Portal de Periódicos da CAPES

p53-regulated Transcriptional Program Associated with Genotoxic Stress-induced Apoptosis

2004; Elsevier BV; Volume: 279; Issue: 20 Linguagem: Inglês

10.1074/jbc.m311912200

1083-351X

Patricia S. Kho, Zhen Wang, Li Zhuang, Yuqing Li, Joon-Lin Chew, Huck‐Hui Ng, Edison T. Liu, Qiang Yu,

DNA Repair Mechanisms

By using a genome-wide approach, we sought the identification of p53-regulated genes involved in cellular apoptosis. To this end, we assessed the transcriptional response of HCT116 colorectal cancer cells during apoptosis induced by the anticancer drug 5-fluorouracil as the function of p53 status, and we identified 230 potential targets that are regulated by p53. Previously identified p53 targets known to be involved in growth arrest and apoptosis were observed to be induced, thus validating the approach. Strikingly, we found that p53 regulates gene expression primarily through transcriptional repression (n = 189) rather than activation (n = 41), and selective blockade of p53-dependent gene repression resulted in the reduction in 5-fluorouracil-induced apoptosis. Reporter and chromatin immunoprecipitation assays demonstrated that p53 can suppress the promoter activities of three further studied candidate genes PLK, PTTG1, and CHEK1 but would only bind directly to PTTG1 and CHEK1 promoters, revealing that p53 can repress gene expression through both direct and indirect mechanisms. Moreover, RNAi-mediated knockdown of PLK and PTTG1 expression was sufficient to induce apoptosis, suggesting that repression of novel anti-apoptotic genes by p53 might contribute to a significant portion of the p53-dependent apoptosis. Our data support the divergent functions of p53 in regulating gene expression that play both synergistic and pleiotropic roles in p53-associated apoptosis. By using a genome-wide approach, we sought the identification of p53-regulated genes involved in cellular apoptosis. To this end, we assessed the transcriptional response of HCT116 colorectal cancer cells during apoptosis induced by the anticancer drug 5-fluorouracil as the function of p53 status, and we identified 230 potential targets that are regulated by p53. Previously identified p53 targets known to be involved in growth arrest and apoptosis were observed to be induced, thus validating the approach. Strikingly, we found that p53 regulates gene expression primarily through transcriptional repression (n = 189) rather than activation (n = 41), and selective blockade of p53-dependent gene repression resulted in the reduction in 5-fluorouracil-induced apoptosis. Reporter and chromatin immunoprecipitation assays demonstrated that p53 can suppress the promoter activities of three further studied candidate genes PLK, PTTG1, and CHEK1 but would only bind directly to PTTG1 and CHEK1 promoters, revealing that p53 can repress gene expression through both direct and indirect mechanisms. Moreover, RNAi-mediated knockdown of PLK and PTTG1 expression was sufficient to induce apoptosis, suggesting that repression of novel anti-apoptotic genes by p53 might contribute to a significant portion of the p53-dependent apoptosis. Our data support the divergent functions of p53 in regulating gene expression that play both synergistic and pleiotropic roles in p53-associated apoptosis. p53 protein is the most commonly mutated tumor suppressor in human cancers. p53 exerts its function through cell cycle arrest, which allows time for DNA damage repair, or apoptosis, which eliminates cells with damaged DNA (1Vogelstein B. Lane D. Levine A.J. Nature. 2000; 408: 307-310Crossref PubMed Scopus (5773) Google Scholar). It is generally believed that these functions of p53 are mediated by transactivation of p53 through its ability to bind to cis-acting DNA elements within the regulatory regions (2Brugarolas J. Chandrasekaran C. Gordon J.I. Beach D. Jacks T. Hannon G.J. Nature. 1995; 377: 552-557Crossref PubMed Scopus (1144) Google Scholar, 3Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2285) Google Scholar). In addition to its ability in transcriptional activation, p53 can also negatively regulate the expression of genes through unknown mechanisms (4Hoffman W.H. Biade S. Zilfou J.T. Chen J. Murphy M. J. Biol. Chem. 2002; 277: 3247-3257Abstract Full Text Full Text PDF PubMed Scopus (709) Google Scholar, 5Murphy M. Ahn J. Walker K.K. Hoffman W.H. Evans R.M. Levine A.J. George D.L. Genes Dev. 1999; 13: 2490-2501Crossref PubMed Scopus (394) Google Scholar). In response to DNA damage and other forms of cellular stress, the levels of p53 protein are greatly increased, and the ability of p53 to bind specific DNA sequences is activated (3Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2285) Google Scholar). p53 protein levels are regulated post-transcriptionally; thus, the accumulation of p53 following DNA damage results primarily from an increase in protein stability (6Mosner J. Mummenbrauer T. Bauer C. Sczakiel G. Grosse F. Deppert W. EMBO J. 1995; 14: 4442-4449Crossref PubMed Scopus (267) Google Scholar). It has become clear that the transcriptional activity of p53 is required for p53-dependent cell cycle arrest; however, the mechanisms by which p53 induces apoptosis are not fully understood (1Vogelstein B. Lane D. Levine A.J. Nature. 2000; 408: 307-310Crossref PubMed Scopus (5773) Google Scholar, 3Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2285) Google Scholar). In particular, it remains unclear as to whether p53-mediated transactivation contributes fully to p53-dependent apoptosis. Unlike the cell cycle inhibitory capacity of p53, which is mediated primarily by p21, a number of genes known to be involved in apoptosis, including BAX, PUMA, FAS/APO-1, NOXA, PIGs, and p53AIP1, have been identified as direct transcriptional targets regulated by p53 (3Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2285) Google Scholar, 7Chao C. Saito S. Kang J. Anderson C.W. Appella E. Xu Y. EMBO J. 2000; 19: 4967-4975Crossref PubMed Scopus (227) Google Scholar). Although it is widely believed that p53 induces apoptosis through transcriptional activation of its putative apoptotic targets (1Vogelstein B. Lane D. Levine A.J. Nature. 2000; 408: 307-310Crossref PubMed Scopus (5773) Google Scholar, 8Bates S. Vousden K.H. Cell. Mol. Life Sci. 1999; 55: 28-37Crossref PubMed Scopus (269) Google Scholar, 9Vousden K.H. Lu X. Nat. Rev. Cancer. 2002; 2: 594-604Crossref PubMed Scopus (2703) Google Scholar), there is also evidence suggesting that p53-mediated apoptosis and transactivation are uncoupled (10Bennett M. Macdonald K. Chan S.W. Luzio J.P. Simari R. Weissberg P. Science. 1998; 282: 290-293Crossref PubMed Scopus (652) Google Scholar, 11Kaeser M.D. Iggo R.D. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 95-100Crossref PubMed Scopus (271) Google Scholar, 12Koumenis C. Alarcon R. Hammond E. Sutphin P. Hoffman W. Murphy M. Derr J. Taya Y. Lowe S.W. Kastan M. Giaccia A. Mol. Cell. Biol. 2001; 21: 1297-1310Crossref PubMed Scopus (302) Google Scholar) and that p53 binding to its target genes and subsequent induction of apoptotic target genes are not correlated with the apoptotic phenotype (11Kaeser M.D. Iggo R.D. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 95-100Crossref PubMed Scopus (271) Google Scholar). Moreover, there is indirect evidence indicating that p53 induces apoptosis through transcriptional repression of anti-apoptotic signals (12Koumenis C. Alarcon R. Hammond E. Sutphin P. Hoffman W. Murphy M. Derr J. Taya Y. Lowe S.W. Kastan M. Giaccia A. Mol. Cell. Biol. 2001; 21: 1297-1310Crossref PubMed Scopus (302) Google Scholar, 13Sabbatini P. Chiou S.K. Rao L. White E. Mol. Cell. Biol. 1995; 15: 1060-1070Crossref PubMed Google Scholar, 14Kokontis J.M. Wagner A.J. O'Leary M. Liao S. Hay N. Oncogene. 2001; 20: 659-668Crossref PubMed Scopus (71) Google Scholar). Moreover, p53 has been shown to induce apoptosis in response to one stimulus but growth arrest to another, probably because of selective transcription of subsets of p53 targets (15Yin Y. Liu Y.X. Jin Y.J. Hall E.J. Barrett J.C. Nature. 2003; 422: 527-531Crossref PubMed Scopus (122) Google Scholar, 16Flaman J.M. Robert V. Lenglet S. Moreau V. Iggo R. Frebourg T. Oncogene. 1998; 16: 1369-1372Crossref PubMed Scopus (77) Google Scholar). Therefore, how p53 modulates apoptosis remains elusive, and whether transcriptional activation and repression are both required for p53-induced apoptosis is unclear. Several studies have been performed to identify p53 target genes on a large scale by using microarray technology (17Mirza A. Wu Q. Wang L. McClanahan T. Bishop W.R. Gheyas F. Ding W. Hutchins B. Hockenberry T. Kirschmeier P. Greene J.R. Liu S. Oncogene. 2003; 22: 3645-3654Crossref PubMed Scopus (151) Google Scholar, 18Wang L. Wu Q. Qiu P. Mirza A. McGuirk M. Kirschmeier P. Greene J.R. Wang Y. Pickett C.B. Liu S. J. Biol. Chem. 2001; 276: 43604-43610Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 19Kannan K. Amariglio N. Rechavi G. Jakob-Hirsch J. Kela I. Kaminski N. Getz G. Domany E. Givol D. Oncogene. 2001; 20: 2225-2234Crossref PubMed Scopus (288) Google Scholar, 20Maxwell P.J. Longley D.B. Latif T. Boyer J. Allen W. Lynch M. McDermott U. Harkin D.P. Allegra C.J. Johnston P.G. Cancer Res. 2003; 63: 4602-4606PubMed Google Scholar, 21Amundson S.A. Bittner M. Chen Y. Trent J. Meltzer P. Fornace Jr., A.J. Oncogene. 1999; 18: 3666-3672Crossref PubMed Scopus (298) Google Scholar, 22Zhao R. Gish K. Murphy M. Yin Y. Notterman D. Hoffman W.H. Tom E. Mack D.H. Levine A.J. Cold Spring Harbor Symp. Quant. Biol. 2000; 65: 475-482Crossref PubMed Scopus (29) Google Scholar). However, most of these studies focused on the p53 transactivated genes, and the whole transcriptional program regulated by p53 in relation to apoptosis has not been dissected in detail. In addition, previous studies (23Guo Q.M. Malek R.L. Kim S. Chiao C. He M. Ruffy M. Sanka K. Lee N.H. Dang C.V. Liu E.T. Cancer Res. 2000; 60: 5922-5928PubMed Google Scholar) carried out in artificial systems produced exaggerated levels of overexpressed p53 which, in the case of Myc, had been shown to induce a different set of genes than physiologic levels of Myc. We sought to identify the transcriptional programs involved in p53-induced apoptosis and to understand the regulation of p53 target genes in biologically relevant conditions. To these ends, we took the advantage of colorectal cancer HCT116 cells that are known to undergo p53-dependent apoptosis in response to the anticancer drug 5-FU, 1The abbreviations used are: 5-FU, 5-fluorouracil; ChIP, chromatin immunoprecipitation; FACS, fluorescence-activated cell sorting; RT, reverse transcriptase; siRNA, small interference RNA; CHX, cycloheximide. 1The abbreviations used are: 5-FU, 5-fluorouracil; ChIP, chromatin immunoprecipitation; FACS, fluorescence-activated cell sorting; RT, reverse transcriptase; siRNA, small interference RNA; CHX, cycloheximide. an antimetabolite that activates p53 (24Bunz F. Hwang P.M. Torrance C. Waldman T. Zhang Y. Dillehay L. Williams J. Lengauer C. Kinzler K.W. Vogelstein B. J. Clin. Investig. 1999; 104: 263-269Crossref PubMed Scopus (927) Google Scholar). Thus, by comparing the temporal gene expression-response profiles between HCT116 cells and the p53-deficient counterparts following 5-FU treatment, we were able to identify 5-FU-induced changes in gene expression that are either dependent on p53 in general or specific to the drug treatment. We dissected the p53-dependent transcriptional program in detail, and we identified ∼230 genes that are tightly regulated by p53 out of a 19,000 probe array. Our data reveal that p53 not only induces genes known to be involved in growth arrest and apoptosis but also activates multiple genes that function to promote cellular growth, supporting the role of p53 as a dual-signal gatekeeper in balancing apoptosis with cellular growth. Strikingly, we show that the majority of p53-responsive genes are repressed rather than activated and that gene repression by p53 on a genomic scale is tightly linked to its ability to induce apoptosis. Extending these observations, we show that p53 can repress the transcription of PLK, CHEK1, and PTTG1 directly or indirectly, and their expression is required for maintaining cell survival. Thus, p53 utilizes both transcriptional activation and repression of its target genes for the full induction of apoptosis. Cell Culture and Drug Treatments—Human colon cancer cell line HCT116 and its derived isogenic p53 (-/-) cell line were kindly provided by Dr. Bert Vogelstein, The Johns Hopkins University, Baltimore, MD. Cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. All of the culture reagents and media were from Invitrogen. 5-Fluorouracil and cycloheximide were purchased from Sigma. Western Blotting—Cell lysates were prepared as reported previously (25Yu Q. La Rose J. Zhang H. Takemura H. Kohn K.W. Pommier Y. Cancer Res. 2002; 62: 5743-5748PubMed Google Scholar). Briefly, cells were lysed with cell lysis buffer (0.3% Nonidet P-40, 1 mm EDTA, 50 mm Tris-HCl (pH 7.4), 2 mm EGTA, 1% Triton X-100, 150 mm NaCl, 25 mm NaF, 1 mm Na3VO4, 2 mm 4-(2-aminoethyl)benzenesulfonyl fluoride, 5 μg/ml aprotinin, 1 μg/ml leupeptin) for 30 min on ice, and the lysates were clarified by centrifugation at 12,000 × g for 15 min at 4 °C. Protein concentration was quantified (Bio-Rad), and protein samples (50 μg) were separated by SDS-PAGE and transferred onto Immobilon membranes (Millipore, Bedford, MA). p53, PLK, PTTG1, and Chk1 proteins were identified using anti-p53, anti-Chk1 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-PLK, and anti-PTTG1 primary antibodies (Zymed Laboratories Inc.). Apoptosis Analyses—Apoptosis was measured using FACS analysis of cells in sub-G1 phase. Cells were harvested and fixed in 70% ethanol. The fixed cells were then stained with propidium iodide (50 μg/ml) after treatment with RNase (100 μg/ml). The stained cells were analyzed for DNA content by fluorescence-activated cell sorting (FACS) in a FACS-Calibur (BD Biosciences). Cell cycle fractions were quantified with Cellquest (BD Biosciences). Microarray Hybridization and Data Analysis—Total RNA was extracted with the use of Trizol reagent (Invitrogen) and the Qiagen RNase Mini kit according to the manufacturer's instructions (Valencia, CA). The methods for probe labeling reaction and microarray hybridization were described previously (26Yu Q. He M. Lee N.H. Liu E.T. J. Biol. Chem. 2002; 277: 13059-13066Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar), except the total RNA was used directly for labeling. For all experiments, universal human reference RNA (Stratagene, La Jolla, CA) was used to generate a reference probe for drug-treated and -untreated samples. 30 μg of total RNA from experimental samples or equal amounts of universal human reference RNA were labeled with Cy5 and Cy3, respectively, by using Superscript II Reverse Transcriptase (Invitrogen). The microarray hybridization, image process, and data normalization were as described previously (26Yu Q. He M. Lee N.H. Liu E.T. J. Biol. Chem. 2002; 277: 13059-13066Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The log 2 ratios of each time point were then normalized for each gene to that of untreated cells (time 0) to obtain the relative expression pattern. The genes that showed substantial differences after drug treatment were selected based on a 2-fold change of expression value for at least two time points across all experimental conditions. A total of 1260 of ∼19,000 genes met the criteria and were further analyzed using clustering and display programs (rana.stanford.edu/software) developed by Eisen et al. (27Eisen M.B. Spellman P.T. Brown P.O. Botstein D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14863-14868Crossref PubMed Scopus (13157) Google Scholar). Real Time Quantitative RT-PCR—Total RNA was extracted using RNeasy kit (Qiagen). 100 ng of total RNA from each sample was subjected to real time RT-PCR using ABI PRISM 7900 Sequence Detection System and SYBR Green master mix (Qiagen) according to manufacturer's protocol. Primers are available upon request. β-Actin was used as an internal control for equal amounts of RNA used. Luciferase Reporter Gene Assay—For promoter reporter constructs, DNA fragments containing ∼1–1.5 kb of the 5′-flanking region of the respective genes were isolated by genomic PCR and subsequently subcloned into pGL3-basic vector (Promega, Madison, WI). The PCR primers are as follows: for PLK1, CCGGGGGTACCTGCTGTAAATGTTTTACAATGG (forward) and GGAAGATCTCTGGGAACGTTACAAAAGCCT (reverse); for CHEK1, TCCCCCGGGACCGGGCTGAAGTAAAGCAT (forward) and CCCAAGCTTCTCCCAAGCACACCGAAGGT (reverse); and for PTTG1, CCGGGTACCGCAAAATTTCTTTTCATATCTG (forward) and CCCAAGCTTTGGGGTCTTTAGAGGTCTCC (reverse). The wild-type p53 (pCMV-p53) and dominant negative mutant p53 (pCMV-p53R175H) expression vectors were obtained from Dr. B. Vogelstein. For transfection, 1 × 104 HCT116 p53 (-/-) cells were seeded in triplicate into 96-well tissue culture plates and transfected with FuGENE 6™ (Roche Applied Science) according to the manufacturer's instructions. For each well, 60 ng of reporter construct or PGL3 basic empty vector were co-transfected with 1 or 10 ng of wild type or mutant p53 expression vectors, together with 3 ng of Renilla luciferase control vector PRL-null (Promega). The total amount of transfected DNA in each well was kept constant by adding empty vector pCMV plasmid. To correct for variation in transfection efficiency, reporter firefly luciferase activity was normalized to Renilla luciferase activity, which was measured using the Dual-luciferase Reporter Assay System kit (Promega) according to the manufacturer's instructions. Chromatin Immunoprecipitation (ChIP) Assay—ChIP assays with HCT116 cells were carried out as described in Weinmann et al. (28Weinmann A.S. Bartley S.M. Zhang T. Zhang M.Q. Farnham P.J. Mol. Cell. Biol. 2001; 21: 6820-6832Crossref PubMed Scopus (331) Google Scholar) and Wells and Farnham (29Wells J. Farnham P.J. Methods. 2002; 26: 48-56Crossref PubMed Scopus (208) Google Scholar). Briefly, cells at different time points before and after 5-FU treatment were cross-linked with 1% formaldehyde for 10 min at room temperature. Formaldehyde was inactivated by addition of 125 mm glycine. Chromatin extracts containing DNA fragments of average size of 500 bp were immunoprecipitated using anti-p53 DO1 monoclonal antibody (Santa Cruz Biotechnology). For all ChIP experiments, quantitative PCR analyses were performed in real time using ABI PRISM 7900 Sequence Detection System and SYBR Green Master Mix as described (30Ng H.H. Robert F. Young R.A. Struhl K. Mol. Cell. 2003; 11: 709-719Abstract Full Text Full Text PDF PubMed Scopus (853) Google Scholar). Relative occupancy values were calculated by determining the apparent immunoprecipitation efficiency (ratios of the amount of immunoprecipitated DNA over that of the input sample) and normalized to the level observed at a control region, which was defined as 1.0. The control region is a 279-bp region on chromosome 22 and is amplified using the following primers: 5′-GGACTCGGAAGAGGTTCACCTTCGG-3′ and 5′-GTCGCCTCCGCTTGCTGAACTCAATGC-3′. The error for independent determinations is ±10%. List of Primers—For CHEK1, A, GAAATTTGCAGGTCTTCCTCTTCGTATTC (forward) and CCTACCTCAGCATCCCAAGTCACTG (reverse); B, CCGGCCAGTGCTGGAGAATGTAAT (forward) and CGGGGAGAGCCAAAATAAATCTTACAACG (reverse); and C, AAGCTCCAACATAAACTGCTCGCTTTC (forward) and GTGCTTTGTAAACCTCAGAGTGCGGTACT (reverse). For PTTG11, A, TCCCCGTCGCCCGCAAGTTCTAACAATAT (forward) and CCCGCCAGGAAATTAGTGCGCATGT (reverse); B, CCTCTTTTCTTCACCTTAAGTTAGGCTCT (forward) and CGAAAGGCTTGACACTATACCTGACATA (reverse); C, CCCAGAAAACGTGCCACAAAGTTTGCAAG (forward) and TCACGCAGGTCTTAACAGCCGCATTCA (reverse). siRNA and Transfection—siRNAs were synthesized by the in vitro transcription method using Silencer™ siRNA Construction Kit (Ambion) following the manufacturer's instructions. Targeting sequence for human PLK (GenBank™ accession number NM_005030), AAGGGCGGCTTTGCCAAGTGC, and for PTTG1 (GenBank™ accession number NM_004219), AAAGCTCTGTTCCTGCCTCAG. An unrelated siRNA targeting a sequence in GADPH mRNA (Ambion) served as a control. Cells were seeded in 6-well plates on the day before transfection at the concentration of 1 × 105 cells per well. Cells were transfected with siRNAs at a concentration of 30 nm using OligofectAMINE reagent (Invitrogen) in serum-free Dulbecco's modified Eagle's medium. After incubation at 37 °C for 4 h, Dulbecco's modified Eagle's medium containing 20% fetal calf serum was added. Cells were harvested 48 h after transfection for protein expression or FACS analysis. Genome-wide Effects in Gene Expression in Response to 5-FU Treatment in HCT116 and HCT116 p53 (-/-) Cells—To study the regulation of gene expression by p53 during genotoxic drug-induced apoptosis, we treated the well characterized colorectal cancer HCT116 cells and the p53-deficient subline with 5-FU, an antimetabolite anticancer drug known to induce p53-dependent apoptosis in these cells (24Bunz F. Hwang P.M. Torrance C. Waldman T. Zhang Y. Dillehay L. Williams J. Lengauer C. Kinzler K.W. Vogelstein B. J. Clin. Investig. 1999; 104: 263-269Crossref PubMed Scopus (927) Google Scholar). Addition of 5-FU to the culture medium of HCT116 cells induced a strong p53 accumulation and apoptosis in a time-dependent manner. However, only a minimum apoptosis was induced in their p53 null counterparts (Fig. 1, A and B). Thus, as reported previously, 5-FU induces a p53-dependent apoptosis in HCT116 cells. We then used spotted Oligo arrays representing 19,000 gene set (Genome Institute of Singapore) to study the temporal gene expression of p53 wild-type and null HCT116 cells following 5-FU treatment at different time points. The expression of ∼1260 genes changed significantly (2.0-fold cut-off) after 5-FU treatment for at least 2 time points after we applied a series of filters and normalizations described under "Experimental Procedures." A hierarchical clustering method was used to group drug-responsive genes on the basis of similarities in their expression patterns (27Eisen M.B. Spellman P.T. Brown P.O. Botstein D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14863-14868Crossref PubMed Scopus (13157) Google Scholar) and three clusters consisting of 280 genes display progressive changes in gene expression across the time points, as illustrated in Fig. 1C. When gene expression patterns in HCT116 wild-type cells were compared with HCT116 p53 (-/-) cells at 2, 4, 6, 8, 12, or 24 h after treatment, two clusters of genes were found to be differentially expressed between HCT116 and HCT116 p53 (-/-) cells both as a function of time following drug treatment and p53 status (Fig. 1C, clusters B and C). The vast majority of genes were down-regulated by 5-FU treatment in HCT116 cells: Fig. 1C, clusters B and C, shows 41 genes that were up-regulated and 239 genes that were down-regulated with induction occurring earlier temporally than repression (Fig. 1D). However, in HCT116 p53 (-/-) cells treated with 5-FU, these gene responses were either abolished or largely reduced, suggesting that the major transcriptional effects by 5-FU are mediated by p53. A much smaller subset of genes was concomitantly increased following 5-FU treatment in both p53 wild-type and null HCT116 cells (Fig. 1C, cluster A). One gene of note in this cluster is cyclin E2, which was significantly induced by 5-FU (∼3-fold), and cyclin E1, to a lesser degree (∼1.5-fold). These genes may represent the general response to 5-FU and appeared to be independent of p53 status. The array results were confirmed in a select subset of these genes by real time RT-PCR (Fig. 2).Fig. 2Real time RT-PCR analyses of selected genes. HCT116 and HCT116 p53 (-/-) cells were either untreated or treated with 5-FU, and mRNA expression of selected genes was measured by real time RT-PCR using ABI 7900 Sequence Detection System and SYBR Green Master mix. Representative genes whose expressions are independent of p53 (CCNE2, upper panel), up-regulated by p53 (CNKN1A, TGFα, and EPHA2, middle panel), and down-regulated by p53 (PTTG1, RAD21, and CDKN3, lower panel) are shown. Fold changes relative to the untreated control (C, arbitrarily set as 1) at indicated times in HCT116 cells (open bars) and HCT116 p53 (-/-) cells (dark bars) are shown.View Large Image Figure ViewerDownload (PPT) Genes Affected by Levels of p53 Protein Accumulation—Protein synthesis inhibitor cycloheximide (CHX) has been shown to block p53 accumulation and to inhibit p53-dependent transcription (31Woo R.A. Jack M.T. Xu Y. Burma S. Chen D.J. Lee P.W. EMBO J. 2002; 21: 3000-3008Crossref PubMed Scopus (94) Google Scholar). To identify genes whose expression is directly influenced by p53 protein levels, we pretreated the culture with CHX for 30 min prior to the induction by addition of 5-FU and harvested the cells at different time points. As predicted, pretreatment of HCT116 cells with 10 μg/ml CHX significantly abrogated 5-FU-induced p53 accumulation (Fig. 3A) and accordingly abolished 5-FU-induced apoptosis by 90% (Fig. 3B). However, CHX treatment had negligible effect on low levels of apoptosis observed in 5-FU-treated HCT116 p53 (-/-) cells (data not shown). This observation suggests the abrogation of p53 accumulation by CHX blocks 5-FU-induced apoptosis in HCT116 cells. Of 41 genes that were induced following p53 accumulation in the absence of CHX, 38 were either abolished or largely reduced in their induction in the presence of CHX (Fig. 3C). At all the time points analyzed, the expression of the majority of p53-inducible genes is directly associated with p53 protein levels. In contrast to the p53-inducible genes, we found that ∼40% of p53-repressed genes (n = 50) were insensitive to CHX treatment and therefore not p53-regulated (Fig. 3C). Thus, only those that are sensitive to blockade of p53 accumulation by CHX are considered truly p53-regulated genes. These genes are listed in Table I of the Supplemental Material. Note, however, that because cycloheximide blocked p53 accumulation itself, we cannot discriminate between p53 primary and secondary target genes. p53-inducible Genes—Among 41 genes up-regulated by p53, 16 have been identified previously as p53 targets in a variety of systems (Table I, boldface text, see Supplemental Material). They are putative p53 targets involved in apoptosis (PUMA, NOXA, PIG3, and FAS/CD95) or growth arrest (CDKN1A, GADD45, and 14-3-3σ). Induction of other known p53 targets such as MDM2, APAF, and KILLER/DR5 were also observed but to a lesser degree than those listed in Table I of Supplemental Material. The successful detection of a large number of previously identified p53 targets indicates that our system is robust and accurate in identifying p53-responsive genes. However, 3 of 41 p53-inducible genes including known p53 targets GADD45A and PPMID (Fig. 3) were not sensitive to CHX treatment, indicating that these three genes must be regulated by p53 in a way that is distinct from other target genes. This observation seems to be in line with a previous report (32Zhan Q. Chen I.T. Antinore M.J. Fornace Jr., A.J. Mol. Cell. Biol. 1998; 18: 2768-2778Crossref PubMed Google Scholar) indicating that GADD45A is regulated by p53 through indirect transactivation. Of all p53-inducible genes, CDKN1A (encoding p21) was most strongly up-regulated (9-fold), which is consistent with a high binding affinity of p53 to p21 promoter (11Kaeser M.D. Iggo R.D. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 95-100Crossref PubMed Scopus (271) Google Scholar). We also found that PUMA was most responsive among the detectable putative apoptotic targets induced by p53, supporting the previous reports that PUMA was a major apoptotic target mediating p53-induced apoptosis in colorectal cancer cells (33Yu J. Wang Z. Kinzler K.W. Vogelstein B. Zhang L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 1931-1936Crossref PubMed Scopus (517) Google Scholar, 34Nakano K. Vousden K.H. Mol. Cell. 2001; 7: 683-694Abstract Full Text Full Text PDF PubMed Scopus (1861) Google Scholar). We also identified 25 previously unidentified putative target genes up-regulated by p53. Of these 25, 19 (76%) were found to contain putative p53-binding sites in their promoter regions (data not shown). This compares to 29% in genes unresponsive to p53 induction. Most interesting, a candidate tumor suppressor gene SERPINB5 was also strongly induced by p53 at 24 h after 5-FU treatment (9-fold), pointing to a potential role of its gene product in mediating p53-mediated tumor suppressor function. The other two candidate genes of interest are DUSP5 and -14, which encode dual specificity phosphatases 5 and 14, respectively. In line with these findings, a recent study shows that DUSP2, another member of this family, is a transcription target of p53 that functions in signaling apoptosis and growth arrest (15Yin Y. Liu Y.X. Jin Y.J. Hall E.J. Barrett J.C. Nature. 2003; 422: 527-531Crossref PubMed Scopus (122) Google Scholar). Unexpectedly, we found that p53 activation also led to the induction of a number of genes associated with mitogenic responses. These genes include TGFα, SEK, TOP1, CNK, and EPHA2, and all contain putative p53-binding sites in their promoters. In particular, TGFα and EPHA2 have been reported previously to be linked to the activation of mitogen-activated protein kinase signaling cascade that promotes cell growth (35Sawhney R.S. Sharma B. Humphrey L.E. Brattain M.G. J. Biol. Chem. 2003; 278: 19861-19869Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 36Pratt R.L. Kinch M.S. Oncogene. 2002; 21: 7690-7699Crossref PubMed Scopus (115) Google Scholar). This implies that activation of p53 is accompanied by an induction of the cellular mitogenic program. This finding is consistent with recent studies (37Han J.A. Kim J.I. Ongusaha P.P. Hwang D.H. Ballou L.R. Mahale A. Aaronson S.A. Le