Portal de Periódicos da CAPES

Characterization of p190RhoGEF, A RhoA-specific Guanine Nucleotide Exchange Factor That Interacts with Microtubules

2001; Elsevier BV; Volume: 276; Issue: 7 Linguagem: Inglês

10.1074/jbc.m003839200

1083-351X

Francis P.G. van Horck, Mohammad Reza Ahmadian, Lars Christian Haeusler, Wouter H. Moolenaar, Onno Kranenburg,

Cancer-related Molecular Pathways

Rho family GTPases control numerous cellular processes including cytoskeletal reorganization and transcriptional activation. Rho GTPases are activated by guanine nucleotide exchange factors (GEFs) which stimulate the exchange of bound GDP for GTP. We recently isolated a putative GEF, termed p190RhoGEF that binds to RhoA and, when overexpressed in neuronal cells, induces cell rounding and inhibits neurite outgrowth. Here we show that the isolated tandem Dbl homology/pleckstrin homology domain of p190RhoGEF activates RhoA in vitro, but not Rac1 or Cdc42, as determined by GDP release and protein binding assays. In contrast, full-length p190RhoGEF fails to activate RhoA in vitro. When overexpressed in intact cells, however, p190RhoGEF does activate RhoA with subsequent F-actin reorganization and serum response factor-mediated transcription. Immunofluorescence studies show that endogenous p190RhoGEF localizes to distinct RhoA-containing regions at the plasma membrane, to the cytosol and along microtubules.In vitro and in vivo binding experiments show that p190RhoGEF directly interacts with microtubules via its C-terminal region adjacent to the catalytic Dbl homology/pleckstrin homology domain. Our results indicate that p190RhoGEF is a specific activator of RhoA that requires as yet unknown binding partners to unmask its GDP/GTP exchange activity in vivo, and they suggest that p190RhoGEF may provide a link between microtubule dynamics and RhoA signaling. Rho family GTPases control numerous cellular processes including cytoskeletal reorganization and transcriptional activation. Rho GTPases are activated by guanine nucleotide exchange factors (GEFs) which stimulate the exchange of bound GDP for GTP. We recently isolated a putative GEF, termed p190RhoGEF that binds to RhoA and, when overexpressed in neuronal cells, induces cell rounding and inhibits neurite outgrowth. Here we show that the isolated tandem Dbl homology/pleckstrin homology domain of p190RhoGEF activates RhoA in vitro, but not Rac1 or Cdc42, as determined by GDP release and protein binding assays. In contrast, full-length p190RhoGEF fails to activate RhoA in vitro. When overexpressed in intact cells, however, p190RhoGEF does activate RhoA with subsequent F-actin reorganization and serum response factor-mediated transcription. Immunofluorescence studies show that endogenous p190RhoGEF localizes to distinct RhoA-containing regions at the plasma membrane, to the cytosol and along microtubules.In vitro and in vivo binding experiments show that p190RhoGEF directly interacts with microtubules via its C-terminal region adjacent to the catalytic Dbl homology/pleckstrin homology domain. Our results indicate that p190RhoGEF is a specific activator of RhoA that requires as yet unknown binding partners to unmask its GDP/GTP exchange activity in vivo, and they suggest that p190RhoGEF may provide a link between microtubule dynamics and RhoA signaling. guanine nucleotide exchange factor serum-response factor guanosine 5′-3-O-(thio)triphosphate Dbl homology pleckstrin homology Src homology domain 2 Src homology domain 3 base pair(s) polyacrylamide gel electrophoresis glutathione S-transferase guanyl-5′-yl thiophosphate hemagglutinin Jun N-terminal kinase Rho family GTPases act as molecular switches by cycling between an inactive GDP-bound and an active GTP-bound state. In the GTP-bound state they bind to effector proteins resulting in multiple downstream responses. Among the best studied effects of Rho GTPases is the regulation of the actin cytoskeleton. In fibroblasts, RhoA, Rac, and Cdc42 induce the formation of stress fibers, lamellipodia, and filopodia, respectively (1Nobes C.D. Hall A. Cell. 1995; 81: 53-62Abstract Full Text PDF PubMed Scopus (3682) Google Scholar, 2Ridley A.J. Hall A. Cell. 1992; 70: 389-399Abstract Full Text PDF PubMed Scopus (3788) Google Scholar, 3Ridley A.J. Cell. 1995; 70: 401-410Abstract Full Text PDF Scopus (3041) Google Scholar). Furthermore, Rho GTPases have been implicated in the control of diverse responses such as cell adhesion, motility, transcription activation, cell cycle progression, cytokinesis, and cell fate determination (4Mackay D.J. Hall A. J. Biol. Chem. 1998; 273: 20685-20688Abstract Full Text Full Text PDF PubMed Scopus (566) Google Scholar). Rho GTPases are activated by the Dbl family of guanine nucleotide exchange factors (GEFs),1that stimulate the exchange of GDP for GTP and are characterized by a Dbl homology (DH) domain in tandem with a pleckstrin homology (PH) domain. The DH domain is responsible for catalytic activity (5Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 62-65Abstract Full Text PDF PubMed Google Scholar), while the PH domain is essential either for proper localization (6Whitehead I. Kirk H. Tognon C. Trigo Gonzalez G. Kay R. J. Biol. Chem. 1995; 270: 18388-18395Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar, 7Olson M.F. Sterpetti P. Nagata K. Toksoz D. Hall A. Oncogene. 1997; 15: 2827-2831Crossref PubMed Scopus (62) Google Scholar) or for full catalytic activity (8Liu X. Wang H. Eberstadt M. Schnuchel A. Olejniczak E.T. Meadows R.P. Schkeryantz J.M. Janowick D.A. Harlan J.E. Harris E.A. Staunton D.E. Fesik S.W. Cell. 1998; 95: 269-277Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar). The Dbl family consists of more than 30 members, showing tissue-specific distribution patterns and distinct specificity for Rho, Rac, or Cdc42. Dbl family members contain various conserved structural motifs, like Ca2+-binding EF-hands,Src-homology 2 (SH2),Src-homology 3 (SH3), andPsd95/Dlg/ZO-1 (PDZ) homology domains (9Stam J.C. Collard J.G. Prog. Mol. Subcell. Biol. 1999; 22: 51-83Crossref PubMed Scopus (40) Google Scholar). Most of these domains presumably mediate protein-protein or protein-lipid interactions, thereby coupling GEFs to upstream regulators or downstream effectors. Some GEFs have been shown to function in specific biological processes: for example, Ect2 regulates cytokinesis (10Tatsumoto T. Xie X. Blumenthal R. Okamoto I. Miki T. J. Cell Biol. 1999; 147: 921-928Crossref PubMed Scopus (338) Google Scholar) while Vav plays a role in adaptive immunity (11Bustelo X.R. Mol. Cell. Biol. 2000; 20: 1461-1477Crossref PubMed Scopus (445) Google Scholar). Furthermore, genetic studies have revealed the importance of GEFs in development: DRhoGEF mediates cell shape changes during gastrulation of Drosophila embryos (12Barrett K. Leptin M. Settleman J. Cell. 1997; 91: 905-915Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar), and UNC-73A is required for cell and growth cone migration in Caenorhabditis elegans (13Steven R. Kubiseski T.J. Zheng H. Kulkarni S. Mancillas J. Ruiz M.A. Hogue C.W. Pawson T. Culotti J. Cell. 1998; 92: 785-795Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar). However, the biological roles of most Dbl family GEFs remain unclear. In neuronal cells, RhoA mediates neurite retraction and cell rounding in response to G protein-coupled receptor agonists such as lysophosphatidic acid and thrombin (14Jalink K. van Corven E.J. Hengeveld T. Morii N. Narumiya S. Moolenaar W.H. J. Cell Biol. 1994; 126: 801-810Crossref PubMed Scopus (572) Google Scholar). Receptor stimulation induces translocation of RhoA from the cytosol to the plasma membrane (15Kranenburg O. Poland M. Gebbink M. Oomen L. Moolenaar W.H. J. Cell Sci. 1997; 110: 2417-2427Crossref PubMed Google Scholar) and subsequent activation of RhoA. RhoA activation and neurite retraction are mediated by the G12/13 subfamily of trimeric G proteins (16Kranenburg O. Poland M. van Horck F.P. Drechsel D. Hall A. Moolenaar W.H. Mol. Biol. Cell. 1999; 10: 1851-1857Crossref PubMed Scopus (270) Google Scholar) whose (17Buhl A.M. Johnson N.L. Dhanasekaran N. Johnson G.L. J. Biol. Chem. 1995; 270: 24631-24634Abstract Full Text Full Text PDF PubMed Scopus (421) Google Scholar) activated α subunits can bind to and activate at least two distinct RhoGEFs, notably p115RhoGEF (18Hart M.J. Jiang X. Kozasa T. Roscoe W. Singer W.D. Gilman A.G. Sternweis P.C. Bollag G. Science. 1998; 280: 2112-2114Crossref PubMed Scopus (671) Google Scholar) and PDZ-RhoGEF (19Fukuhara S. Murga C. Zohar M. Igishi T. Gutkind J.S. J. Biol. Chem. 1999; 274: 5868-5879Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar). We recently isolated a novel RhoA-binding protein of 190 kDa that contains a DH/PH domain and, hence, is a putative GEF for Rho family GTPases (20Gebbink M.F. Kranenburg O. Poland M. van Horck F.P. Houssa B. Moolenaar W.H. J. Cell Biol. 1997; 137: 1603-1613Crossref PubMed Scopus (138) Google Scholar). We called this protein p190RhoGEF, and showed that it is ubiquitously expressed. When overexpressed in neuronal cells, p190RhoGEF mimics activated RhoA in stimulating cytoskeletal contraction and preventing neurite outgrowth. It remains unclear, however, to what extent the DH/PH catalytic domain of p190RhoGEF is abona fide activator of RhoA and/or other Rho family members. p190RhoGEF contains several potential regulatory motifs, including an N-terminal leucine-rich region, a cysteine-rich zinc-finger domain and a C-terminal region that may form an α-helical coiled-coil (Fig.1). In the present study, we have characterized p190RhoGEF in further biochemical and cell biological detail. We show that p190RhoGEF is a specific activator of RhoA both in vitro and in vivo. We find that full-length p190RhoGEF, unlike its isolated DH/PH domain, is inactive in vitro, indicating that additional factors are required to activate p190RhoGEF in vivo. Furthermore, we show that p190RhoGEF binds to and colocalizes with microtubules, suggesting that p190RhoGEF may provide a link between microtubule dynamics and RhoA signaling. COS-7 and N1E-115 cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum and antibiotics and NIH3T3 cells were cultured in Dulbecco's modified Eagle's medium containing 10% newborn calf serum and antibiotics. COS-7 cells were transfected using the DEAE-dextran method, whereas NIH3T3 cells were transfected using LipofectAMINE PLUS (Life Technologies) as described by the manufacturer. For luciferase assays, transfection was stopped after 3 h by switching to culture medium containing 0.5% newborn calf serum. Cloning of full-length p190RhoGEF (bp 1–5400) and ΔNp190RhoGEF (bp 2156–5400) has been described (20Gebbink M.F. Kranenburg O. Poland M. van Horck F.P. Houssa B. Moolenaar W.H. J. Cell Biol. 1997; 137: 1603-1613Crossref PubMed Scopus (138) Google Scholar). pcDNA3-HA-p190RhoGEF was generated in two steps. First, a polymerase chain reaction was performed on pBSKML4 using primers gctctagaaggtaccccatggagttgagctgcagtg and T3, followed by digestion withXba I-Apa I and subcloning into pcDNA3-HA, resulting in pcDNA3-HA-ΔRhoGEF. Subsequently, anApa I-Apa I fragment of full-length p190RhoGEF (bp 625–5400) was cloned into pcDNA3-HA-ΔRhoGEF resulting in the final construct pcDNA3-HA-p190RhoGEF (bp 105–5400). Removal of a Bst EII-Not I fragment from pcDNA3-HA-p190RhoGEF generated ΔCp190RhoGEF (bp 105–4135). The p190RhoGEF-DH/PH (bp 2534–3734) deletion mutant was generated by using primers cccggtcgacttctctgtggatcgacct and ccccgcggccgcggcca. Polymerase chain reaction was performed on the full-length p190RhoGEF cDNA, followed by digestion with Sal I and Not I and subcloning into pMT2sm-HA. The Quick mutagenesis kit (Stratagene) was used to make a single-point mutation, Y1003A, in pcDNA3-HA-p190RhoGEF using the primers cccagcgcatcacaaaggccccagtcttggtgg and ccaccaagactggggcctttgtgatgcgctggg. The GST-C terminus (bp 4189–5400) construct was prepared by subcloning aBam HI-Eco RI fragment from pcDNA3-HA-p190RhoGEF into pRP259, a derivative of pGEX-1N. The construction of pGEX-C21 (GST-C21), pGST-PAK-CD (GST-PBD), pMT2smHA-C1199Tiam1 and SRE.L-luciferase plasmids are described elsewhere (21Sander E.E. van Delft S. ten Klooster J.P. Reid T. van der Kammen R.A. Michiels F. Collard J.G. J. Cell Biol. 1998; 143: 1385-1398Crossref PubMed Scopus (585) Google Scholar, 22Reid T. Furuyashiki T. Ishizaki T. Watanabe G. Watanabe N. Fujisawa K. Morii N. Madaule P. Narumiya S. J. Biol. Chem. 1996; 271: 13556-13560Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar, 23Michiels F. Stam J.C. Hordijk P.L. van der Kammen R.A. Ruuls-Van Stalle L. Feltkamp C.A. Collard J.G. J. Cell Biol. 1997; 137: 387-398Crossref PubMed Scopus (210) Google Scholar, 24Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar). A polyclonal anti-RhoGEF serum, termed antibody 40, was made by immunizing rabbits with a GST fusion protein containing the DH/PH domain of p190RhoGEF (bp 2534–3734). This plasmid was generated by subcloning a Sal I-Eco RI fragment from pMT2smHA-DH/PH cDNA into pRP261, a derivative of pGEX-3X. Rho and Rac proteins were detected with 26C4 (Santa Cruz Biotechnology) and 23A8 (Upstate Biotechnology) monoclonal antibodies. GST was detected with the 2F3 monoclonal antibody. Cytoskeletal structures were analyzed using rhodamine-conjugated phalloidin (Molecular probes) and monoclonal anti-tubulin antibodies (Sigma). A polyclonal anti-tubulin antibody (Sigma) was used for immunoprecipitation. Recombinant Rho was prepared fromEscherichia coli using a bacterial expression system as described previously (25Self, A. J., and Hall, A. (1995) in Small GTPases and Their Regulators, W.E. Balch, C.J. Der, A. Hall, Pt. B, pp. 3–10, Academic Press Inc., New YorkGoogle Scholar). Single 9-cm dishes of COS-7 cells were transiently transfected with 5 μg of expression plasmid encoding HA-tagged DH/PH domain. In case full-length p190RhoGEF was assayed, 20 dishes were transfected. After 48 h cells were lysed in 300 μl of 100 mm NaCl, 20 mm Tris-HCl, pH 8.0, 1 mm EDTA, 1 mm dithiothreitol, 0.2% Triton X-100 and protease inhibitors. After clearance (13,000 rpm, 10 min), cell lysates were precleared with nonspecific mouse immunoglobulins precoupled to protein A-Sepharose CL-4B (Amersham Pharmacia Biotech) and subsequently incubated with 12CA5 monoclonal antibodies coupled to protein A-Sepharose. GDP dissociation from RhoA was assayed exactly as described (26Zheng Y. Hart M.J. Cerione R.A. Methods Enzymol. 1995; 256: 77-84Crossref PubMed Scopus (70) Google Scholar) using 30 μl of slurry (50% beads/buffer) per assay. Control immune complexes were prepared from mock-transfected COS-7 cells. Recombinant proteins of DH/PH domain, truncated RhoA (amino acid residues 1–181), Rac1 and Cdc42 were produced as GST fusion proteins in E. coli strain BL21 (DE3) and purified by glutathione-Sepharose affinity chromatography (Amersham Pharmacia Biotech, Uppsala, Sweden) as described (27Ahmadian M.R. Mittal R. Hall A. Wittinghofer A. FEBS Lett. 1997; 408: 315-318Crossref PubMed Scopus (65) Google Scholar). The fluorescent derivative of GDP, mGDP (2′,3′-O-(N-methylanthraniloyl)guanosine 5′-diphosphate), in complex with the respective GTPases was prepared (28Lenzen C. Cool R.H. Wittinghofer A. Methods Enzymol. 1995; 255: 95-109Crossref PubMed Scopus (120) Google Scholar). The nucleotide exchange activity of the DH/PH domain was determined on an LS50B Perkin-Elmer spectrofluorometer (Norwalk, CT) using 0.1 μm mGDP-bound GTPase, 20 μm GDP, and different concentration of DH/PH domain in 30 mmTris-HCl, 5 mm MgCl2, 10 mmKPO4, 3 mm dithioerythritol, pH 7.5, at 25 °C as described for Cdc25 (28Lenzen C. Cool R.H. Wittinghofer A. Methods Enzymol. 1995; 255: 95-109Crossref PubMed Scopus (120) Google Scholar). Exponential fits to the data were done using the program Grafit (Erithacus software). Preparation of GST-C21 and GST-PBD and analysis of cellular activation of Rho and Rac was performed as described previously (21Sander E.E. van Delft S. ten Klooster J.P. Reid T. van der Kammen R.A. Michiels F. Collard J.G. J. Cell Biol. 1998; 143: 1385-1398Crossref PubMed Scopus (585) Google Scholar, 22Reid T. Furuyashiki T. Ishizaki T. Watanabe G. Watanabe N. Fujisawa K. Morii N. Madaule P. Narumiya S. J. Biol. Chem. 1996; 271: 13556-13560Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). In brief, transfected COS-7 cells were lysed in Nonidet P-40 fish buffer. Lysates were centrifuged to remove debris, and incubated for 45 min at 4 °C with 20 μl of GSH-Sepharose loaded with 20 μg of either GST-C21 or GST-PBD. The beads were washed three times with the Nonidet P-40 buffer and the bound proteins were separated by SDS-PAGE and Western blotting. To determine interactions between p190RhoGEF and GST-GTPases, transfected COS-7 cells were lysed in a buffer containing 0.1% Triton X-100, 150 mm NaCl, 50 mm Tris-HCl, pH 7.4, 10 mm EDTA, and protease inhibitors. Lysates were incubated for 2 h at 4 °C withE. coli expressed, GST-RhoA, GST-Rac, or GST-Cdc42 bound to GSH-Sepharose. Samples were washed three times in the 0.1% Triton X-100 buffer and the bound proteins were subjected to SDS-PAGE and Western blotting using monoclonal antibody 12CA5. Experiments testing the nucleotide dependence of the interactions were performed similarly, except that GST-RhoA was preloaded in a buffer containing 20 mm Tris-HCl, 1 mm dithiothreitol, 10 mm EDTA, 5 mm MgCl2, and 50 μm of either GDP or GTPγS for 1 h at 4 °C. N1E-115 and NIH3T3 cells were grown on glass coverslips. After overnight culturing in serum-free medium, the cells were fixed in 3.7% formaldehyde and were processed for immunofluorescence as described (15Kranenburg O. Poland M. Gebbink M. Oomen L. Moolenaar W.H. J. Cell Sci. 1997; 110: 2417-2427Crossref PubMed Google Scholar) using 12CA5, antibody 40, or anti-RhoA antibodies as indicated. Rhodamine-conjugated phalloidin and anti-tubulin antibody were used to stain F-actin and tubulin, respectively. Luciferase activities were measured 24 h after the start of the transfection by using the Dual-Luciferase Reporter Assay System (Promega) as described by the manufacturer. In the Dual-Luciferase Reporter assay the activities of firefly and Renilla luciferases are measured sequentially from a single sample. Luminescence intensities were measured using the TD 20/20 luminometer (Turner Designs model, Promega) counting the ratio of luminescence between the firefly and the Renilla luciferase reactions. Transfected COS-7 cells were lysed in tubulin buffer (Cytoskeleton) containing 0.1% Triton X-100. Lysates were centrifuged at 100,000 × g for 1 h in a Beckman airfuge. Supernatant fractions were incubated for 30 min at room temperature with purified, Taxol-stabilized microtubules, which were generated using the Microtubule/Tubulin Biochem Kit from Cytoskeleton. Alternatively, purified GST fusion proteins were prepared and incubated with microtubules. Microtubules were pelleted by high-speed centrifugation (100,000 × g for 1 h) and supernatant and pellet fractions were subjected to SDS-PAGE and immunoblotting using anti-HA or anti-tubulin antibodies. p190RhoGEF was expressed in COS-7 cells as described above. Two days after transfection cells were serum-starved for 1 h, labeled with [35S]methionine/cysteine for 4 h, and then lysed in a buffer containing 0.2% Triton X-100, 100 mm NaCl, 20 mm Tris, pH 7.4, 1 mm dithiothreitol, 1 mm EGTA, and 5 mm MgCl2. Lysates were clarified and precipitated with 12CA5 or tubulin antibodies precoupled to protein A-Sepharose. Reprecipitation was performed by boiling the immunoprecipitates for 5 min in lysis buffer containing 0.1% SDS, followed by adding 9 volumes of lysis buffer and antibodies precoupled to protein A-Sepharose. Precipitates were washed extensively, subjected to SDS-PAGE, and analyzed by autoradiography. Fig.1 shows the structural features of p190RhoGEF in comparison to other Dbl family GEFs. The DH/PH domain of p190RhoGEF is most closely related to the DH/PH domains in the Rho-specific GEFs Brx and proto-Lbc (52% identity), Lfc (50%), GEF-H1 (48%), and p115RhoGEF (25%) (22Reid T. Furuyashiki T. Ishizaki T. Watanabe G. Watanabe N. Fujisawa K. Morii N. Madaule P. Narumiya S. J. Biol. Chem. 1996; 271: 13556-13560Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar, 23Michiels F. Stam J.C. Hordijk P.L. van der Kammen R.A. Ruuls-Van Stalle L. Feltkamp C.A. Collard J.G. J. Cell Biol. 1997; 137: 387-398Crossref PubMed Scopus (210) Google Scholar, 24Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar, 25Self, A. J., and Hall, A. (1995) in Small GTPases and Their Regulators, W.E. Balch, C.J. Der, A. Hall, Pt. B, pp. 3–10, Academic Press Inc., New YorkGoogle Scholar, 26Zheng Y. Hart M.J. Cerione R.A. Methods Enzymol. 1995; 256: 77-84Crossref PubMed Scopus (70) Google Scholar). Aside from its DH/PH domain, p190RhoGEF contains an N-terminal leucine-rich region and a cysteine-rich domain that could form a zinc finger. C-terminal of the DH/PH domain, p190RhoGEF contains a region with high propensity to form coiled coils, as is also observed in GEF-H1. We note that p190RhoGEF lacks an apparent LH domain that can interact directly with G protein α subunits, as in p115RhoGEF (18Hart M.J. Jiang X. Kozasa T. Roscoe W. Singer W.D. Gilman A.G. Sternweis P.C. Bollag G. Science. 1998; 280: 2112-2114Crossref PubMed Scopus (671) Google Scholar). We examined whether p190RhoGEF can stimulate GDP/GTP exchange on Rho family GTPases in vitro. Specific exchange activity was determined using an assay in which the dissociation of fluorescently labeled GDP from RhoA, Rac1, or Cdc42 is monitored in real time (28Lenzen C. Cool R.H. Wittinghofer A. Methods Enzymol. 1995; 255: 95-109Crossref PubMed Scopus (120) Google Scholar). As shown in Fig. 2 A, the isolated DH/PH domain promotes nucleotide exchange on RhoA, but not on Rac-1 or Cdc42. The p190RhoGEF catalytic domain stimulates the rate of nucleotide exchange on RhoA about 40-fold (from 0.0048 min−1 to 0.193 min−1). We find a similar stimulation using the DH/PH domain of p115RhoGEF (data not shown), which is 4-fold higher than what has been reported for p115RhoGEF-mediated GDP/GTP exchange (29Hart M.J. Sharma S. elMasry N. Qiu R.G. McCabe P. Polakis P. Bollag G. J. Biol. Chem. 1996; 271: 25452-25458Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). To examine whether p190RhoGEF acts as a Rho-specific GEF in vivo, we measured endogenous RhoA activation by affinity precipitation. In this assay, the Rho-binding domain of rhotekin (GST-C21) is used to specifically precipitate GTP-bound RhoA from cell extracts (30Reid T. Bathoorn A. Ahmadian M.R. Collard J.G. J. Biol. Chem. 1999; 274: 33587-33593Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Similarly, the Cdc42/Rac interactive binding domain of the Rac/Cdc42 effector protein PAK (GST-PBD) was used to pull-down activated Rac (31Manser E. Loo T.H. Koh C.G. Zhao Z.S. Chen X.Q. Tan L. Tan I. Leung T. Lim L. Mol. Cell. 1998; 1: 183-192Abstract Full Text Full Text PDF PubMed Scopus (630) Google Scholar). Fig. 2 B shows that expression of the isolated DH/PH domain of p190RhoGEF in COS-7 cells activates RhoA but not Rac1. Conversely, the Rac-specific GEF Tiam-1 (32Habets G.G.M. Scholtes E.H. Zuydgeest D. van der Kammen R.A. Stam J.C. Berns A. Collard J.G. Cell. 1994; 77: 537-549Abstract Full Text PDF PubMed Scopus (472) Google Scholar) activates Rac-1 but not RhoA in COS-7 cells (Fig. 2 B). Both RhoA and Rac1 appear as doublets, presumably representing differently isoprenylated forms of these GTPases (33Seabra M.C. Cell Signal. 1998; 10: 167-172Crossref PubMed Scopus (222) Google Scholar). Taken together, these results demonstrate that the catalytic domain of p190RhoGEF acts specifically on RhoA bothin vitro and in vivo. GEF-mediated stimulation of GDP/GTP exchange involves a direct interaction between GEF and the small GTPase. Although these complexes form transiently, they can be isolated from cells (5Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 62-65Abstract Full Text PDF PubMed Google Scholar). Since p190RhoGEF shows in vitro and in vivo exchange activity toward RhoA, we examined whether the two proteins can form a complex. To this end, we precipitated full-length p190RhoGEF (HA-tagged) from COS-7 cell lysates using immobilized GST fusion proteins of RhoA, Rac1, or Cdc42. As shown in Fig. 3 A, we find that p190RhoGEF binds to RhoA but not to Rac1 or Cdc42. GEFs stimulate GDP/GTP exchange by inducing a conformational change in the GTPase, resulting in the release of bound GDP. GEFs stabilize a transition state, in which interaction occurs with nucleotide-free GTPase. Since cellular GTP levels are much higher than GDP levels, this leads to net GDP/GTP exchange on the GTPase (34Cherfils J. Chardin P. Trends Biochem. Sci. 1999; 24: 306-311Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). We examined the binding of p190RhoGEF to RhoA in both nucleotide-bound and nucleotide-free states. Nucleotide was depleted from GST-RhoA by chelating magnesium from the assay buffer. Alternatively, GST-RhoA was loaded with either GDPβS or GTPγS. Fig. 3 B shows that p190RhoGEF associates with all three forms of RhoA, although it appears that there is a slight preference for binding to nucleotide-depleted RhoA. This is in agreement with previous findings on the binding of other GEFs to small GTPases (5Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 62-65Abstract Full Text PDF PubMed Google Scholar, 35Glaven J.A. Whitehead I.P. Nomanbhoy T. Kay R. Cerione R.A. J. Biol. Chem. 1996; 271: 27374-27381Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Aside from the tandem DH/PH domain, p190RhoGEF contains several structural elements that may play a role in regulating its activity and/or intracellular localization. We compared thein vitro exchange activity of the full-length protein to that of the isolated catalytic DH/PH domain. Fig.4 A shows that, while the DH/PH domain promotes GDP/GTP exchange on RhoA, the full-length protein is completely inactive. About equal amounts of proteins were precipitated from the cell lysates (Fig. 4 A, lower panel). Even under conditions where the full-length protein was used in excess of the DH/PH domain, exchange activity was only detected with the isolated DH/PH domain (Fig. 4 B). Although the Rho-specific GEFs Ect-2 and GEF-H1 are active as full-length proteins (10Tatsumoto T. Xie X. Blumenthal R. Okamoto I. Miki T. J. Cell Biol. 1999; 147: 921-928Crossref PubMed Scopus (338) Google Scholar, 36Ren Y. Li R. Zheng Y. Busch H. J. Biol. Chem. 1998; 273: 34954-34960Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar), the activities of most GEFs have only been tested with the isolated DH/PH domains. Of note, in fibroblast transformation assays, Lbc, Dbl, Ost, and p115RhoGEF are only active when truncated (5Hart M.J. Eva A. Zangrilli D. Aaronson S.A. Evans T. Cerione R.A. Zheng Y. J. Biol. Chem. 1994; 269: 62-65Abstract Full Text PDF PubMed Google Scholar, 29Hart M.J. Sharma S. elMasry N. Qiu R.G. McCabe P. Polakis P. Bollag G. J. Biol. Chem. 1996; 271: 25452-25458Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 37Sterpetti P. Hack A.A. Bashar M.P. Park B. Cheng S.D. Knoll J.H. Urano T. Feig L.A. Toksoz D. Mol. Cell. Biol. 1999; 19: 1334-1345Crossref PubMed Scopus (68) Google Scholar, 38Ron D. Tronick S.R. Aaronson S.A. Eva A. EMBO J. 1988; 7: 2465-2473Crossref PubMed Scopus (83) Google Scholar, 39Horii Y. Beeler J.F. Sakaguchi K. Tachibana M. Miki T. EMBO J. 1994; 13: 4776-4786Crossref PubMed Scopus (185) Google Scholar). The striking difference in in vitro activity between full-length and truncated p190RhoGEF suggests that the full-length protein contains an intrinsic autoinhibitory domain and requires cellular factors to be activated. When activated, RhoA, Rac, and Cdc42 induce specific rearrangements of the actin cytoskeleton. In fibroblasts, RhoA induces stress fiber formation, whereas lamellipodia and filopodia are formed in response to activated Rac and Cdc42, respectively. We examined the cytoskeletal changes induced by full-length p190RhoGEF in NIH-3T3 fibroblasts. As shown in Fig.5 A, p190RhoGEF mimics active RhoA in inducing the formation of actin stress fibers, with no sign of the formation of membrane ruffles or filopodia. These findings in 3T3 cells are consistent with the observation that p190RhoGEF induces cytoskeletal contraction and inhibits neurite outgrowth in N1E-115 neuroblastoma cells (20Gebbink M.F. Kranenburg O. Poland M. van Horck F.P. Houssa B. Moolenaar W.H. J. Cell Biol. 1997; 137: 1603-1613Crossref PubMed Scopus (138) Google Scholar). In addition to their effects on the actin cytoskeleton, Rho GTPases can modulate gene transcription. In particular, activated forms of RhoA, Rac1, and Cdc42 can activate the serum response factor (SRF) (40Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1197) Google Scholar). We examined whether p190RhoGEF could activate SRF-mediated transcription by using a reporter plasmid in which the luciferase gene is under the control of a c-Fos serum-responsive promotor element (pSRE.L). This modified SRE element depends on SRF, but not on Elk-1 activity, making it a specific reporter for signaling by Rho family GTPases (24Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar). NIH-3T3 cells were transiently co-transfected with pSRE.L and full-length p190RhoGEF. As shown in Fig. 5 B, expression of p190RhoGEF results in a 5-fold activation of SRF, similar to what is observed after serum stimulation (Fig. 5 B). We also used a point mutant of p190RhoGEF in which residue Tyr10