomal RNA (1Busch H. Smetana K. The Nucleolus. Academic Press, Inc., New York1970: 1-7Google Scholar). Additional functions have recently been assigned to nucleoli including production of signal recognition particles and transient sequestration of proteins involved in the regulation of gene transcription, cell cycle progression, and stem cell proliferation (2Pederson T. Nucleic Acids Res. 1998; 26: 3871-3876Crossref PubMed Scopus (431) Google Scholar, 3Visintin R. Amon A. Curr. Opin. Cell Biol. 2000; 12: 372-377Crossref PubMed Scopus (150) Google Scholar, 4Olson M.O.J. Dundr M. Szebeni A. Trends Cell Biol. 2000; 10: 189-196Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar, 5Tsai R.Y.L. McKay R.D.G. Genes Dev. 2002; 16: 2991-3003Crossref PubMed Scopus (393) Google Scholar). The recent identification of ∼350 additional nucleolar proteins may eventually lead to additional functions for the nucleolus (6Andersen J.S. Lyon C.E. Fox A.H. Leung A.K.L. Lam Y.W. Steen H. Mann M. Lamond A.I. Curr. Biol. 2002; 12: 1-11Abstract Full Text Full Text PDF PubMed Scopus (808) Google Scholar, 7Scherl A. Coute Y. Deon C. Calle A. Kindbeiter K. Sanchez J-C. Greco A. Hochstrasser D. Diaz J.-J. Mol. Biol. Cell. 2002; 13: 4100-4109Crossref PubMed Scopus (395) Google Scholar).Electron microscopic examination of a nucleolus shows three structurally well defined regions: the fibrillar center (FC), 1The abbreviations used are: FC, fibrillar center; DFC, dense fibrillar component; GC, granular component; Gu, RNA helicase II/Gu; rRNA, ribosomal RNA; RT, reverse transcription; ssRNA, single-stranded RNA; GST, glutathione S-transferase; PBS, phosphate-buffered saline; RNP, ribonucleoprotein; RPL4, ribosomal protein L4; xGu, Xenopus RNA helicase II/Gu.1The abbreviations used are: FC, fibrillar center; DFC, dense fibrillar component; GC, granular component; Gu, RNA helicase II/Gu; rRNA, ribosomal RNA; RT, reverse transcription; ssRNA, single-stranded RNA; GST, glutathione S-transferase; PBS, phosphate-buffered saline; RNP, ribonucleoprotein; RPL4, ribosomal protein L4; xGu, Xenopus RNA helicase II/Gu. the dense fibrillar component (DFC), and the granular component (GC). Transcription of rRNA genes is thought to occur in the DFC and/or at the FC/DFC borders (8Hozak P. Cook P.R. Schofer C. Mosgoller W. Wachtler F. J. Cell Sci. 1994; 107: 639-648PubMed Google Scholar, 9Koberna K. Malinski J. Pliss A. Masata M. Vecerova J. Fialova M. Bednar J. Raska I. J. Cell Biol. 2002; 157: 743-748Crossref PubMed Scopus (122) Google Scholar, 10Huang S. J. Cell Biol. 2002; 157: 739-741Crossref PubMed Scopus (61) Google Scholar), and early processing of the newly synthesized mammalian 47 S primary precursor transcript occurs within the DFC (11Ochs R.L.A. Lischwe M. Shen E. Carrol R.E. Busch H. Chromosoma. 1985; 92: 330-336Crossref PubMed Scopus (112) Google Scholar, 12Raska I. Dundr M. Koberna K. Melcak I. Risueno M. Torok I. J. Struct. Biol. 1995; 114: 1-22Crossref PubMed Scopus (76) Google Scholar). RNA polymerase I catalyzes the synthesis of 47 S pre-rRNA, which is then processed into the mature 18, 5.8, and 28 S rRNAs. This processing resembles an assembly line involving numerous proteins and small nucleolar RNAs. Ribose methylation and pseudouridilation of the 47 S precursor RNA, guided by small nucleolar RNAs, occur prior to nucleolytic cleavages (13Kiss-Laszlo Z. Henry Y. Bachellerie J.-P. Caizergues-Ferrer M. Kiss T. Cell. 1996; 85: 1077-1088Abstract Full Text Full Text PDF PubMed Scopus (653) Google Scholar, 14Ganot P. Bortolin M-L. Kiss T. Cell. 1997; 89: 799-809Abstract Full Text Full Text PDF PubMed Scopus (486) Google Scholar). Final processing and assembly of the rRNAs, together with ∼80 ribosomal proteins, occur within the GC region and result in the formation of preribosomes that are eventually exported to the cytoplasm to become major components of the translation machinery (15Hadjiolov A.A. The Nucleolus and Ribosome Biogenesis. Springer-Verlag Wien, New York1985Crossref Google Scholar, 16Leary D.J. Huang S. FEBS Lett. 2001; 509: 145-150Crossref PubMed Scopus (103) Google Scholar).Although the general processing pathway is conserved through evolution, the mechanism of rRNA production tends to be more complex when going from yeast to human. The process is better defined in yeast because of available genetic screenings (17Venema J. Tollervey D. Annu. Rev. Genet. 1999; 33: 261-311Crossref PubMed Scopus (649) Google Scholar, 18Warner J.R. Cell. 2001; 107: 133-136Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Most yeast factors have mammalian counterparts but because a mammalian nucleolus is more complex in structure and function, not all nucleolar proteins in higher eukaryotes have yeast homologues. Furthermore, if a mammalian homologue exists, it cannot always reverse the mutant yeast phenotype. For example, mammalian nucleolin, a homologue of the yeast NSR1, cannot complement the yeast nsr1-Δ mutant (19Lee W.-C. Zabetakis D. Melese T. Mol. Cell. Biol. 1992; 12: 3865-3871Crossref PubMed Scopus (110) Google Scholar). This shortcoming in the yeast system dictates that a different system must be employed to identify protein function.The Xenopus laevis oocyte offers an alternative system for functional analyses of proteins with advantages that include large size and convenient physical and biochemical manipulations. Factors that may alter gene expression are conveniently microinjected, and the oocyte fractions can then be analyzed. This technique has been used to study proteins and RNAs involved in rRNA processing in the X. laevis oocyte (20Amaldi F. Bozzoni I. Beccari E. Pierandrei-Amaldi P. Trends Biochem. Sci. 1989; 14: 175-178Abstract Full Text PDF PubMed Scopus (63) Google Scholar, 21Savino R. Gerbi S.A. EMBO J. 1990; 9: 2299-2308Crossref PubMed Scopus (179) Google Scholar, 22Caizergues-Ferrer M. Mathieu C. Mariottini P. Amalric F. Amaldi F. Development. 1991; 112: 317-326PubMed Google Scholar, 23Heine M.A. Rankin M.L. DiMario P.J. Mol. Biol. Cell. 1993; 4: 1189-1204Crossref PubMed Scopus (61) Google Scholar, 24Cairns C. McStay B. J. Cell Sci. 1995; 108: 3339-3347PubMed Google Scholar, 25Peculis B.A. Mol. Cell. Biol. 1997; 17: 3702-3713Crossref PubMed Scopus (66) Google Scholar, 26Dunbar D.A. Baserga S.J. RNA. 1998; 4: 195-204PubMed Google Scholar). Despite the convenience of using frog oocytes, details on the mechanism of rRNA synthesis in higher eukaryotes lag behind when compared with those in yeast. At least 16 putative helicases or DEAD box proteins have been genetically and biochemically implicated in yeast rRNA production (27Tanner N.K. Linder P. Mol. Cell. 2001; 8: 251-262Abstract Full Text Full Text PDF PubMed Scopus (605) Google Scholar), but none has been demonstrated in higher eukaryotes.A nucleolar protein hypothesized to function in the biogenesis of rRNA is RNA helicase II/Gu (Gu). We previously reported the cloning and characterization of mammalian Gu, a protein with 5′ to 3′ RNA unwinding activity (28Valdez B.C. Henning D. Busch R.K. Woods K. Flores-Rozas H. Hurwitz J. Perlaky L. Busch H. Nucleic Acids Res. 1996; 24: 1220-1224Crossref PubMed Scopus (71) Google Scholar, 29Flores-Rozas H. Hurwitz J. J. Biol. Chem. 1993; 268: 21372-21383Abstract Full Text PDF PubMed Google Scholar). Gu also contains a functionally distinct domain at its C terminus that is able to introduce secondary structure to single-stranded RNA (30Valdez B.C. Eur. J. Biochem. 2000; 267: 6395-6402Crossref PubMed Scopus (24) Google Scholar). We recently identified Guβ, a paralogue of the original Gu, which we now call Guα. The two proteins are products of structurally related adjacent genes on human chromosome 10 and may have evolved by gene duplication (31Valdez B.C. Yang H. Hong E. Sequitin A.M. Gene (Amst.). 2002; 284: 53-61Crossref PubMed Scopus (10) Google Scholar). The shuttling of Guα between the nucleolus and nucleoplasm (32Valdez B.C. Perlaky L. Cai Z.-J. Busch H. BioTechniques. 1998; 24: 1032-1036Crossref PubMed Scopus (12) Google Scholar) supports our recent report on the activation of c-Jun-regulated transcriptions by Guα (33Westermarck J. Weiss C. Saffrich R. Kast J. Musti A.-M. Wessely M. Ansorge W. Seraphin B. Wilm M. Valdez B.C. Bohmann D. EMBO J. 2002; 21: 451-460Crossref PubMed Scopus (94) Google Scholar). The localization of Guα in the nucleolus and its RNA unwinding and annealing activities indicate a possible role in the production of highly structured rRNAs.To gain more information about the role of Guα in rRNA production, we cloned its Xenopus homologue. In this paper, we demonstrate that down-regulation of Guα results in aberrant rRNA production in Xenopus oocytes. This is the first report showing the function of an RNA helicase in the biogenesis of rRNA in higher eukaryotes.EXPERIMENTAL PROCEDURESCloning of the X. laevis Guα Homologue—Using the mouse Guα cDNA (34Valdez B.C. Wang W. Genomics. 2000; 66: 184-194Crossref PubMed Scopus (9) Google Scholar), the EST Data Bank was searched for its frog homologue. This search resulted in two almost identical X. laevis sequences; both are homologous to the 3′ two-thirds of the mouse Guα cDNA sequence. The sequences were designated xGu-1 (GenBank™ accession number AF302423) and xGu-2 (GenBank™ accession number AF302422).To obtain full-length cDNA clones, a X. laevis oocyte cDNA library (Clontech) was screened according to standard protocols. A probe was prepared based on the obtained EST Data Bank sequences. BV602 (5′-ACCTGGCCGTGTGAGAGATCTTGTCCA-3′) and BV603 (5′-GATGAACATAAGCATCTGCTTCCTTTG-3′) were used to synthesize partial xGu cDNA from a liver total RNA using the One-Step RT-PCR kit (Qiagen). The 600-nucleotide cDNA fragment was randomly labeled (50 ng) with [α-32P]dCTP using a RadPrime DNA labeling system (Invitrogen). Prehybridization and hybridization of the membranes with the labeled probe were carried out according to standard procedures (35Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 7.43-7.52Google Scholar). Positive plaques were purified and rescreened according to the procedure that came with the cDNA library.Lambda phage clones were converted to phagemid using BM25.8 Escherichia coli cells. Phagemid DNA was purified and analyzed using EcoRI and XbaI. The clones with the longest inserts were sequenced. This screening resulted in the isolation of two clones with full-length xGu-1 and xGu-2 sequences.Isolation of Total RNA from Xenopus Tissues—Oocyte-positive human chorionic gonadotropin-tested female X. laevis were purchased from Xenopus Express. Different tissues were dissected from the frogs and stored at -80 °C. TRIZOL reagent (Invitrogen) was used to isolate total RNA from 100 mg of homogenized tissue. RNA samples were quantified spectrophotometrically, and the quality was determined by formaldehyde gel electrophoresis.Northern Blot Hybridization—A mixture of total RNA (10 μg in 5 μl of H2O) was treated according to standard protocol and separated on a 1.4% agarose-formaldehyde gel, blotted onto nitrocellulose membrane, and analyzed by Northern blot (35Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 7.43-7.52Google Scholar) using the same 32P-labeled probes. The analysis of xGu mRNA was done with the same 32P-labeled probe described above. The analysis of rRNAs used 32P end-labeled oligodeoxynucleotides such as 18 S-5′ (5′-TTGAGACAAGCATATGCTACT-3′) and 28 S-5′ (5′-GTCGCCGCGTCTGATCTGAGG-3′). The level of 20 S rRNA was analyzed using a mixture of 32P end-labeled ITS1A (5′-CGAGACCCCCCTCACCCGGAGAGAGGGAAGGCGCCCGCCGCACCCTCCCCGCGG-3′) and ITS1B (5′-GCGGGCGTCTCTCTCTCTCTCCGCGGGGAGGGTGCGGCGGG-3′) as described previously (36Peculis B.A. Steitz J. Cell. 1993; 73: 1233-1245Abstract Full Text PDF PubMed Scopus (215) Google Scholar).Western Blot Analysis—Large scale preparation of oocyte extract was carried out by freon extraction to remove yolk protein as described (37Evans J.P. Kay B.K. Methods in Cell Biology. Academic Press Inc., New York1991: 133-148Google Scholar). Approximately 5 μg of this extract was analyzed by a colorimetric Western blot method using alkaline phosphatase.For small scale preparations, germinal vesicles were manually isolated with forceps and boiled in Laemmli buffer. The samples were loaded onto 10% polyacrylamide-SDS gels and analyzed either by a colorimetric method or by a chemiluminescence detection system using an ECL Plus kit (Amersham Biosciences).RT-PCR—A One-Step RT-PCR kit was used to quantitatively analyze mRNA levels using the sets of primers listed in Table I. Each RT-PCR contained 100 ng of total RNA, 5 μl of 5× RT-PCR buffer, 5 μl of 5× Q-solution, 200 μm dATP, 200 μm dTTP, 200 μm dGTP, 200 μm dCTP, 0.5 μl of 10 units/μl RNAsin, 1 μl of RT-PCR enzyme mix, and 2 μm each primer in 25 μl of total volume. The RT-PCR was carried out at 50 °C for 30 min and at 95 °C for 15 min. Amplification was done at 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min (30 cycles). The reaction was extended at 72 °C for 10 min. The RT-PCR products were analyzed in a 1% agarose gel, visualized under UV light, and photographed using the Eagle Eye II system (Stratagene). The intensity of the DNA bands was measured in pixels with the Eagle Eye II system. β-Actin bands were used as internal controls.Table IName5′ → 3′ sequenceGene1BV672AAGAACATAACAAGTGATGATxGu-1 onlyBV673GTTCCTCCGTAAAAACACGAG2BV646AAATCATCGATGCCCGGGAAxGu-2 onlyBV675TTTTGGACAAGATCTCTTATG3BV805ATCAACAACAATAATCCGACxGu-1 and xGu-2BV796AGAGTACAATACTACAAGGT4BV698GCACGAGCCGCATAGAAAGGAxβ-actinBV699ACTGGGTGTTCTTCTGGTGCA5BV809GAGGGAGTTCTTTTCAAAGAxC23BV810ATATGCAATCCCTTTATTTG6BV811GCTTTAGAAGATCTTGAATCxB23BV812CTTCCACTTTAGGAAGAACA Open table in a new tab Cellular Localization of xGu—A X. laevis kidney cell line (A6) was obtained from ATCC. The cells were grown on a chamber slide containing 75% National Cancer Tissue Culture 109 medium (Invitrogen), 15% water, and 10% fetal bovine serum in a 5% CO2 incubator at 26 °C. The cells were analyzed by double indirect immunofluorescence (38Perlaky L. Valdez B.C. Busch R.K. Larson R.G. Jhiang S.M. Zhang W.W. Brattain M. Busch H. Cancer Res. 1992; 52: 428-436PubMed Google Scholar) using anti-xGu and anti-xC23 antibodies. The antibody against X. laevis nucleolin/C23 (b6-6E7) was obtained from the Developmental Studies Hybridoma Bank at the University of Iowa.Expression, Purification, and Enzyme Assays of GST Fusion Proteins—The cDNA fragment of xGu-2 that encodes amino acids 2-800 was PCR-amplified using BV655 (5′-AAATCATGGAATTCCGGGAAAGTTTATACCGATGA-3′) and BV608 (5′-TTGGCATGTCTCGAGTCACTAACGGCCCTTCTAA-3′) and a phagemid containing xGu-2 cDNA. The PCR product was subcloned into the EcoRI/XhoI sites of the pGEX 4T-3 vector.Site-directed mutation of the DEVD motif to ASVD was carried out by PCR. The full-length mutant was also subcloned into the pGEX 4T-3 vector. All of the fusion proteins were expressed and purified described previously for GST-human Guα (28Valdez B.C. Henning D. Busch R.K. Woods K. Flores-Rozas H. Hurwitz J. Perlaky L. Busch H. Nucleic Acids Res. 1996; 24: 1220-1224Crossref PubMed Scopus (71) Google Scholar).For RNA helicase assays, a partially double-stranded RNA with a 34-nucleotide duplex was synthesized from pBluescript vector as reported previously (Ref. 28Valdez B.C. Henning D. Busch R.K. Woods K. Flores-Rozas H. Hurwitz J. Perlaky L. Busch H. Nucleic Acids Res. 1996; 24: 1220-1224Crossref PubMed Scopus (71) Google Scholar; see also Fig. 8). Annealing of RNAs, gel purification of the substrates, and the helicase assays were done as described (28Valdez B.C. Henning D. Busch R.K. Woods K. Flores-Rozas H. Hurwitz J. Perlaky L. Busch H. Nucleic Acids Res. 1996; 24: 1220-1224Crossref PubMed Scopus (71) Google Scholar, 29Flores-Rozas H. Hurwitz J. J. Biol. Chem. 1993; 268: 21372-21383Abstract Full Text PDF PubMed Google Scholar) with minor modifications. Briefly, RNA helicase assays were carried out in a 20-μl reaction mixture containing 20 mm HEPES-KOH, pH 7.6, 2 mm dithiothreitol, 3 mm MgCl2, 3 mm ATP, 0.1 m KCl, 2 units of RNAsin, 50 fmol of 32P-labeled double-stranded RNA substrate, and the enzyme fraction at 37 °C for 30 min. The reactions were stopped by adding 5 μl of stop buffer (0.1 m Tris-HCl, pH 7.4, 20 mm EDTA, 1.3% SDS, 0.1% Nonidet P-40, 0.1% bromphenol blue, 0.1% xylene cyanol, 42% glycerol, and 0.8 mg/ml proteinase K) to the 20-μl reaction mix, and incubated at 37 °C for 5 min prior to loading of 12.5 μl of reaction mix onto 10% SDS-PAGE gel. After electrophoresis at 100 volts, the gel was dried and analyzed by phosphorus imaging.Assays for RNA folding activity were done as described previously (30Valdez B.C. Eur. J. Biochem. 2000; 267: 6395-6402Crossref PubMed Scopus (24) Google Scholar). An [α-32P]GTP-labeled T7 RNA polymerase transcript from a HindIII-cut pBluescript II KS plasmid was synthesized, gel-purified, and dissolved in buffer containing 20 mm HEPES, pH 7.6, 0.2 m KCl, 0.1 mm EDTA. The single-stranded RNA substrate was appropriately diluted, boiled for 10 min, and cooled on ice just before using. RNA folding assay was done in 20 μl of reaction buffer containing 20 mm HEPES-KOH, pH 7.6, 2 mm dithiothreitol, 3 mm MgCl2, 0.1 m KCl, 2 units of RNAsin, 100 fmol of 32P-labeled ssRNA substrate and enzyme fraction at 37 °C for 30 min. The reaction was stopped by adding 5 μl of stop buffer and analyzed as described above for helicase assay.Production of Anti-xGu Antibody—The cDNA region of xGu-1 that encodes amino acids 245-759 (92% identical to xGu-2) was amplified by RT-PCR using BV609 (5′-AAGCTAAATGCTAGCCAACAGCCATTGGCTAGAGG-3′) and BV610 (5′-TGTTCGGACCTCGAGACGGCCC-CTTCTAAACCCC-3′) and 1 μg of frog liver total RNA using the SuperScript One-Step RT-PCR System (Invitrogen). The amplified cDNA fragment was digested with NheI and XhoI and subcloned into the pTYB3 expression vector (New England Biolabs, Inc.).Protein expression was done by isolating plasmid DNA from the DH5α clone and transforming BL21-CodonPlus competent cells (Stratagene). The recombinant protein was purified according to the IMPACT T7: One-Step Protein Purification System protocol (New England Biolabs, Inc.). The purified protein was equilibrated overnight against a dialysis buffer (20 mm HEPES, pH 7.6, 0.1 mm EDTA, 0.5 m NaCl, 0.1% Triton X-100) and sent to Rockland, Inc. for antibody production in rabbit.Affinity Purification of Anti-xGu Antibody—A polyclonal antibody was raised against xGu-1 protein as described above. Affinity purification was carried out using xGu-2 protein to purify antibody that recognized both xGu-1 and xGu-2. GST and GST-xGu-2 were separately immobilized onto cyanogen bromide-activated Sepharose (Sigma). The rabbit serum containing anti-xGu antibody was diluted 3-fold in 1× PBS and passed twice through a GST affinity column (1 ml) to eliminate nonspecific binding. The flow-through from this GST column was passed through a GST-xGu-2 affinity column (1 ml) twice. The GST-xGu-2 column was washed consecutively with 15 ml of 1× PBS, 10 ml of 1× PBS containing 1.8 m KCl (pH 7.6), and 10 ml of 1× PBS or until absorbance of the wash at 280 nm was 0. Bound antibodies were eluted with 0.2 m glycine (pH 2.2), and each 1-ml fraction was collected into a tube containing 0.4 ml of 1 m Tris-HCl (pH 8.0). All of the fractions were kept on ice, and absorbance at 280 nm was measured. Fractions with at least A 280 = 0.05 were dialyzed for 24 h against 1× PBS. The dialyzed fractions were concentrated using Microcon YM 30 (Millipore), and the protein concentration was determined using a Bio-Rad protein assay kit.Isolation of Frog Oocytes—Oocytes were surgically removed from a female X. laevis obtained from Xenopus Express and tumbled with 2 mg/ml type I collagenase (Sigma) in Ca2+-free modified Barth's saline medium (20 mm HEPES, pH 7.5, 88 mm NaCl, 1 mm KCl, 2.4 mm NaHCO3, 0.82 mm MgSO4) at room temperature until most of the oocytes were free. The oocytes were washed thoroughly with this medium and stored overnight at 18 °C in a modified Barth's saline medium (20 mm HEPES, pH 7.5, 88 mm NaCl, 1 mm KCl, 2.4 mm NaHCO3, 0.82 mm MgSO4, 0.33 mm Ca(NO3)2, 0.41 mm CaCl2).Microinjection of Antisense Oligodeoxynucleotides and Analysis of rRNA—Different antisense phosphodiester oligodeoxynucleotides (Integrated DNA Technologies, Inc.) with perfect complementation to both xGu-1 and xGu-2 mRNAs were used in this study (Table II). Stage V and VI oocytes were selected for cytoplasmic microinjection with 32.2 nl of antisense oligonucleotide (1 ng/nl). After 6 h of incubation at 18 °C in modified Barth's saline medium, the oocytes were microinjected with a mixture of 16.1 nl of antisense oligonucleotide and 16.1 nl of [α-32P]GTP (3,000 Ci/mmol and 10 μCi/ul). After further incubation for 18 h at 18 °C, the oocytes were homogenized in 50 μl of homogenization buffer/oocyte (50 mm NaCl, 50 mm Tris-HCl, pH 7.5, 5 mm EDTA, 0.5% SDS, 200 μg/ml proteinase K) and incubated at 37 °C for 1 h. Samples were extracted with phenol:chloroform:iso-amyl alcohol (25:24:1) twice and with chloroform once. Nucleic acids were precipitated with ethanol. Total RNA equivalent to 1.5 oocytes was loaded per lane and resolved on a 1% agarose formaldehyde denaturing gel. Initial electrophoresis was done at 100 volts for 1 h and continued at 140 volts for 2 h. The gel was washed twice with water for 5 min followed with 10× SSC for 15 min. RNA was passively transferred onto a nitrocellulose membrane with 10× SSC overnight. The membrane was air-dried for 30 min and exposed to a phosphorus imaging screen (Molecular Dynamics). The results were obtained by scanning the screen using STORM 860 PhosphorImager and analyzed with ImageQuant software (Molecular Dynamics).Table IIName5′ → 3′ SequencePosition relative to ATG of xGu-1BV786CGAGGTCCGCAGGTGACCAC−56 to −37BV787CCGGGCATCGATGATTTCTC−12 to 8BV788CTTGGGTAGAGGAGTTTCAG62 to 81BV789TTATTGTTGTTGATCTCTCC154 to 173BV790CTTGGATCTGGCTGCTCTCC250 to 269BV791TCTTTTCTTAGGAGCTGGTT422 to 441BV792ACAACATCTTTGCCACTGTA640 to 659BV793ACTAAGAAGTCAATTCCATC898 to 917BV794CTCAACTTGTTCGGAGAAGC1022 to 1041BV795TCCACTGTACACCTGAACTA1268 to 1287BV796AGAGTACAATACTACAAGGT1502 to 1521BV797CCAGTTGTTCTTTAATTGAT1947 to 1966BV798AAAGGTCTCCTCCCTCTTCC2173 to 2192 Open table in a new tab The 5.8 S rRNA was analyzed on a 10% polyacrylamide/7 m urea gel. A 4-8 S HeLa RNA fraction prepared according to Reddy et al. (39Reddy R. Li W-Y. Henning D. Choi Y.C. Nohga K. Busch H. J. Biol. Chem. 1981; 256: 8452-8457Abstract Full Text PDF PubMed Google Scholar) was used as nonradioactive markers. After electrophoresis, the denaturing gel was stained with 0.2% methylene blue for 10 min at room temperature, destained with water, vacuum dried, and analyzed by autoradiography.Determination of Half-life—The oocytes were microinjected with 32.2 nl of antisense BV795 (1 ng/nl) and incubated in a modified Barth's saline medium containing 1 mg/ml cycloheximide to stop protein synthesis (40Gard D.L. Hafezi S. Zhang T. Doxsey S. J. Cell Biol. 1990; 110: 2033-2042Crossref PubMed Scopus (149) Google Scholar). In the event cycloheximide did not completely inhibit synthesis of xGu protein, the microinjection of BV795 would contribute to the inhibition of such synthesis by degradation of xGu mRNA. Ten nuclei were manually isolated after incubation of oocytes for 0, 2, 3, 4, and 5 h and used for immunoblot analysis. Signal intensities were quantitated using a densitometer and ImageQuant software.Rescue Experiment—The full coding sequence of xGu-1 cDNA (wild type and mutant) was amplified using BV863 (5′-CTGGTTCCGCGTGGATCCATGCCCGTGAAGGTTTA-3′) and BV864 (5′-GTCACGATGCGGGAGCTCGAGTCACTAACGGCCCC-3′) and subcloned into the BamHI and SstI sites of modified pSP64(poly(A)) vector (41Li J. O'Malley B.W. Wong J. Mol. Cell. Biol. 2000; 20: 2031-2042Crossref PubMed Scopus (115) Google Scholar). The inserts were sequenced to prove absence of mutations. The EcoRI-linearized constructs were used as templates to in vitro synthesize xGu-1 mRNA using the Ambion MEGAscript SP6 kit. The sizes of the RNA products were checked on a formaldehyde-agarose gel. The RNA products were then used as templates for in vitro translation, and the resulting proteins were analyzed by Western blot using anti-xGu antibody.Stage V and VI oocytes were selected for cytoplasmic microinjection with 32.2 nl of 1 ng/nl BV795 antisense oligonucleotide. After 4 h at 18 °C in modified Barth's saline medium, the oocytes were microinjected a second time with 16.1 nl of in vitro transcribed mRNA (1 ng/nl) together with 16.1 nl of [α-32P]GTP. The oocytes were further incubated at 18 °C in modified Barth's saline medium for 18-20 h prior to total RNA isolation and analysis as described above.Microinjection of Anti-xGu Antibody—Stage V and VI oocytes were selected for nuclear microinjection with 18.4 nl of affinity-purified anti-xGu antibody (1 ng/nl). After 4 h at 18 °C in modified Barth's saline medium, the oocytes were microinjected a second time with 9.2 nl of the same antibody together with 9.2 nl of [α-32P]GTP. The oocytes were further incubated at 18 °C in modified Barth's saline medium for 18-20 h prior to total RNA isolation and analysis.Immunoelectron Microscopy—PtK2 cells (rat kangaroo kidney epithelial cells; ATCC) were grown as monolayers and prepared for Nanogold immunoelectron microscopy as previously described (42Ochs R.L. Stein Jr., T.W. Tan E.M. J. Cell Sci. 1994; 107: 385-399PubMed Google Scholar) using a 1:1000 dilution of human serum containing anti-Guα antibody (28Valdez B.C. Henning D. Busch R.K. Woods K. Flores-Rozas H. Hurwitz J. Perlaky L. Busch H. Nucleic Acids Res. 1996; 24: 1220-1224Crossref PubMed Scopus (71) Google Scholar).RESULTSPrimary Structures of the Two X. laevis RNA Helicase II/Gu Proteins—Two cDNA clones from X. laevis that are highly homologous to mammalian Guα protein are identified in this study. The amino acid sequences deduced from these two cDNA clones are 90% identical, excluding the 44-amino acid region present only in xGu-2 (Fig. 1). The presence of two Gu genes in X. laevis with 10% sequence divergence is consistent with the pseudotetraploid genetic make-up of this species (43Graf J-D. Kobel H.R. Methods in Cell Biology. Academic Press Inc., New York1991: 19-34Google Scholar).Fig. 1Alignment of the cDNA-derived amino acid sequences of mouse Guα (mGu- α), and the two X. laevis homologues xGu-1 and xGu-2. Conserved amino acid residues among three (or between two protein sequences) are in red. Conservative substitutions are indicated in blue, nonconserved residues are in black, and missing residues are shown by dashes. Motifs conserved among RNA helicases are in boxes. Repeats at the N-terminal region are indicated with long arrows. The FRGQR repeats at the C-terminal region are underlined. The sequences of
Referência(s)