Pancreatic Acinar Cells Express Vesicle-associated Membrane Protein 2- and 8-Specific Populations of Zymogen Granules with Distinct and Overlapping Roles in Secretion
2007; Elsevier BV; Volume: 282; Issue: 13 Linguagem: Inglês
10.1074/jbc.m611108200
ISSN1083-351X
AutoresNing Weng, Diana D.H. Thomas, Guy E. Groblewski,
Tópico(s)Lipid Membrane Structure and Behavior
ResumoPrevious studies have demonstrated roles for vesicle-associated membrane protein 2 (VAMP 2) and VAMP 8 in Ca2+-regulated pancreatic acinar cell secretion, however, their coordinated function in the secretory pathway has not been addressed. Here we provide evidence using immunofluorescence microscopy, cell fractionation, and SNARE protein interaction studies that acinar cells contain two distinct populations of zymogen granules (ZGs) expressing either VAMP 2 or VAMP 8. Further, VAMP 8-positive granules also contain the synaptosome-associated protein 29, whereas VAMP 2-expressing granules do not. Analysis of acinar secretion by Texas red-dextran labeling indicated that VAMP 2-positive ZGs mediate the majority of exocytotic events during constitutive secretion and also participate in Ca2+-regulated exocytosis, whereas VAMP 8-positive ZGs are more largely involved in Ca2+-stimulated secretion. Previously undefined functional roles for VAMP and syntaxin isoforms in acinar secretion were established by introducing truncated constructs of these proteins into permeabilized acini. VAMP 2 and VAMP 8 constructs each attenuated Ca2+-stimulated exocytosis by 50%, whereas the neuronal VAMP 1 had no effects. In comparison, the plasma membrane SNAREs syntaxin 2 and syntaxin 4 each inhibited basal exocytosis, but only syntaxin 4 significantly inhibited Ca2+-stimulated secretion. Syntaxin 3, which is expressed on ZGs, had no effects. Collectively, these data demonstrate that individual acinar cells express VAMP 2- and VAMP 8-specific populations of ZGs that orchestrate the constitutive and Ca2+-regulated secretory pathways. Previous studies have demonstrated roles for vesicle-associated membrane protein 2 (VAMP 2) and VAMP 8 in Ca2+-regulated pancreatic acinar cell secretion, however, their coordinated function in the secretory pathway has not been addressed. Here we provide evidence using immunofluorescence microscopy, cell fractionation, and SNARE protein interaction studies that acinar cells contain two distinct populations of zymogen granules (ZGs) expressing either VAMP 2 or VAMP 8. Further, VAMP 8-positive granules also contain the synaptosome-associated protein 29, whereas VAMP 2-expressing granules do not. Analysis of acinar secretion by Texas red-dextran labeling indicated that VAMP 2-positive ZGs mediate the majority of exocytotic events during constitutive secretion and also participate in Ca2+-regulated exocytosis, whereas VAMP 8-positive ZGs are more largely involved in Ca2+-stimulated secretion. Previously undefined functional roles for VAMP and syntaxin isoforms in acinar secretion were established by introducing truncated constructs of these proteins into permeabilized acini. VAMP 2 and VAMP 8 constructs each attenuated Ca2+-stimulated exocytosis by 50%, whereas the neuronal VAMP 1 had no effects. In comparison, the plasma membrane SNAREs syntaxin 2 and syntaxin 4 each inhibited basal exocytosis, but only syntaxin 4 significantly inhibited Ca2+-stimulated secretion. Syntaxin 3, which is expressed on ZGs, had no effects. Collectively, these data demonstrate that individual acinar cells express VAMP 2- and VAMP 8-specific populations of ZGs that orchestrate the constitutive and Ca2+-regulated secretory pathways. The exocrine pancreas is responsible for synthesizing and secreting a variety of digestive enzymes that are essential for assimilation of the diet. Secretion occurs by exocytosis of large dense core zymogen granules (ZGs) 3The abbreviations used are: ZG, zymogen granule; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor; VAMP, vesicle-associated membrane protein; SNAP, synaptosome-associated protein; PFO, Perfringolysin O; GST, glutathione S-transferase; FITC, fluorescein isothiocyanate; MOPS, 4-morpholinepropanesulfonic acid. localized in the apical cytoplasm of acinar cells. Similar to endocrine and neural cells, exocytosis is highly induced following acinar stimulation by secretagogues; however, acini are unique in that a significant proportion of exocytosis also occurs by a constitutive pathway under basal conditions. Secretagogue-stimulated exocytosis is mediated by G protein-coupled receptors, which signal through phospholipase C and/or adenylate cyclase, and numerous studies have established roles for Ca2+, diacylglycerol, and cAMP in modulating secretion (reviewed in Ref. 1Williams J.A. Annu. Rev. Physiol. 2001; 63: 77-97Crossref PubMed Scopus (194) Google Scholar). For acinar cells of the pancreas, changes in cellular Ca2+ play a pivotal role to trigger exocytosis under normal conditions, and furthermore, during pathophysiological states, aberrant increases in Ca2+ may induce cell damage leading to the onset of pancreatitis (reviewed in Ref. 2Sutton R. Criddle D. Raraty M.G. Tepikin A. Neoptolemos J.P. Petersen O.H. Pancreatology. 2003; 3: 497-505Crossref PubMed Scopus (90) Google Scholar). The process of exocytosis and other membrane fusion events is widely held to be regulated by soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) interactions in cells (3Fasshauer D. Antonin W. Margittai M. Pabst S. Jahn R. J. Biol. Chem. 1999; 274: 15440-15446Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar, 4Weber T. Zemelman B.V. McNew J.A. Westermann B. Gmachl M. Parlati F. Sollner T.H. Rothman J.E. Cell. 1998; 92: 759-772Abstract Full Text Full Text PDF PubMed Scopus (2021) Google Scholar, 5Jahn R. Sudhof T.C. Annu. Rev. Biochem. 1999; 68: 863-911Crossref PubMed Scopus (1025) Google Scholar). SNARE proteins are classified as either Q-SNARE or R-SNARE based on conserved glutamine (Q) and arginine (R) residues positioned within their characteristic coiled-coil motifs. When brought in close opposition, Q- and R-SNAREs on each membrane form a heterotrimeric complex that provides the driving force for membrane fusion. In neurons, one R-containing coil of the complex is derived from vesicle-associated membrane protein (VAMP/synaptobrevin) present on synaptic vesicles, and one Q-containing coil is contributed by syntaxin 1 located on the pre-synaptic plasma membrane. The remaining two coils of the complex are contributed by synaptosome-associated protein (SNAP) 25, a Q-SNARE also located on the plasma membrane (6Sutton R.B. Fasshauer D. Jahn R. Brunger A.T. Nature. 1998; 395: 347-353Crossref PubMed Scopus (1932) Google Scholar). VAMPs and syntaxins are integrated into phospholipids via C-terminal hydrophobic regions that orient their coiled-coil motifs into the cytoplasm. Uniquely, SNAP 25 is membrane inserted by palmitoylation of four central cysteine residues positioning separate amino and carboxyl coiled-coil motifs into the cytoplasm (7Steegmaier M. Yang B. Yoo J.S. Huang B. Shen M. Yu S. Luo Y. Scheller R.H. J. Biol. Chem. 1998; 273: 34171-34179Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 8Washbourne P. Cansino V. Mathews J.R. Graham M. Burgoyne R.D. Wilson M.C. Biochem. J. 2001; 357: 625-634Crossref PubMed Scopus (80) Google Scholar). Pancreatic acinar cells express SNAP 23, an isoform of SNAP 25, (9Gaisano H.Y. Sheu L. Wong P.P. Klip A. Trimble W.S. FEBS Lett. 1997; 414: 298-302Crossref PubMed Scopus (72) Google Scholar, 10Wang C.C. Ng C.P. Lu L. Atlashkin V. Zhang W. Seet L.F. Hong W. Dev. Cell. 2004; 7: 359-371Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar), and also contain multiple syntaxin isoforms with discrete localizations, including syntaxin 2 on apical plasma membrane, syntaxin 3 on ZGs, and syntaxin 4 on both apical and basolateral membranes (10Wang C.C. Ng C.P. Lu L. Atlashkin V. Zhang W. Seet L.F. Hong W. Dev. Cell. 2004; 7: 359-371Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 11Gaisano H.Y. Ghai M. Malkus P.N. Sheu L. Bouquillon A. Bennett M.K. Trimble W.S. Mol. Biol. Cell. 1996; 7: 2019-2027Crossref PubMed Scopus (173) Google Scholar, 12Hansen N.J. Antonin W. Edwardson J.M. J. Biol. Chem. 1999; 274: 22871-22876Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). ZGs also express VAMP 2, which modulates a portion of exocytosis, because cleavage of this protein by tetanus toxin led to a significant but incomplete reduction in stimulated secretion in permeabilized cells and in vitro fusion assays (12Hansen N.J. Antonin W. Edwardson J.M. J. Biol. Chem. 1999; 274: 22871-22876Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 13Gaisano H.Y. Sheu L. Foskett J.K. Trimble W.S. J. Biol. Chem. 1994; 269: 17062-17066Abstract Full Text PDF PubMed Google Scholar, 14Padfield P.J. FEBS Lett. 2000; 484: 129-132Crossref PubMed Scopus (9) Google Scholar). Additionally, we previously reported in abstract form (15Weng N. Thomas D.D. Groblewski G. FASEB J. 2005; 19: A742Google Scholar) that VAMP 8 is present on ZGs, results that were unexpected as VAMP 8 was initially described as endobrevin, due to its purported role in endosomal vesicle fusion (16Antonin W. Holroyd C. Tikkanen R. Honing S. Jahn R. Mol. Biol. Cell. 2000; 11: 3289-3298Crossref PubMed Scopus (127) Google Scholar). More recently, Wang et al. (10Wang C.C. Ng C.P. Lu L. Atlashkin V. Zhang W. Seet L.F. Hong W. Dev. Cell. 2004; 7: 359-371Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) showed that genetic ablation of VAMP 8 in mice did not significantly disrupt endosomal trafficking. Rather, VAMP 8 null mice exhibited pronounced alterations in exocrine pancreas morphology corresponding with elevated levels of basal secretion but a compromised response to stimulated secretion (10Wang C.C. Ng C.P. Lu L. Atlashkin V. Zhang W. Seet L.F. Hong W. Dev. Cell. 2004; 7: 359-371Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Although VAMP 2 and VAMP 8 are known to regulate acinar secretion, their concerted function in the overall secretory response has not been investigated. Likewise, despite having identified the major apical membrane Q-SNAREs syntaxin 2 and syntaxin 4, a definitive role for these molecules in the constitutive and regulated secretory pathways has not been established. In this study, we examined the SNARE complexes in pancreatic acinar cells that mediate the constitutive and Ca2+-stimulated secretory pathways. Evidence demonstrates that individual acinar cells contain distinct populations of ZGs expressing either VAMP 2 or VAMP 8. Utilizing dextran labeling to identify sites of VAMP-specific ZG exocytosis indicated that VAMP 2-positive granules were highly localized at the apical plasma membrane under both basal and Ca2+-stimulated conditions. In comparison, VAMP 8-positive granules were much less concentrated at the apical membrane and appeared to interact with the plasma membrane at regions that were distinct from VAMP-2/dextran staining. Utilization of truncated SNARE constructs in permeabilized acini revealed that syntaxin 4, which is known to interact with VAMP 8, selectively inhibited Ca2+-stimulated secretion, whereas syntaxin 2, which is exclusively present on the apical membrane, inhibited only the constitutive pathway. Taken together, these data indicate that VAMP 2 plays a major role in the constitutive secretory pathway and participates in Ca2+-regulated secretion. In comparison, VAMP 8-positive granules appear to be more involved in Ca2+-stimulated exocytosis. Antibodies—Anti-SNAP 29 (catalog no. 111 302), anti-Syntaxin 2 (catalog no. 110 022), anti-syntaxin 4 (catalog no. 110 042), anti-VAMP 8 (catalog no. 104 302), rabbit polyclonal antibodies, and anti-VAMP 2 (catalog no. 104 211) mouse monoclonal antibody c169.1 were purchased from Synaptic Systems. Anti-syntaxin 4 (catalog no. 610439) mouse monoclonal antibody clone 49 was purchased from BD Transduction Laboratories. Anti-VAMP 2 (catalog no. VAS-SV006C) rabbit polyclonal antibody was purchased from StressGen. Anti-SNAP 23 (catalog no. ab 4114) polyclonal antibody was purchased from Abcam. Anti-VAMP 2 (cat AB5625) chicken polyclonal antibody was purchased from Chemicon. Anti-VAMP 8 rabbit polyclonal antibody was provided by Thomas Weimbs (17Low S.H. Li X. Miura M. Kudo N. Quinones B. Weimbs T. Dev. Cell. 2003; 4: 753-759Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar), and anti-SNAP 29 rabbit polyclonal antibody was from Mia Horowitz (18Rotem-Yehudar R. Galperin E. Horowitz M. J. Biol. Chem. 2001; 276: 33054-33060Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Alexa-conjugated secondary antibodies (488, 546, 594, and 647), Alexa 488-conjugated anti-FITC, FITC, 3000K Texas red dextran, Rhodamine-Phalloidin, and Zenon secondary labeling kits were purchased from Molecular Probes. Peroxidase-conjugated sheep anti-mouse IgG and donkey anti-rabbit IgG were purchased from Amersham Biosciences. Other Reagents—Soybean trypsin inhibitor, benzamidine, phenylmethanesulfonyl fluoride, Percoll, and Triton X-100 were purchased from Sigma, essential amino acid solution was from Invitrogen, and a protease inhibitor mixture containing 4-(2-aminoethyl)benzenesulfonylfluoride hydrochloride, aprotinin, EDTA, leupeptin, and E64 was from Calbiochem. Protein A and protein G beads were from Pierce, Phadebas amylase assay kit was from Amersham Biosciences, and protein determination reagent was from Bio-Rad. The Perfringolysin O (PFO) bacterial expression plasmid was a kind gift from A. Johnson and R. Ramachandran of the University of Texas (19Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4926-4931Crossref PubMed Scopus (200) Google Scholar). Isolation of Pancreatic Lobules and Dispersed Acini—The University of Wisconsin Committee on Use and Care of Animals approved all studies involving animals. Pancreatic lobules were prepared by microdissection of an adult male Sprague-Dawley rat pancreas that had been injected with incubation buffer consisting of (in mm) 10 HEPES, 137 NaCl, 4.7 KCl, 0.56 MgCl2, 1.28 CaCl2, 0.6 Na2HPO4, 5.5 d-glucose, 2 l-glutamine, and an essential amino acid solution. The buffer was supplemented with 0.1 mg/ml soybean trypsin inhibitor and 1 mg/ml bovine serum albumin, gassed with 100% O2, and adjusted to pH 7.48. Dispersed cultures of pancreatic acinar cells were isolated from adult male Sprague-Dawley rats by collagenase digestion as described previously (20Wishart M.J. Groblewski G. Goke B.J. Wagner A.C. Williams J.A. Am. J. Physiol. 1994; 267: G676-G686PubMed Google Scholar, 21Thomas D.D. Taft W.B. Kaspar K.M. Groblewski G.E. J. Biol. Chem. 2001; 276: 28866-28872Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). Acini were suspended in incubation buffer and cells were maintained at 37 °C for 1 h prior to performing assays. Immunofluorescence Microscopy—The buffer used for all blocking, incubations, and washing steps contained: 1× phosphate-buffered saline, 3% bovine serum albumin, 2% goat serum, 0.7% cold water fish skin gelatin, and 0.2% Triton X-100. For cryostat sections of rat pancreas (Figs. 2 and 4A), lobules were fixed in 4% paraformaldehyde, and immunofluorescence microscopy was conducted on 9-μm-thick cryostat sections as previously described (22Thomas D.D. Kaspar K.M. Taft W.B. Weng N. Rodenkirch L.A. Groblewski G.E. J. Biol. Chem. 2002; 277: 35496-35502Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 23Thomas D.D. Weng N. Groblewski G.E. Am. J. Physiol. 2004; 287: G253-G263Crossref PubMed Scopus (20) Google Scholar). For images of acinar cell whole mounts (Fig. 5) isolated acini were allowed to settle on poly-l-lysine-coated microscope slides in wells created using a silicone slide cover. For dextran labeling, cells were incubated in HEPES buffer containing 1 mg/ml dextran for 5 min at room temperature before treatment with CCK-8 at room temperature. Following fixation in 2% paraformaldehyde, cells were blocked for 30 min at room temp, and primary antibodies were added simultaneously for 1.5 h at room temp. Secondary antibodies were added simultaneously for 1 h at room temp after washing (3 × 5 min). For VAMP 8, a secondary antibody amplification system (anti-rabbit-FITC followed by rabbit anti-FITC Alexa 488 conjugate) was used due to low signal intensity; however, initial studies conducted without amplification yielded identical results but required much higher laser settings. Due to the low expression levels of epithelial SNAREs, detection using secondary antibody amplification has previously been described (24Weimbs T. Low S.H. Li X. Kreitzer G. Methods. 2003; 30: 191-197Crossref PubMed Scopus (17) Google Scholar). For ZG immunofluorescence (Fig. 4, B–D), Percoll-purified ZGs were fixed for 1 h in 4% paraformaldehyde, washed in phosphate-buffered saline, and embedded in Tissue-Tek. Immunofluorescence microscopy was conducted on 9-μm-thick cryostat sections as described above. In all cases, specificity of antibodies was determined by measuring fluorescence with secondary antibodies alone and in the case of VAMP 8, by antigen competition. Tissues were analyzed using a Radiance 2100 Bio-Rad Multiphoton/Confocal imaging system. For dual-immunofluorescence measurements, fluorophores were individually excited at the appropriate wavelength to ensure no overlapping excitation between channels. Captured images were overlaid and processed for presentation using ImageJ software. Movies of captured z-series and three-dimensional reconstruction of fixed acinar whole mounts, provided as supplemental movies for Fig. 5, were made using ImageJ and Windows Movie Maker software. For semiquantification of images in Fig. 4 (E and D), multiple z-series images from at least three separate tissue preparations were analyzed using ImageJ software with the colocalization threshold plug-in. All images used were raw data that had not been manipulated in any way prior to analysis. Threshold values for each image were automatically determined by the software and, therefore, were unbiased and provided conservative estimates. Analysis of VAMP 8-granule recruitment to the apical membrane (Fig. 5E) was conducted by counting the number of VAMP 8-positive puncta that colocalized with dextran alone or VAMP 2 and dextran in two optical fields obtained with a 100× objective for each treatment group. Data were quantified from three independent experiments utilizing different acinar preparations.FIGURE 4VAMP 2 and VAMP 8 are present on separate populations of ZGs. A, VAMP 2 and 8 VAMP 8 were localized in 4%-paraformaldehyde-fixed sections of pancreatic lobules. VAMP 8 was detected with a rabbit polyclonal antibody (1:100) (17Low S.H. Li X. Miura M. Kudo N. Quinones B. Weimbs T. Dev. Cell. 2003; 4: 753-759Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar) and VAMP 2 with a chicken polyclonal antibody (AB5625, 1:100). An anti-rabbit FITC (1:100)/anti-FITC Alexa 488-conjugated rabbit IgG (1:500) secondary amplification system and an Alexa 546-conjugated anti-chicken IgG (1:5000), were used for immunolocalization. B–D, microscopy was conducted on cryostat sections of Percoll-purified ZGs. VAMP 8 was detected with a rabbit polyclonal antibody (104 302, 1:50), and VAMP 2 with a mouse monoclonal antibody (104 211, 1:100, in B) or a chicken polyclonal antibody (AB5625, 1:100, in C). SNAP 29 was detected with a rabbit polyclonal antibody (1:100) (18Rotem-Yehudar R. Galperin E. Horowitz M. J. Biol. Chem. 2001; 276: 33054-33060Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Immunoreactivity was localized using an Alexa 488-conjugated anti-rabbit IgG, Alexa 546-conjugated anti-mouse IgG, Alexa 546-conjugated anti-chicken IgG, or Alexa 488 conjugated anti-rabbit IgG, respectively. In D, VAMP 8 was detected with a rabbit polyclonal antibody (104 302, 1:50) and SNAP 29 with a rabbit polyclonal antibody (1:100) using an Alexa 488-conjugated and Alexa 546-conjugated Zenon secondary detection kit, respectively. Arrows indicate isolated areas of VAMP 8 staining. Arrowheads indicate isolated areas of VAMP 2 staining. Note in A that VAMP 2 is localized below the acinar lumen, whereas VAMP 8 occupies deeper areas of the apical cytoplasm. Also note the pronounced overlap of VAMP 8 and SNAP 29 (dotted-line arrowheads in D) but minimal overlap of VAMP 2 and SNAP 29 in ZG fractions (C). E, semiquantitative analysis of SNARE protein colocalization acquired from multiple z-series images from three separate ZG preparations. Data are mean and S.E. (n = 30, 12, and 12 for VAMP 2/VAMP 8, VAMP 2/SNAP 29, and VAMP 8/SNAP 29, respectively). All images are a single representative experiment performed on multiple sections from at least three separate tissue preparations.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 5VAMP proteins differentially localize to sites of acinar exocytosis. A–C, immunofluorescence microscopy was performed on whole mounts of isolated acini that were incubated with Texas Red-dextran (1 mg/ml) for 5 min at room temperature before stimulation with 100 pm CCK-8 for an additional 1 or 5 min. Acini were then fixed in 2% paraformaldehyde, VAMP 2 was detected with a chicken polyclonal antibody (Chemicon, 1:200), and VAMP 8 was detected with a rabbit polyclonal antibody (1:200) (17Low S.H. Li X. Miura M. Kudo N. Quinones B. Weimbs T. Dev. Cell. 2003; 4: 753-759Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). Immunoreactivity was detected using an anti-rabbit FITC (1:100)/anti-FITC Alexa 488-conjugated rabbit IgG (1:250) secondary amplification system and an Alexa 647-conjugated anti-chicken IgG (1:250). Post-acquisition, VAMP 2 was pseudo-colored red and dextran was pseudo-colored blue. Arrowheads indicate isolated areas of VAMP 8 staining. Arrows indicate areas of VAMP 8/VAMP 2/dextran overlap. Note the prominent VAMP 2/dextran overlap in control and treated acini, whereas VAMP 8 is more sparsely localized as single ZGs at sites of dextran or dextran/VAMP 2 labeling. See supplemental materials for a z-series and three-dimensional reconstruction of each panel. All images are a single representative experiment performed on multiple sections from at least three separate tissue preparations. D, semiquantitative analysis of VAMP protein and dextran colocalization acquired from multiple z-series images from three separate tissue preparations analyzed in duplicate or triplicate. Data are mean and S.E. (n = 7). E, quantification of VAMP 8 recruitment to sites of exocytosis. VAMP 8-positive puncta that colocalized with dextran alone or VAMP 2 plus dextran were counted from two optical fields for each treatment group. Data are the mean and S.E. from three independent experiments utilizing separate acinar preparations.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Acinar Cell Permeabilization—Acini were suspended in a permeabilization buffer containing (in mm) 20 PIPES (pH 6.6), 139 K+-glutamate, 4 EGTA, 1.78 MgCl2, 2 Mg-ATP, 0.1 mg/ml soybean trypsin inhibitor, 1 mg/ml bovine serum albumin, and 35 pm PFO. PFO is a cholesterol-dependent cytolysin that assembles to create large aqueous pores in cell membranes (19Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4926-4931Crossref PubMed Scopus (200) Google Scholar). PFO was allowed to bind to intact cells on ice for 10 min, and excess unbound PFO was then removed by washing at 4 °C in the same buffer without PFO. Acini were aliquoted into pre-chilled microcentrifuge tubes (200 μl/tube) containing the indicated amounts of recombinant proteins. The cell suspension was then diluted with an equal volume of the same buffer containing enough CaCl2 to create the desired final concentration of free Ca2+. The quantity of CaCl2 added to the buffer was calculated based on dissociation constants using a computer program as previously described (21Thomas D.D. Taft W.B. Kaspar K.M. Groblewski G.E. J. Biol. Chem. 2001; 276: 28866-28872Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). To measure basal secretion, permeabilized cells were incubated at 37 °C with indicated amounts of recombinant proteins in the presence of ≤10 nm of free Ca2+. Following incubation, cells were cooled in an ice bath and then centrifuged at 12,000 × g for 1 min. The content of amylase in the medium was determined using a Phadebas assay kit. Data were calculated as the percentage of total cellular amylase present in an equal amount of cells measured at the start of the experiment. Preparation of ZGs—Rat pancreases were minced in 5 vol of a buffer containing (in mm) 10 MOPS, pH 6.8, 250 sucrose, 0.1 MgCl2, 0.1 phenylmethylsulfonyl fluoride, and 1 benzamidine. Tissue was homogenized by three strokes of a motor-driven homogenizer (5,000 rpm) using a Teflon pestle with 0.5- to 1-mm clearance. A postnuclear supernatant was prepared by centrifugation at 600 × g for 10 min and then further centrifuged at 1,300 × g for 10 min to produce a white pellet enriched in ZGs overlaid by a brown pellet enriched in mitochondria. The remaining supernatant was centrifuged at 100,000 × g for 1 h to separate microsomal and cytosolic fractions. ZGs were further purified by Percoll gradient centrifugation (21Thomas D.D. Taft W.B. Kaspar K.M. Groblewski G.E. J. Biol. Chem. 2001; 276: 28866-28872Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar) and then lysed by sonication in buffer consisting of (in mm) 50 Tris (pH 7.4), 100 NaCl, 5 EDTA, 25 NaF, 10 sodium pyrophosphate, and protease inhibitors. ZG membranes were separated from content by 100,000 × g centrifugation. GST- and His-Protein Purification—Constructs containing the full-length cytoplasmic domains of human VAMP 2 and VAMP 8 were obtained from G. Reed (25Polgar J. Chung S.H. Reed G.L. Blood. 2002; 100: 1081-1083Crossref PubMed Scopus (132) Google Scholar). VAMP 1 constructs were prepared by PCR using full-length rat VAMP 1 as a template and the primers GGTGGATCCATGTCTGCTCCAGCTC (forward) and GATCTCGAGTTAGCAGTTTTTCCACCAATA (backward). GST fusion proteins incorporating cytoplasmic domains of VAMPs 1, 2, and 8 were purified by glutathione affinity chromatography and either eluted in buffer containing 10 mm glutathione or released by thrombin cleavage as previously described (26Groblewski G.E. Wishart M.J. Yoshida M. Williams J.A. J. Biol. Chem. 1996; 271: 31502-31507Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). PFO was purified as a His-tagged protein by Co2+-affinity chromatography in according with the manufacturer's instructions. GST Pull-down Assay and Immunoprecipitations—Membrane fractions prepared from isolated acini or purified ZG membranes were solubilized in lysis buffer containing 1% Triton X-100 and then incubated with 15 μg of GST alone, GST-VAMP 2 or GST-VAMP 8, together with 20 μl of glutathione-Sepharose beads at 4 °C. After 1-h incubation at 4 °C, the beads were washed extensively, and fusion proteins were eluted by incubating in cleavage buffer containing 0.03 unit/μl thrombin. Binding proteins were analyzed by immunoblotting. For immunoprecipitations, detergent-solubilized membrane fractions were incubated with indicated antibodies overnight at 4 °C. Antibodies were then precipitated with Protein A- or G-Sepharose beads for 1 h, and washed extensively in lysis buffer, and analyzed by SDS-PAGE and immunoblotting (27Groblewski G.E. Wang Y. Ernst S.A. Kent C. Williams J.A. J. Biol. Chem. 1995; 270: 1437-1442Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). Subcellular Localization of SNAREs in Acini—Our initial studies using subcellular fractionation of pancreas confirmed previous reports that VAMP 2 and VAMP 8 are enriched in ZG membranes but absent in ZG content and cytosolic fractions (Fig. 1) (10Wang C.C. Ng C.P. Lu L. Atlashkin V. Zhang W. Seet L.F. Hong W. Dev. Cell. 2004; 7: 359-371Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 13Gaisano H.Y. Sheu L. Foskett J.K. Trimble W.S. J. Biol. Chem. 1994; 269: 17062-17066Abstract Full Text PDF PubMed Google Scholar). Investigation of SNAP 25 homologs demonstrated that SNAP 23 and SNAP 29 also copurified with ZG membranes. Unlike SNAP 23, which is present exclusively in membrane, small amounts of SNAP 29 were evident in cytosolic fractions, likely reflecting that SNAP 29 does not contain the central cysteine residues that mediate palmitoylation and membrane insertion of SNAP 23 (7Steegmaier M. Yang B. Yoo J.S. Huang B. Shen M. Yu S. Luo Y. Scheller R.H. J. Biol. Chem. 1998; 273: 34171-34179Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 28Vogel K. Roche P.A. Biochem. Biophys. Res. Commun. 1999; 258: 407-410Crossref PubMed Scopus (83) Google Scholar). The presence of SNAP 29 in acini was recently reported by Chen et al. (29Chen X. Walker A.K. Strahaler J.R. Simon E.S. Tomanicek-Volk S.L. Nelson B.B. Hurley M.C. Ernst S.A. Williams J.A. Andrews P.C. Mol. Cell. Proteomics. 2006; 5: 306-312Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar) who utilized a proteomic screen to identify novel ZG proteins. The distribution of syntaxin isoforms in pancreas confirmed a previous report (11Gaisano H.Y. Ghai M. Malkus P.N. Sheu L. Bouquillon A. Bennett M.K. Trimble W.S. Mol. Biol. Cell. 1996; 7: 2019-2027Crossref PubMed Scopus (173) Google Scholar) that syntaxin 3 is present on ZG membranes, whereas syntaxins 2 and 4 are localized to acinar membrane fractions. SNAP 23 and SNAP 29 Are Present
Referência(s)