Portal de Periódicos da CAPES

The Escherichia coli RNA polymerase alpha subunit linker: length requirements for transcription activation at CRP-dependent promoters

2000; Springer Nature; Volume: 19; Issue: 7 Linguagem: Inglês

10.1093/emboj/19.7.1555

1460-2075

Wenmao Meng,

Genomics and Chromatin Dynamics

Article3 April 2000free access The Escherichia coli RNA polymerase α subunit linker: length requirements for transcription activation at CRP-dependent promoters Wenmao Meng Wenmao Meng Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield, S10 2RX UK Search for more papers by this author Nigel J. Savery Nigel J. Savery Department of Biochemistry, University of Bristol, School of Medical Sciences, University Walk, Bristol, BS8 1TD UK Search for more papers by this author Stephen J.W. Busby Stephen J.W. Busby School of Biosciences, University of Birmingham, Birmingham, B15 2TT UK Search for more papers by this author Mark S. Thomas Corresponding Author Mark S. Thomas Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield, S10 2RX UK Search for more papers by this author Wenmao Meng Wenmao Meng Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield, S10 2RX UK Search for more papers by this author Nigel J. Savery Nigel J. Savery Department of Biochemistry, University of Bristol, School of Medical Sciences, University Walk, Bristol, BS8 1TD UK Search for more papers by this author Stephen J.W. Busby Stephen J.W. Busby School of Biosciences, University of Birmingham, Birmingham, B15 2TT UK Search for more papers by this author Mark S. Thomas Corresponding Author Mark S. Thomas Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield, S10 2RX UK Search for more papers by this author Author Information Wenmao Meng1, Nigel J. Savery2, Stephen J.W. Busby3 and Mark S. Thomas 1 1Division of Molecular and Genetic Medicine, University of Sheffield Medical School, Sheffield, S10 2RX UK 2Department of Biochemistry, University of Bristol, School of Medical Sciences, University Walk, Bristol, BS8 1TD UK 3School of Biosciences, University of Birmingham, Birmingham, B15 2TT UK *Corresponding author. E-mail: [email protected] The EMBO Journal (2000)19:1555-1566https://doi.org/10.1093/emboj/19.7.1555 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info The C-terminal domain of the Escherichia coli RNA polymerase α subunit (αCTD) plays a key role in transcription initiation at many activator-dependent promoters. This domain is connected to the N-terminal domain by an unstructured linker, which is proposed to confer a high degree of mobility on αCTD. To investigate the role of this linker in transcription activation we tested the effect of altering the linker length on promoters dependent on the cyclic AMP receptor protein (CRP). Short deletions within the α linker decrease CRP-dependent transcription at a Class I promoter while increasing the activity of a Class II promoter. Linker extension impairs CRP-dependent transcription from both promoters, with short extensions exerting a more marked effect on the Class II promoter. Activation at both classes of promoter was shown to remain dependent upon activating region 1 of CRP. These results show that the response to CRP of RNA polymerase containing linker-modified α subunits is class specific. These observations have important implications for the architecture of transcription initiation complexes at CRP-dependent promoters. Introduction Escherichia coli holo RNA polymerase (RNAP) is a multi-subunit complex consisting of two identical α subunits, single β and β′ subunits, and one of several σ subunit species. During transcription initiation at many promoters, RNAP containing the major σ factor, σ70, recognizes three promoter elements: the −10 hexamer, the −35 hexamer and the UP element. In addition, interactions between RNAP and one or more transcription activators are frequently required, often involving the α subunit. Each α subunit consists of 329 amino acids organized in two independently folding domains (Blatter et al., 1994; Negishi et al., 1995). The N-terminal domain (αNTD; residues 8–231) contains determinants for dimerization and assembly into RNAP (Igarashi et al., 1991; Kimura et al., 1994; Kimura and Ishihama, 1995a,b; Zhang and Darst, 1998) and plays a role in transcription activation at some promoters (see below). The C-terminal domain (αCTD; residues 249–329) plays multiple roles in transcription (Igarashi and Ishihama, 1991; Ross et al., 1993; Jeon et al., 1995; Gaal et al., 1996; Kainz and Gourse, 1998). During transcription initiation at some promoters, αCTD recognizes the A+T-rich UP element (Ross et al., 1993; Giladi et al., 1996; Tagami and Aiba, 1999). At the rrnB P1 promoter, this interaction is responsible for a 30- to 70-fold increase in promoter activity (Ross et al., 1993; Rao et al., 1994; Estrem et al., 1998). In addition, αCTD is also a target for a variety of transcription activator proteins at positively regulated promoters, including the well studied cyclic AMP receptor protein (CRP; also known as the catabolite activator protein, CAP) (reviewed by Ishihama, 1993; Ebright and Busby, 1995; Busby and Ebright, 1999). CRP can activate transcription at >100 different promoters in E.coli in response to the intracellular concentration of its allosteric effector, cAMP (reviewed by Kolb et al., 1993a; Busby and Kolb, 1996). The cAMP–CRP complex binds as a dimer to a 22 bp inverted repeat, possessing a consensus of aaaTGTGAtctagaTCACAttt (Berg and von Hippel, 1988). The binding of the CRP dimer to its DNA target results in a sharp bend in the DNA (Wu and Crothers, 1984) estimated to be 80–90° (Schultz et al., 1991; Busby and Ebright, 1999). Promoters that are dependent upon CRP as sole activator can be divided into two classes according to the location of the bound CRP (Ushida and Aiba, 1990; Ebright, 1993). At Class I CRP-dependent promoters, the CRP target site is located upstream of the −35 region (at sites centred near positions −61.5, −71.5, −81.5 or −91.5 with respect to the transcription start point), whereas at Class II CRP-dependent promoters the CRP-binding site is centred near position −41.5, and therefore overlaps the −35 region of the target promoter (Gaston et al., 1990). At both classes of promoter, αCTD makes contact with activating region 1 (AR1) of CRP (Zhou et al., 1994a; Niu et al., 1996; Rhodius et al., 1997) and is thereby recruited to DNA sequences adjacent to CRP. The interaction of CRP with αCTD is a requirement for CRP-dependent activation at these promoters. AR1 is a surface-exposed loop (residues 156–164), which is located adjacent to the helix–turn–helix motif responsible for DNA target site recognition by CRP (Zhou et al., 1993a; Niu et al., 1994). At Class I CRP-dependent promoters, recruitment occurs through the ‘downstream’ subunit of the bound CRP dimer so that one or both αCTDs occupies a position on the template between CRP and the rest of the RNAP holoenzyme (Kolb et al., 1993b; Zhou et al., 1993b, 1994b; Law et al., 1999), while at Class II CRP-dependent promoters αCTD is recruited by the ‘upstream’ CRP subunit and therefore binds to the DNA upstream of bound CRP (Attey et al., 1994; Belyaeva et al., 1996, 1998; Murakami et al., 1997). The determinant on αCTD required for the interaction with AR1 at both classes of promoter is proposed to comprise the side chains of amino acids 285–289, 315 and 317–318 (Savery et al., 1998; Busby and Ebright, 1999; N.J.Savery, G.S.Lloyd, S.J.W.Busby, M.S.Thomas, R.H.Ebright and R.L.Gourse, in preparation). In addition, the DNA-binding determinant on αCTD is involved in interactions with upstream promoter sequences during transcription activation by CRP at both classes of promoter. Transcription activation at Class II CRP-dependent promoters also requires a second activating region on CRP, AR2, located in the N-terminal cAMP-binding domain (Niu et al., 1996; Rhodius et al., 1997). AR2 of the downstream CRP subunit makes functional contacts with residues 162–165 of αNTD at this class of promoter (Niu et al., 1996). The ability of αCTD to contact CRP bound at different upstream positions at target promoters suggests that this domain possesses a degree of motional freedom. Several lines of evidence indicate the presence of a flexible linker connecting the mobile αCTD to a fixed αNTD. First, limited proteolysis studies pointed to an accessible region between amino acids 234 and 249 (Blatter et al., 1994; Negishi et al., 1995). Secondly, NMR analysis of an isolated C-terminal fragment of α (amino acids 233–329) showed that a region of at least 13 amino acids, extending from D236 (but possibly from D233) to E248, exhibits a high degree of flexibility (Jeon et al., 1997). The more N-terminal limit for the inter-domain linker is consistent with the crystallographic data for αNTD, where the C-terminal limit of helix 3 is assigned to F231 (Zhang and Darst, 1998). Finally, amino acid sequence alignments of the α subunits of eubacteria and chloroplasts reveal a non-conserved sequence corresponding to amino acids V237–P251 of the E.coli α subunit (Figure 1A). Despite the sequence variation, the length of this region is fairly well conserved in the bacterial α subunits (14–18 residues), but exhibits considerable length variation in the chloroplast α homologues (18–38 residues). Figure 1.(A) Amino acid sequence alignment of putative inter-domain regions of RNAP α subunits from representative bacteria and chloroplasts. Thirty sequences (14 from bacteria and 16 from chloroplasts) obtained from the Swiss Protein sequence database were aligned, although for clarity only 14 (11 from bacteria and three from chloroplasts) are shown. The amino acid denoted by the letter X in the Haemophilus influenzae α sequence is aspartate or glutamate (GAA/T). Amino acid residues at any one position that are identical in ≥50% of sequences throughout the alignment are highlighted in black boxes, and residues exhibiting similarity in ≥50% of more sequences are shown in grey boxes. The region where sequence conservation is absent is indicated by a horizontal bar over the E.coli sequence. The C-terminal limit of αNTD and the N-terminal limit of αCTD are indicated on the E.coli sequence and are inferred from Zhang and Darst (1998) and Jeon et al. (1997). Chloroplast sequences are separated from bacterial sequences by a horizontal line. (B) Amino acid sequences of wild-type and mutant inter-domain linkers of the E.coli RNAP α subunit used in this work. Amino acids 233–248 of the wild-type linker are shown. Deletions are represented by dashes, and insertions (duplicated sequences) are in bold and underlined. The second linker repeat in the Ω32 mutant derivative is also italicized. Deletions are confined to residues 236–247, insertions involve duplication of parts of or all of the region shown, with the exception that αΩ6 has a serine rather than an arginine in the duplicated linker segment, and E248 is replaced by an aspartate residue at each position where it is replicated in the Ω13, Ω16 and Ω32 derivatives. Download figure Download PowerPoint As Class I and Class II CRP-dependent promoters require the interaction of αCTD with CRP (and adjacent DNA sequences) at a variety of distances upstream from the core promoter elements, they constitute an ideal system to study the role of the α inter-domain linker in transcription activation. In this work, we have constructed a series of deletions and insertions within the inter-domain linker of the E.coli RNAP α subunit. These linker-modified α derivatives were then either reconstituted in vitro or incorporated in vivo into RNAP and the length requirement of the linker at different classes of CRP-dependent promoter was investigated. Our results indicate that the linker can tolerate gross changes without affecting transcription from the CRP-independent, UP element-independent lacUV5 promoter, whereas length is important for CRP-activated transcription at both classes of CRP-dependent promoter. Results Construction of RNAP mutants containing α subunits with inter-domain linkers of different lengths To test the requirements for the RNAP α subunit inter-domain linker at CRP-dependent promoters, a series of 12 rpoA mutants was constructed by PCR and introduced into the rpoA expression plasmid pHTT7f1NHα (Figure 1B; Table I). Six of the variants contain sequences encoding shorter linkers, giving rise to α derivatives harbouring deletions of 3, 6, 9 and 12 amino acids (Δ3a-c, Δ6, Δ9 and Δ12, respectively; three different Δ3 derivatives were designed) within the 13-amino-acid flexible region (D236–E248) defined by NMR as constituting the minimum limits of the α linker (Jeon et al., 1997). Additionally, six rpoA variants were constructed in which the linker encoding sequence was extended (Figure 1B). For the constructs encoding 3, 6, 10 and 13 additional amino acids in the α linker (Ω3, Ω6, Ω10 and Ω13), extension was achieved by duplicating segments within the 13-amino-acid flexible region. For the Ω16 α mutant, the DLR motif (residues 233–235 of α) was also duplicated in addition to residues 236–248. This 16-amino-acid sequence is present in three tandem copies in the Ω32 variant. All the mutant α subunits, as well as the wild-type subunit, were overproduced as N-terminal His-tagged fusions under the control of a phage T7 promoter in E.coli, purified to homogeneity and then reconstituted into holo RNAP with wild-type β, β′ and σ70 subunits (Figure 2). Figure 2.SDS–PAGE of reconstituted E.coli RNAP carrying wild-type or linker-modified α subunits. The proteins were analysed on an 8–15% polyacrylamide gradient gel. Each lane contains reconstituted RNAP carrying linker-modified α subunits (all N-terminal His-tagged) as indicated, or wild-type (wt) RNAP (Boehringer). Positions of α, β, β′ and σ subunits are indicated. Download figure Download PowerPoint Table 1. Linker coding sequences of mutant rpoA expression plasmids α derivative Nucleotide sequence of modified linker coding regionsa pHTT7f1-NHα/pLAW2 derivatives Δ12 GACCTAAGG…GAG pMGM34/pMGM35 Δ9 GACCTAAGG…GAGAAACCAGAG pMGM6/pMGM17 Δ6 GACCTAAGG…GTGAAAGAAGAGAAACCAGAG pMGM5/pMGM16 Δ3c GACCTAAGGGATGTACGTCAGCCTGAA…GAGAAACCAGAG pMGM4/pMGM15 Δ3b GACCTAAGGGATGTACGT…GTGAAAGAAGAGAAACCAGAG pMGM3/pMGM14 Δ3a GACCTAAGG…CAGCCTGAAGTGAAAGAAGAGAAACCAGAG pMGM2/pMGM13 Wild-type (native) GACTTACGTGATGTACGTCAGCCTGAAGTGAAAGAAGAGAAACCAGAG pHTT7f1-NHα/pLAW2 Wild-type (Bsu36I) GACCTAAGGGATGTACGTCAGCCTGAAGTGAAAGAAGAGAAACCAGAG pMGM1/pMGM12 Ω3 GACCTAAGGGATGTACGTCAGCCTGAGGTCAAGGAAGTGAAAGAAGAGAAACCAGAG pMGM7/pMGM18 Ω6 GACCTAAGGGATGTACGTCAGCCTGAGGTCAAGAGTCAACCAGAAGTGAAAGAAGAGAAACCAGAG pMGM8/pMGM19 Ω10 GACTTACGTGATGTACGTCAGCCTGAAGTGAAAGAGGAAGATGTACGTCAGCCTGAAGTGAAAGAAGAGAAACCAGAG pMGM31/pMGM32 Ω13 GACTTACGTGATGTACGTCAGCCTGAAGTGAAAGAGGAAAAGCCTGACGATGTACGTCAGCCTGAAGTGAAAGAAGAGAAACCAGAG pMGM10/pMGM21 Ω16 GACTTACGTGATGTACGTCAGCCTGAAGTGAAAGAGGAAAAGCCTGACGACCTAAGGGATGTACGTCAGCCTGAAGTGAAAGAAGAGAAACCAGAG pMGM9/pMGM20 Ω32 GACCTAAGGGATGTACGTCAGCCTGAAGTGAAAGAGGAAAAGCCTGACGACCTAAGGGATGTACGTCAGCCTGAAGTGAAAGAGGAAAAGCCTGACGACCTAAGGGATGTACGTCAGCCTGAAGTGAAAGAGAAACCAGAG pMGM11/pMGM22 a Codons 233–248 of wild-type rpoA and the corresponding codons in the mutant sequences are shown. Locations of deleted linker codons are indicated by a dotted line. Codons inserted into the linker are in bold. Bsu36I sites introduced into the α coding sequence to create pMGM1 and subsequent linker-modified derivatives are underlined (there are no Bsu36I sites in the Ω10 and Ω13 derivatives). Bases changed in the wild-type α coding sequence in order to introduce the Bsu36I site, without changing the encoded amino acids, are also underlined. Effect of α linker length on CRP-dependent transcription in vitro The effects of α subunit linker length on CRP-dependent transcription were assessed in vitro by performing multiple round transcription assays with template DNA carrying either the Class I CRP-dependent promoter, CC(−61.5), or the Class II CRP-dependent promoter, CC(−41.5) (Gaston et al., 1990). As a control, transcription from the CRP-independent lacUV5 promoter was also examined. As expected, transcription from this promoter occurred in the absence of CRP, and was not appreciably affected by alterations in linker length (⩽10% variation; Figure 3A), whereas under the same conditions (without CRP) no transcription was detectable from either CRP-dependent promoter by any of the RNAPs (Figure 3B and C). When CRP was included in the transcription reactions, transcription occurred from both CRP-dependent promoters in the presence of wild-type RNAP. Shortening the α inter-domain linker caused a sharp decrease in CRP-dependent transcriptional activity at the CC(−61.5) promoter. Thus, deletion of three amino acids resulted in a 35–50% decrease in CRP-dependent transcription from this promoter, depending upon which amino acid triplet was removed, while deletion of a further three amino acids almost completely abolished transcription (Figure 3B). Insertion of three amino acids in the inter-domain linker caused a small but reproducible enhancement in the response of RNAP to CRP at the Class I promoter (∼20% increase), whereas further extension of the α linker resulted in a gradual decrease in CRP-dependent activity, with RNAP containing the Ω32 α derivative initiating transcription ∼40–50% as efficiently as the wild-type enzyme. Figure 3.In vitro transcription from CRP-dependent and CRP-independent promoters by RNAP reconstituted with α subunits containing wild-type or altered inter-domain linkers. Transcription was carried out at the lacUV5 promoter in the absence of CRP (A), and at the CC(−61.5) and CC(−41.5) promoters (B and C, respectively) in the absence (−) or presence (+) of wild-type CRP. The mutant α subunits present in each reconstituted RNAP are indicated above the gel in each panel. Concentrations of RNAP were: Δ12α RNAP, 15.0 nM; Δ9α RNAP, 14.6 nM; Δ6α RNAP, 14.6 nM; Δ3cα RNAP, 13.6 nM; Δ3bα RNAP, 14.6 nM; Δ3aα RNAP, 13.2 nM; WTα RNAP, 10.5 nM; Ω3α RNAP, 13.7 nM; Ω6α RNAP, 13.2 nM; Ω10α RNAP, 12.3 nM; Ω13α RNAP, 13.6 nM; Ω16α RNAP, 12.9 nM; Ω32α RNAP, 11.9 nM. The identities of specific transcripts are indicated by arrows (the vector-encoded replication repressor, RNA-I, 108 nucleotides; CC promoters, 123 nucleotides; lacUV5, 131 nucleotides). The abundance of transcripts originating from the CC(−61.5) and CC(−41.5) promoters in the presence of CRP was quantified from three experiments and plotted. The values were calculated as a percentage of transcript obtained with wild-type RNAP (with standard deviations) and are presented below the appropriate transcription gel, aligned with the corresponding gel lane. Download figure Download PowerPoint With the CC(−41.5) promoter, in contrast to the behaviour of linker-modified RNAPs at CC(−61.5), all RNAPs produced transcripts, regardless of α linker length. However, the level of transcription activity in response to CRP varied markedly. Deletion of the α linker caused an increase in the CRP-dependent activity of RNAP, reaching a maximum with RNAP reconstituted with the Δ6 α derivative (2.5- to 3-fold increase over wild type) (Figure 3C). Further deletion reversed this trend, but even for the Δ12 α derivative the activity remained greater than that conferred by wild-type α. On the other hand, insertions within the linker caused a reduction in transcriptional activity (∼30–75% decrease in activity as the linker is increased by 3–32 amino acids). Thus, the effect of alterations in linker length on CRP-dependent transcription is different at the CC(−41.5) and CC(−61.5) promoters. Effect of α linker length on the interaction between AR1 of CRP and αCTD Both Class I and Class II CRP-dependent promoters share a requirement for AR1 of CRP, which is involved in direct interactions with αCTD. The CRP–αCTD interaction can be disrupted by single amino acid changes in AR1, such as the HL159 substitution (Bell et al., 1990; Zhou et al., 1993a). Thus, to determine whether the AR1–αCTD contact is still required for the response of the linker-modified RNAPs to CRP, the ability of three reconstituted mutant RNAPs (containing the Δ9, Ω3 and Ω32 mutant α subunits) to respond to HL159 CRP was examined in a multiple round in vitro transcription assay. The results show that the observed CRP-dependent activity of the three mutant RNAP preparations at CC(−61.5) is severely impaired by the HL159 substitution in AR1 (Figure 4). Similarly, the HL159 substitution also exerted a negative effect on CRP-dependent transcription from the CC(−41.5) promoter (Figure 4). This indicates that the αCTD–AR1 contact remains a requirement for efficient transcription initiation by the linker-modified RNAPs at both classes of CRP-dependent promoter. Figure 4.Requirement for CRP AR1 at the CC(−61.5) and CC(−41.5) promoters. Transcription was carried out with RNAP reconstituted with wild-type (WT), Δ9, Ω3 and Ω32 α subunits in the presence of wild-type or HL159 CRP (20 nM, where indicated). Concentrations of RNAP were: Δ9α RNAP, 14.6 nM; WTα RNAP, 10.5 nM; Ω3α RNAP, 13.7 nM; Ω32α RNAP, 11.9 nM. The identities of specific transcripts are indicated by arrows. Download figure Download PowerPoint Effect of α linker length on interactions between αCTD and upstream DNA sequences at Class II CRP-dependent promoters At Class II CRP-dependent promoters, CRP recruits αCTD to the DNA segment upstream of the CRP-binding site (Attey et al., 1994; Savery et al., 1995; Belyaeva et al., 1996, 1998). The requirement of AR1 for CRP-dependent activation of transcription from the CC(−41.5) promoter following deletion of nine amino acids from the α subunit inter-domain linker suggests that αCTD may still be recruited to upstream promoter sequences (despite the decrease in linker length). To explore the location of αCTD in RNAP–CRP–DNA ternary complexes at CC(−41.5), DNase I footprinting was performed with RNAP preparations carrying either the Δ9 or Ω10 α variants (Figure 5). The results showed that wild-type RNAP or RNAP reconstituted with the Δ9 α subunit affords only weak protection of the core promoter sequences in the absence of CRP (Figure 5, lanes 13 and 14). CRP alone binds to and protects the DNA site for CRP centred at −41.5 (Figure 5, lane 3). In the presence of wild-type CRP, the protection afforded by wild-type RNAP and RNAP reconstituted with the Δ9 or Ω10 α subunits was both enhanced and extended upstream of the CRP-binding site (Figure 5, lanes 4, 5 and 7). As expected, the protection upstream of CRP was not evident with RNAP reconstituted with the C-terminal-deleted Δ235 α mutant (Figure 5, lane 6; Attey et al., 1994). When wild-type CRP was replaced by HL159 CRP in the footprinting assay, the extension of upstream protection by RNAPs containing wild-type, Δ9 and Ω10 α was less pronounced (Figure 5, lanes 9, 10 and 12). However, the enhancement of core promoter protection was retained, presumably due to the CRP AR2–αNTD interaction (Busby and Ebright, 1999). These results indicate that αCTD, tethered to αNTD by a linker shortened by nine amino acids, can still be recruited to DNA sequences upstream of the CRP-binding site at Class II CRP-dependent promoters, and this recruitment remains dependent upon AR1. In addition, extension of the linker does not compromise the ability of αCTD to be recruited by CRP at this promoter. Figure 5.DNase I footprinting analysis of complexes formed by linker-modified RNAPs at the CC(−41.5) promoter. Protection of the CC(−41.5) promoter by CRP alone (wild-type and HL159) and RNAP reconstituted with wild-type (WT), Δ9, Ω10 and Δ235 α subunits (with or without wild-type or HL159 CRP) is shown. Protection by αCTD, CRP and RNAP is indicated by a filled box, stippled box and open box, respectively. Lanes 1 and 15, A+G ladder; lane 2, no protein; lane 3, WT CRP; lanes 4–7, WT CRP plus RNAP reconstituted with the α derivative indicated; lane 8, HL159 CRP; lanes 9–12, HL159 CRP plus the RNAP indicated; lanes 13 and 14, the RNAP indicated in the absence of CRP. Base co-ordinates are numbered relative to the transcription startpoint (+1) for CC(−41.5). Download figure Download PowerPoint Effect of α linker length on open complex formation at CRP-dependent promoters The inhibition of transcription initiation at the Class I CRP-dependent promoter due to removal of amino acids from the α linker could occur either prior to open complex formation or after open complex formation. To discriminate between these two possibilities, we used permanganate to detect open complex formation in the absence of transcript formation. The footprinting was performed at the CC(−61.5) promoter with RNAP preparations carrying linker-deleted α variants, in the presence and absence of CRP. The results showed that, in the presence of CRP, RNAP reconstituted with the Δ3, Ω3 or wild-type α subunits, which respond to CRP in the transcription assay, gave rise to a pair of bands indicative of enhanced reactivity of T residues at positions −9 and −11 in the template strand (Figure 6). In contrast, RNAP containing the Δ6, Δ9 or Δ12 α subunits, which fail to produce transcripts in response to CRP, did not give rise to these bands. As expected, these bands were also absent when CRP was omitted from the assay. The absence of DNA melting in the −10 region catalysed by RNAP reconstituted with the Δ6, Δ9 or Δ12 mutant α subunits, in the presence of CRP, indicates that the impairment of CRP-dependent transcription from the CC(−61.5) promoter caused by shortening the α linker occurs at a step prior to open complex formation. Figure 6.Effect of α subunit linker length on open complex formation at the CC(−61.5) promoter. Complexes formed by RNAP reconstituted with the α subunits indicated in the presence or absence of wild-type CRP at the CC(−61.5) promoter were reacted with potassium permanganate. The location of the reactive thymidine residues was determined by PCR with a labelled primer followed by gel electrophoresis and autoradiography. Base co-ordinates are numbered relative to the transcription startpoint. Download figure Download PowerPoint Incorporation of linker-modified α variants into RNAP in vivo To assess the effect of linker modifications on CRP-dependent transcription in vivo, the mutant rpoA alleles were transferred to the rpoA expression plasmid pLAW2 (Zou et al., 1992). In this plasmid, rpoA is under the control of the isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible lpp/lac dual promoter system and the resultant α derivative is synthesized without a His tag. The level of production of mutant α subunits and the efficiency of their incorporation into RNAP were ascertained by immunoblotting following induction of the lpp/lac promoter for 3–4 generations. Figure 7A shows an immunoblot of SDS–PAGE-fractionated whole-cell extracts using polyclonal anti-α antibody. The experiment showed that each plasmid-encoded α variant was overproduced 2- to 3-fold relative to chromosome-encoded α. To investigate the efficiency with which the plasmid-encoded α subunits are incorporated into RNAP core and holoenzyme, RNAP complexes were immunoprecipitated with a polyclonal anti-β′ antibody, subjected to SDS–PAGE and immunoblotted with anti-α antibody. The blot showed that the ratio of plasmid-encoded mutant α to chromosome-encoded wild-type α was 2.0–2.5:1 (Figure 7B), which is similar to the ratio observed in total cell protein. This result indicates that the different plasmid-encoded α variants accumulate to similar levels in this system and are incorporated into RNAP complexes equally as efficiently as the chromosome-encoded wild-type α. Therefore, in cells expressing the mutant alleles from a pLAW2 derivative, ∼90% of RNAP molecules in the cell would contain at least one plasmid-encoded α, while ∼50% of RNAP molecules would contain two plasmid-encoded α subunits (cf. Tang et al., 1994). Figure 7.Relative abundance of chromosomal and plasmid-encoded α subunits in total cell protein and RNAP complexes. (A) Western blot of SDS–PAGE-fractionated cell extracts from RLG4649 harbouring pMGM12-pMGM22 and pMGM32 grown in the presence of IPTG (1 mM). Blots were probed with a polyclonal anti-α antibody. Plasmid-encoded α subunits present in the cell extracts are indicated at the top of each lane (−, extracts from cells not harbouring an rpoA expression plasmid). Wild-type (WT) α is indicated by an arrow. (B) Comparison of the relative abundance of chromosome-encoded wild-type α and plasmid-encoded Δ9 and Ω32 α subunits in total protein (t) and RNAP complexes (c). RNAP complexes were prepared by immunoprecipitation of cell extracts with a polyclonal anti-β′ antibody. Cell extracts (t) and immunoprecipitates (c) were subjected to western blotting as in (A). The chromosome-encoded wild-type α subunit is indicated by an arrow. Download figure Download PowerPoint Effect of α linker length on CRP-dependent transcription in vivo To investigate the effects of altering the length of the α inter-domain linker on CRP-dependent transcription in vivo, the pLAW2 derivatives expressing the mutant rpoA alleles were transformed into M182 or M182Δcrp cells carrying various CRP-dependent promoter–lacZ fusions in single copy. β-galactosidase activities were assayed following induction of mutant α synthesis for 3–4 generations. In general agreement with our observations in vitro, increasing the number of amino acids removed from or inserted into the α inter-domain linker exerted a progr