Portal de Periódicos da CAPES

Neurofibromatosis Type 1 (NF1) Tumor Suppressor, Neurofibromin, Regulates the Neuronal Differentiation of PC12 Cells via Its Associating Protein, CRMP-2

2008; Elsevier BV; Volume: 283; Issue: 14 Linguagem: Inglês

10.1074/jbc.m708206200

1083-351X

Siriporn Patrakitkomjorn, Daiki Kobayashi, Takashi Morikawa, Masayo Morifuji Wilson, Nobuyuki Tsubota, Atsushi Irie, Tatsuya Ozawa, Masashi Aoki, Nariko Arimura, Kozo Kaibuchi, Hideyuki Saya, Norie Araki,

Neuroblastoma Research and Treatments

Neurofibromatosis type 1 (NF1) tumor suppressor gene product, neurofibromin, functions in part as a Ras-GAP, a negative regulator of Ras. Neurofibromin is implicated in the neuronal abnormality of NF1 patients; however, the precise cellular function of neurofibromin has yet to be clarified. Using proteomic strategies, we identified a set of neurofibromin-associating cellular proteins, including axon regulator CRMP-2 (Collapsin response mediator protein-2). CRMP-2 directly bound to the C-terminal domain of neurofibromin, and this association was regulated by the manner of CRMP-2 phosphorylation. In nerve growth factor-stimulated PC12 cells, neurofibromin and CRMP-2 co-localized particularly on the distal tips and branches of extended neurites. Suppression of neurofibromin using NF1 small interfering RNA significantly inhibited this neurite outgrowth and up-regulated a series of CRMP-2 phosphorylations by kinases identified as CDK5, GSK-3b, and Rho kinase. Overexpression of the NF1-RAS-GAP-related domain rescued these NF1 small interfering RNA-induced events. Our results suggest that neurofibromin regulates neuronal differentiation by performing one or more complementary roles. First, neurofibromin directly regulates CRMP-2 phosphorylation accessibility through the complex formation. Also, neurofibromin appears to indirectly regulate CRMP-2 activity by suppressing CRMP-2-phosphorylating kinase cascades via its Ras-GAP function. Our study demonstrates that the functional association of neurofibromin and CRMP-2 is essential for neuronal cell differentiation and that lack of expression or abnormal regulation of neurofibromin can result in impaired function of neuronal cells, which is likely a factor in NF1-related pathogenesis. Neurofibromatosis type 1 (NF1) tumor suppressor gene product, neurofibromin, functions in part as a Ras-GAP, a negative regulator of Ras. Neurofibromin is implicated in the neuronal abnormality of NF1 patients; however, the precise cellular function of neurofibromin has yet to be clarified. Using proteomic strategies, we identified a set of neurofibromin-associating cellular proteins, including axon regulator CRMP-2 (Collapsin response mediator protein-2). CRMP-2 directly bound to the C-terminal domain of neurofibromin, and this association was regulated by the manner of CRMP-2 phosphorylation. In nerve growth factor-stimulated PC12 cells, neurofibromin and CRMP-2 co-localized particularly on the distal tips and branches of extended neurites. Suppression of neurofibromin using NF1 small interfering RNA significantly inhibited this neurite outgrowth and up-regulated a series of CRMP-2 phosphorylations by kinases identified as CDK5, GSK-3b, and Rho kinase. Overexpression of the NF1-RAS-GAP-related domain rescued these NF1 small interfering RNA-induced events. Our results suggest that neurofibromin regulates neuronal differentiation by performing one or more complementary roles. First, neurofibromin directly regulates CRMP-2 phosphorylation accessibility through the complex formation. Also, neurofibromin appears to indirectly regulate CRMP-2 activity by suppressing CRMP-2-phosphorylating kinase cascades via its Ras-GAP function. Our study demonstrates that the functional association of neurofibromin and CRMP-2 is essential for neuronal cell differentiation and that lack of expression or abnormal regulation of neurofibromin can result in impaired function of neuronal cells, which is likely a factor in NF1-related pathogenesis. Neurofibromatosis type 1 (NF1) 2The abbreviations used are: NF1neurofibromin type 1CRMP-2collapsin response mediator protein-2DNdominant negativeGAPGTPase-activating proteinGRDGAP-related domainsiRNAsmall interfering RNANGFnerve growth factorGSTglutathione S-transferaseCTDC-terminal domainCHAPS3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonic acidDTTdithiothreitolPBSphosphate-buffered salinePVDFpolyvinylidene difluorideDIGEdifference gel electrophoresisMSmass spectrometryMALDI-TOFmatrix-assisted laser desorption ionization time-of-flightLCliquid chromatographyESIelectrospray ionizationCSRDcysteine/serine-rich domainFITCfluorescein isothiocyanateRhoKRho kinase. is an autosomal dominantly inherited disorder, with an estimated prevalence of 1 in 3,000-4,000 people (1Stephens K. Riccardi V.M. Rising M. Ng S. Green P. Collins F.S. Rediker K.S. Powers J.A. Parker C. Donis-Keller H. Genomics. 1987; 1: 353-357Crossref PubMed Scopus (21) Google Scholar). The hallmarks of NF1 include development of benign tumors of the peripheral nervous system and an increased risk of developing malignancies. The phenotype of NF1 is highly variable, with several organ systems being affected, including the bones, skin, irises, and central and peripheral nervous systems. The effects on the nervous system manifest as neurofibroma, gliomas, and learning disabilities. neurofibromin type 1 collapsin response mediator protein-2 dominant negative GTPase-activating protein GAP-related domain small interfering RNA nerve growth factor glutathione S-transferase C-terminal domain 3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonic acid dithiothreitol phosphate-buffered saline polyvinylidene difluoride difference gel electrophoresis mass spectrometry matrix-assisted laser desorption ionization time-of-flight liquid chromatography electrospray ionization cysteine/serine-rich domain fluorescein isothiocyanate Rho kinase. The NF1 gene locates on chromosome 17q11.2 and encodes a large protein of 2,818 amino acids, neurofibromin (2Cawthon R.M. Weiss R. Xu G.F. Viskochil D. Culver M. Stevens J. Robertson M. Dunn D. Gesteland R. O'Connell P. White R. Cell. 1990; 62: 193-201Abstract Full Text PDF PubMed Scopus (956) Google Scholar). Because the great majority of NF1 gene mutations frequently found in NF1 patients prevents the expression of intact neurofibromin, functional disruption of neurofibromin is potentially relevant to the expression of some or all of the multiple abnormalities that occur in NF1 patients (3Costa R.M. Federov N.B. Kogan J.H. Murphy G.G. Stern J. Ohno M. Kucherlapati R. Jacks T. Silva A.J. Nature. 2002; 415: 526-530Crossref PubMed Scopus (472) Google Scholar). A region centered around 360 amino acid residues encoded by the NF1 gene shows significant homology to the known catalytic domains of mammalian Ras GTPase-activating protein (p120 GAP). This region is also similar to yeast IRA1/2 proteins, which have been shown to interact with Ras and mediate hydrolysis of Ras-bound GTP to GDP, resulting in inactivation of Ras protein function. The GAP-related domain of the NF1 gene product (NF1-GRD) also stimulates Ras GTPase and consequently inactivates Ras protein (4Guo H.F. Tong J. Hannan F. Luo L. Zhong Y. Nature. 2000; 403: 895-898Crossref PubMed Scopus (209) Google Scholar, 5Gregory P.E. Gutmann D.H. Mitchell A. Park S. Boguski M. Jacks T. Wood D.L. Jove R. Collins F.S. Somatic Cell Mol. Genet. 1993; 19: 265-274Crossref PubMed Scopus (115) Google Scholar, 6Yunoue S. Tokuo H. Fukunaga K. Feng L. Ozawa T. Nishi T. Kikuchi A. Hattori S. Kuratsu J. Saya H. Araki N. J. Biol. Chem. 2003; 278: 26958-26969Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). In the region of NF1-GRD, two different isoforms (type I and type II possessing higher and lower GAP activity, respectively) formed by alternative splicing have been identified (6Yunoue S. Tokuo H. Fukunaga K. Feng L. Ozawa T. Nishi T. Kikuchi A. Hattori S. Kuratsu J. Saya H. Araki N. J. Biol. Chem. 2003; 278: 26958-26969Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Recently, we demonstrated a novel role for neurofibromin on neuronal differentiation in conjunction with regulation of Ras activity via its GAP-related domain (GRD) in NGF-stimulated PC12 cells serving as a model for neuronal cells (6Yunoue S. Tokuo H. Fukunaga K. Feng L. Ozawa T. Nishi T. Kikuchi A. Hattori S. Kuratsu J. Saya H. Araki N. J. Biol. Chem. 2003; 278: 26958-26969Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). In PC12 cells, time-dependent increases in the GAP activity of cellular neurofibromin (NF1-GAP) were detected after NGF stimulation, and these increases correlated with down-regulation of Ras activity during neurite elongation. Interestingly, the NF1-GAP increases were because of induction of alternative splicing of NF1-GRD type 1, which was triggered by NGF-induced Ras activation. Dominant-negative (DN) forms of NF1-GRD type I significantly inhibited the neurite extension of PC12 cells via regulation of the Ras state. NF1-GRD-DN also reduced axonal and dendritic branching/extension of rat embryonic hippocampal neurons. These results demonstrated that mutual regulation of Ras and NF1-GAP is essential for normal neuronal differentiation. Thus, we speculated that abnormal regulation of NF1-GAP in neuronal cells may be implicated in NF1-related learning and memory disorder (6Yunoue S. Tokuo H. Fukunaga K. Feng L. Ozawa T. Nishi T. Kikuchi A. Hattori S. Kuratsu J. Saya H. Araki N. J. Biol. Chem. 2003; 278: 26958-26969Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Recent studies using Nf1 gene-targeting animals have also supported our hypothesis. For example, Drosophila homozygotes with Nf1-null mutation showed significant decrements in olfactory learning performance (4Guo H.F. Tong J. Hannan F. Luo L. Zhong Y. Nature. 2000; 403: 895-898Crossref PubMed Scopus (209) Google Scholar); Nf1 heterozygous mice displayed spatial learning disability (7Xu H. Gutmann D.H. Brain Res. 1997; 759: 149-152Crossref PubMed Scopus (56) Google Scholar, 8Li C. Cheng Y. Gutmann D.A. Mangoura D. Brain Res. Dev. Brain Res. 2001; 130: 231-248Crossref PubMed Scopus (63) Google Scholar), and mice lacking the alternatively spliced exon 23a of Nf1 exhibited specific learning impairment (8Li C. Cheng Y. Gutmann D.A. Mangoura D. Brain Res. Dev. Brain Res. 2001; 130: 231-248Crossref PubMed Scopus (63) Google Scholar). Furthermore, abnormal Ras activity in Nf1 knock-out mice can disrupt learning and memory, indicating that the functional modulation of Ras by neurofibromin is essential for learning and memory. To determine the precise cellular function of neurofibromin, we recently developed an acute knockdown system for neurofibromin using NF1-siRNAs, and we studied its effects on motility in several types of cell lines (9Ozawa T. Araki N. Yunoue S. Tokuo H. Feng L. Patrakitkomjorn S. Hara T. Ichikawa Y. Matsumoto K. Fujii K. Saya H. J. Biol. Chem. 2005; 280: 39524-39533Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). In the glioma and HeLa cells, NF1 siRNA treatment resulted in characteristic morphological changes such as abnormal actin stress fiber formation and elevated phosphorylation levels of cofilin, a protein that regulates actin cytoskeletal reorganization by depolymerizing and severing actin filaments. The elevated cofilin phosphorylation in neurofibromin-depleted cells was induced by activation of the Rho-RhoK/ROCK-LIMK2-cofilin pathway. Based on such evidence, we concluded that neurofibromin plays a significant role in actin cytoskeletal reorganization and cell motility (9Ozawa T. Araki N. Yunoue S. Tokuo H. Feng L. Patrakitkomjorn S. Hara T. Ichikawa Y. Matsumoto K. Fujii K. Saya H. J. Biol. Chem. 2005; 280: 39524-39533Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). The above observations prompted us to postulate that neurofibromin plays a key role in regulating cytoskeletal organization during axon formation or neurite outgrowth in neuronal cells, and that functional regulation by unknown factors associated with neurofibromin could collaborate in orchestrating these phenomena. The search for NF1-associated proteins is therefore of particular interest because it may both lead to the identification of novel cellular components in Ras-related and/or other pathways, as well as further our understanding of the mechanism of NF1-related pathogenesis. In this study we analyzed the neurofibromin-associating proteins that functionally relate to neuronal cell differentiation. Using the newly established quantitative differential proteomic method, iTRAQ, more than 50 proteins were identified, including several neuronal regulating proteins. Out of the above, we focused on CRMP-2, which is known as a key molecule for axon formation and guidance. First, we observed that cellular co-localization of CRMP-2 and neurofibromin occurred especially on the neurites in NGF-treated PC12 cells. Subsequently, by suppressing neurofibromin expression using NF1 siRNA, we were able to analyze the functional association of CRMP-2 and neurofibromin in relation to the neurite outgrowth of PC12 cells. We observed that NF1 siRNA treatment resulted in up-regulation of a series of CRMP-2 phosphorylations and a significant inhibition of the neurite extension of NGF-treated PC12 cells. We then examined the functional correlation between CRMP-2 phosphorylation and neurofibromin suppression by analyzing specific related kinases in PC12 cells using unique proteomic strategies such as two-dimensional-DIGE combined with phosphoprotein staining and Western blotting using specific antibodies. Here we demonstrate that the neurofibromin function for neurite outgrowth of PC12 cells may involve the regulation of CRMP-2 phosphorylation via the direct interaction/complex formation with CRMP-2, and via the regulation of cellular CRMP-2 phosphorylating kinase cascades. We also discuss the implications of a functional association between neurofibromin and CRMP-2 for neuronal regulation in relation to NF1 pathogenesis. Preparation of Glutathione S-transferase (GST) Fusion Proteins, Plasmid Constructions, and Transfections—GST fusion domain proteins of human neurofibromin corresponding to sequences of residues 543-909, 1168-1530, and 2260-2818 of neurofibromin, which were designated cysteine/serine-rich domain (CSRD), GAP-related domain (GRD), and C-terminal domain (CTD), respectively, were produced in Escherichia coli under the isopropyl 1-thio-β-d-galactopyranoside induction system and affinity-purified as described previously (10Tokuo H. Yunoue S. Feng L. Kimoto M. Tsuji H. Ono T. Saya H. Araki N. FEBS Lett. 2001; 494: 48-53Crossref PubMed Scopus (50) Google Scholar). Mammalian expression plasmids for NF1-GRD types 1 (pcDNA3-FLAG-GRD1X) were prepared as described previously (6Yunoue S. Tokuo H. Fukunaga K. Feng L. Ozawa T. Nishi T. Kikuchi A. Hattori S. Kuratsu J. Saya H. Araki N. J. Biol. Chem. 2003; 278: 26958-26969Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Human GST-CRMP2 plasmid construction and purification of GST-CRMP2 protein were performed as described previously (11Fukata Y. Itoh T.J. Kimura T. Menager C. Nishimura T. Shiromizu T. Watanabe H. Inagaki N. Iwamatsu A. Hotani H. Kaibuchi K. Nat. Cell Biol. 2002; 4: 583-591Crossref PubMed Scopus (637) Google Scholar). The GFP-NF1-CTD fusion protein expression vector was constructed by ligating KpnI/BamHI fragments of pAcGFP-C1 vector (Clontech) and pGEX-2TH/NF1-CTD (10Tokuo H. Yunoue S. Feng L. Kimoto M. Tsuji H. Ono T. Saya H. Araki N. FEBS Lett. 2001; 494: 48-53Crossref PubMed Scopus (50) Google Scholar). The vector was transfected to PC12 cells using Lipofectamine 2000 (Invitrogen) according to manufacturer's recommendation. Antibodies and Inhibitors—An antibody against the C terminus of neurofibromin (anti-GRP (D)) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-human CRMP-2 (C4G) mouse IgG was purchased from IBL (Gunma, Japan). Monoclonal anti-α-tubulin (clone DM1A) and anti-β-tubulin (clone D66) were purchased from Sigma. The specific antibodies for phosphorylated CRMP-2, phospho-Thr514, and phospho-Thr555 were prepared as described previously (12Yoshimura T. Kawano Y. Arimura N. Kawabata S. Kikuchi K. Kaibuchi K. Cell. 2005; 120: 137-149Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar), and phospho-Ser522 was kindly provided from Dr. Y. Goshima (Yokohama City University). Secondary antibodies linked to horseradish peroxidase and Cy5 were purchased from Amersham Biosciences. Alexa Fluor® 488 goat anti-mouse IgG and Alexa Fluor® 568 goat anti-rabbit IgG were purchased from Invitrogen. Rhodamine phalloidin was purchased from Molecular Probes. ROCK inhibitor (Y27632), Cdk inhibitor (purvalanol A and olomoucine), and GSK-3β inhibitor (LiCl) were purchased from Calbiochem. Purification of Binding Proteins from Mouse Brain Cytosolic Fraction by GST-CTD Affinity Chromatography—Mouse brain cytosolic fraction was prepared in lysis buffer A (20 mm Tris-HCl, pH 7.5, 1 mm EDTA, 5 mm MgCl2, 150 mm NaCl, and 0.1% Nonidet P-40) containing 1% protease inhibitors (mixture for mammalian tissues, Sigma) and 1 mm DTT, sodium fluoride (2 mm), sodium orthovanadate (2 mm), and okadaic acid (1 μm) as described (10Tokuo H. Yunoue S. Feng L. Kimoto M. Tsuji H. Ono T. Saya H. Araki N. FEBS Lett. 2001; 494: 48-53Crossref PubMed Scopus (50) Google Scholar). GST-CTD fusion proteins immobilized on GSH-agarose were packed onto a column and equilibrated with buffer B (30 mm Tris-HCl, pH 7.5, 1 mm EDTA, 5 mm MgCl2, and 1 mm DTT). Mouse brain cytosolic fraction was pre-cleared by passing through a GSH column and then loaded onto the GST-CTD column or GST column as a control. After washing the column with buffer A, the proteins bound to the column were eluted by the addition of buffer C (buffer A containing 0.5 m NaCl) and used for the proteomic analysis. Protein concentrations of eluted samples were determined using the BCA protein assay (Pierce) or Bradford assay (Bio-Rad). Silver Staining—Gels were fixed in fixative (50% methanol and 12% acetic acid) in 0.02% formaldehyde for at least 1 h. Gels were washed in 50% ethanol three times for 20 min and pretreated for 1 min by sodium thiosulfate (0.8 mm). Gels were rinsed in distilled water three times for 20 s. Silver nitrate solution (0.2%) in 0.03% formaldehyde was used for impregnating for 20 min, following rinsing with distilled water two times for 20 s. Developing solution (0.7 m of sodium carbonate, 0.02% formaldehyde, and 16 μm of sodium thiosulfate) was used for developing. Gels were rinsed two times in distilled water for 2 min. Stopping solution (50% methanol and 12% acetic acid) was used for stopping the reaction, and gels were kept in 50% methanol. iTRAQ Sample Preparation and Quantitative Analysis—The 200 μl of protein samples (100 μg) were precipitated with 6× volume of acetone and kept overnight at -80 °C. After centrifugation of the samples at 13,000 × g for 5 min, the precipitants were kept and dissolved in 200 μl of 50 mm NH4HCO3, 2 mm CaCl2, and 10% AcCN; then 1 μg of trypsin (Promega) was added and incubated at 37 °C for 2 h. Another 1 μg of trypsin was added before incubating overnight, after which the samples were kept at -80 °C until analysis. Samples were labeled with iTRAQ tags as follows: 100 μg of duplicated protein trypsin peptide fractions eluted from the GST-CTD column were labeled with iTRAQ116 and iTRAQ117; 100 μg of duplicated fractions from GST column as controls were labeled with iTRAQ114 and -115. The labeled samples were then all mixed, desalted, and subjected to LC-ESI-QQ-TOF and LC-MALDI-TOF-TOF MS analysis using the UltiMate NanoLC system (LCPackings A Dionex Company), the API QSTAR Pulsar i, or the 4700 Proteomics analyzer (Applied Biosystems). Obtained data were processed with iTRAQ quantitative analysis software ProQuant version 1.1 for ESI-QQ-TOF MS or GPS Explorer version 3.1 for MALDI-TOF-TOF MS (Applied Biosystems) and MASCOT (Matrix Science). Immunoprecipitation Assays—Mouse brain was homogenized with lysis buffer A containing 1% protease inhibitor mixture for mammalian tissues (Sigma) and 1 mm DTT, sodium fluoride (2 mm), sodium orthovanadate (2 mm), and okadaic acid (1 μm) as the phosphatase inhibitors. Samples were centrifuged at 10,000 rpm for 10 min, and the supernatants were mixed with the indicated antibodies for 3 h and then mixed with appropriate protein A or G-Sepharose 4 Fast Flow beads (GE Healthcare) for 1 h. The beads were washed with buffer A, and boiled in 2× SDS loading buffer. Samples were separated by SDS-PAGE, transferred into PVDF membrane electrophoretically, and subjected to immunoblotting analysis with the indicated antibodies. After reaction with horseradish peroxidase- or Cy5-conjugated secondary antibodies, the reacted protein pattern on the membrane was visualized by an ECL detection system or by scanning with fluorescent scanner Typhoon 9400 (GE Healthcare), respectively. Binding Assay of CRMP-2 to Neurofibromin Fragments in Vitro—The GST fusion neurofibromin fragment proteins (GST-CSRD-(543-909), GST-GRD-(1168-1530), GST-CTD-(2260-2818)), or GST (500 μg) purified from E. coli were immobilized on GSH-agarose beads and packed onto columns. CRMP-2 protein (500 μg) was prepared after the thrombin (48 units) treatment of GST-CRMP-2 in thrombin cleavage buffer (50 mm Tris-HCl, pH 8.8, 150 mm NaCl, 2.5 mm CaCl2) for 40 min at room temperature, followed by the gel filtration. Purified CRMP-2 was applied to the neurofibromin fragment columns and washed with buffer A, and the bound CRMP-2 on each column was eluted by 2× SDS loading buffer. The eluted fractions were separated by SDS-PAGE, transferred onto PVDF membrane electrophoretically, and subjected to the immunoblotting analysis with anti-CRMP-2 antibody. To check the purity of thrombin-cleaved CRMP-2 and GST-neurofibromin fragments (GST-CSRD, -GRD, -CTD), each protein was subjected to SDS-PAGE and their patterns analyzed after staining with Simply Blue (Fig. 1D, upper panel). Quantitative Western Blotting Analysis—After immunoblotting detection, the ECL patterns were scanned using LabScan 5.0 (GE Healthcare) with transparent mode and resolution 300 dpi, and Cy5 patterns were processed by fluorescence scanner Typhoon 9400. The intensities were measured using ProGenesis Work station version 2005 (PerkinElmer Life Sciences) or ImageQuant (GE Healthcare) with background subtraction and normalization by total spot volume mode. The intensity of each spot was recorded as digital data, and processed by Microsoft Office Excel. Experimental values are expressed as mean ± S.E. Paired Student's t test or one-way analysis of variance with Dunnett's test was used to identify significant differences where appropriate. p values of <0.05 were considered significant. Cell Culture, Stimulation, Transfection, and Preparation of Cell Lysates—PC12 cells were cultured under 5% CO2 at 37 °C in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% horse serum and 5% fetal bovine serum. Transfection into cells was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. PC12 cells were stimulated with 50 ng/ml 2.5 S NGF (WAKO) for up to 72 h. For preparation of cellular lysates, cells were solubilized with NF1 lysis buffer (20 mm Tris-HCl, pH 7.5, 5 mm MgCl2, 150 mm NaCl, 1 mm EDTA, 0.1% Nonidet P-40, 1 mm 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride, 1 μg/ml each aprotinin, pepstatin A, and leupeptin) and passed through a 25-gauge syringe 20 times. Lysates were centrifuged at 20,000 × g for 20 min at 4 °C, and the protein concentrations of the supernatants were determined using the BCA protein assay (Pierce). siRNA—Four target sequences for Rat NF1 siRNA were designed as follows: a 21-oligonucleotide siRNA duplex was designed as recommended elsewhere (9Ozawa T. Araki N. Yunoue S. Tokuo H. Feng L. Patrakitkomjorn S. Hara T. Ichikawa Y. Matsumoto K. Fujii K. Saya H. J. Biol. Chem. 2005; 280: 39524-39533Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) and was synthesized by Gene Link (Japan) to target the rat NF1 sequence 5′-249CAAGGAGTGTCTGATCAACTT-3′ (for 249 NF1 siRNA), sequence 5′-532CTTCGGAATTCTGCTTCTGTT-3′ (for 532 NF1 siRNA), and sequence 5′-611GGTTACAGGAGTTGACTGTTT-3′ (for 611 NF1 siRNA). Annealing of the component strands of each siRNA and transfection were performed as described (9Ozawa T. Araki N. Yunoue S. Tokuo H. Feng L. Patrakitkomjorn S. Hara T. Ichikawa Y. Matsumoto K. Fujii K. Saya H. J. Biol. Chem. 2005; 280: 39524-39533Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). FITC-labeled rat NF1 sequence (FITC-249 NF1 siRNA) was also synthesized by Gene Link. A 27-oligonucleotide siRNA duplex was designed and synthesized by iGENE therapeutics (Japan) to target the rat NF1 sequence 5′-GAAAGGGGCUUGAAGUUAAUGUCAAAG-3′. For control siRNAs, a 27-oligonucleotide siRNA duplex scramble sequence by iGENE therapeutics (Japan), and a double-stranded RNA targeting human NF1 gene (5′-609AACTTCGGAATTCTGCCTCTG629-3′) were used as a control. Immunofluorescence Analysis—PC12 cells grown on a 35-mm culture dish were fixed with 4% paraformaldehyde in PBS for 15 min at room temperature and then permeabilized with 0.2% Triton X-100 in PBS for 15 min. After being washed with PBS, cells were incubated in primary antibodies diluted in PBS containing 0.2% bovine serum albumin, followed by a secondary antibody conjugated with a fluorescent dye for 60 min at room temperature, or the cells were incubated with rhodamine phalloidin to stain cellular actin for 60 min at room temperature. Analysis was performed with a confocal microscope (Fluoview, FV300, Olympus) or fluorescence microscope (with 20 × 1.6 Olympus IX71) (DPController, DPManager). Time-lapse Video Analysis—Cells were placed on a collagen-coated glass-bottom plate with 6 wells (Iwaki). Dishes were maintained at 37 °C under 5% CO2 in the chamber set under the camera, during the observation. Images were obtained using a 20× UPlan Apo objective (Olympus). The camera, shutters, and filter wheel were controlled by MetaMorph imaging software (Universal Imaging), and the images were collected every 5 min with exposure times of 100 ms. Through-focus z-series stacks consisting of three frames were acquired at each time point. Two-dimensional Electrophoresis and Two-dimensional Difference Gel Electrophoresis (DIGE)—Mouse brain or PC12 cell lysates (10-50 μg), after desalting using two-dimensional-clean up kit (Amersham Biosciences), were mixed with 125 μl of rehydration solution (8 m urea, 0.5% (w/v) CHAPS, 0.2% (w/v) DTT, 0.5% (v/v) IPG buffer) and loaded into strip holders for first-dimension isoelectric focusing. IPG strips (pH 4-7) (Amersham Biosciences) were used and allowed to re-swell for 12 h. Strips were equilibrated in a two-step process in equilibration solution (2% SDS, 50 mm Tris-HCl, pH 8.8, 6 m of urea, 30% (v/v) glycerol, and 0.002% bromphenol blue) for 15 min each step. In step one, 1 mm DTT was added; in step two, 1 mm iodoacetamide was added. Strips were then subjected to two-dimensional SDS-PAGE (10% gel, 7 × 7 or 13 × 13 cm2). The proteins separated in two-dimensional gels were stained with protein staining solutions or transferred onto nitrocellulose or PVDF membranes, and protein patterns were obtained using specific antibodies. The two-dimensional pattern images on the gels or membranes were visualized with fluorescence probes or ECL (GE Healthcare) and scanned by a confocal fluorescence scanner Typhoon 9400 (GE Healthcare). For two-dimensional DIGE, mouse brain or PC12 cell lysates (10-50 μg) were labeled with 400 pmol of CyDye DIGE Fluor minimal dyes (GE Healthcare) freshly dissolved in anhydrous dimethylformamide. The labeling mixture was incubated on ice in the dark for 30 min, and the reaction was terminated by addition of 10 nmol of lysine. Equal volumes of 2× sample buffer (8 m urea, 4% (w/v) CHAPS, 2 mg/ml DTT, 1% (v/v) IPG buffer, pH 4-7) were added to each of the labeled protein samples. The two samples were mixed prior to isoelectric focusing by IPG strip and subjected to the two-dimensional PAGE as described above. Staining of the Two-dimensional Gels by ProQuant Diamond Phosphoprotein Gel Stain and SYPRO Ruby Protein Gel Stain—For ProQuant Diamond staining, two-dimensional gels were fixed in 50% methanol containing 10% acetic acid once for 30 min and again for overnight. Gels were washed three times in water for 10 min and stained with ProQuant Diamond phosphoprotein gel stain (Invitrogen) in the dark for 60-90 min and then washed with destain solution (5% of 1 m sodium acetate, pH 4.0, containing 20% acetonitrile) three times for 30 min. Gels were washed twice with water for 5 min and scanned by Typhoon. For SYPRO Ruby gel staining, gels were fixed in 50% methanol containing 7% acetic acid for 30 min, stained in SYPRO Ruby protein gel stain (Invitrogen) for 3 h, and washed with 10% methanol containing 10% acetic acid for 30 min. The fluorescent images were scanned with Typhoon 9400, visualized, and processed as digital data with data mining software ImageQuant version 5.2, DeCyder (GE Healthcare), and ProGenesis Work station version 2005 (PerkinElmer Life Sciences). The Identification of Neurofibromin C-terminal Associating Proteins—To isolate proteins that physically associate with neurofibromin, we used the C-terminal domain (CTD), one of the crucial regions in regulating neurofibromin function (10Tokuo H. Yunoue S. Feng L. Kimoto M. Tsuji H. Ono T. Saya H. Araki N. FEBS Lett. 2001; 494: 48-53Crossref PubMed Scopus (50) Google Scholar, 14Feng L. Yunoue S. Tokuo H. Ozawa T. Zhang D. Patrakitkomjorn S. Ichimura T. Saya H. Araki N. FEBS Lett. 2004; 557: 275-282Crossref PubMed Scopus (50) Google Scholar), as a ligand. Mouse brain cytosolic lysates were loaded onto the affinity column with immobilized GST-CTD or GST. Associating proteins on both columns were eluted using high salt elution buffer. The concentration of eluted protein from the GST-CTD column was 3.7 times higher than that from the control column (Fig. 1A). To subject the proteins eluted from each column to iTRAQ analysis, each fraction was adjusted to the same pr