Portal de Periódicos da CAPES

Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas

2007; Wiley; Volume: 177; Issue: 4 Linguagem: Inglês

10.1111/j.1469-8137.2007.02320.x

1469-8137

D. Lee Taylor, Melissa McCormick,

Plant and animal studies

New PhytologistVolume 177, Issue 4 p. 1020-1033 Free Access Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas D. Lee Taylor, D. Lee Taylor University of Alaska, Institute of Arctic Biology, 311 Irving I Building, Fairbanks, AK 99775, USA;Search for more papers by this authorMelissa K. McCormick, Melissa K. McCormick Smithsonian Environmental Research Center, Edgewater, MD 21037, USASearch for more papers by this author D. Lee Taylor, D. Lee Taylor University of Alaska, Institute of Arctic Biology, 311 Irving I Building, Fairbanks, AK 99775, USA;Search for more papers by this authorMelissa K. McCormick, Melissa K. McCormick Smithsonian Environmental Research Center, Edgewater, MD 21037, USASearch for more papers by this author First published: 10 December 2007 https://doi.org/10.1111/j.1469-8137.2007.02320.xCitations: 212 Author for Correspondence: D. Lee Taylor Tel: +1 907 474 6982 Fax: +1 907 474 6967Email: [email protected] AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Summary • Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. • Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. • Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora–Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. • Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples. Introduction The Orchidaceae is the most species-rich family of flowering plants. Along with other unique features, the Orchidaceae is characterized by a novel form of mycorrhizal interaction. The diagnostic feature of these mycorrhizas is the intracellular coils of hyphae, which have a superficial resemblance to the Paris form of arbuscular mycorrhizas (Smith & Read, 1997). However, rather than the Glomeromycotan fungi which engage in all arbuscular mycorrhizal associations, nearly all known orchid mycorrhizas are formed with fungi of the Basidiomycota (Rasmussen, 1995; Taylor et al., 2002). The identification of orchid mycorrhizal fungi is a critical first step in exploring the biology of this symbiosis, on which all orchids so far studied depend to complete their life cycles in nature (Arditti et al., 1990). This first step is difficult for a number of reasons. The majority of fungi that have been recorded as orchid mycorrhizal symbionts belong to the anamorphic form-genus Rhizoctonia (Burgeff, 1959; Hadley, 1982; Rasmussen, 1995). This genus includes fungi with perfect states belonging to the Ascomycota and the Pucciniomycotina and Agaricomycotina of the Basidiomycota (Roberts, 1999). However, all recorded orchid-associated Rhizoctonia species belong to the Ceratobasidiaceae, Sebacinaceae and Tulasnellaceae of the Agaricomycotina (Wells, 1994). The best-known Rhizoctonia species among these three families is the damping-off root pathogen R. solani (teleomorph Thanatephorus cucumeris) of the Ceratobasidiaceae. All three families lie in a gray area occupied by diverse basal hymenium-forming fungi, most having septate basidia, leading to perpetual disagreements about the relationships among Rhizoctonia species and the placements of these families within the Agaricomycotina (see Wells, 1994; Weiss & Oberwinkler, 2001). Morphology is naturally the first choice for species discrimination in eukaryotes, including fungi. However, in most fungi where complex fruit bodies are absent, such as the three families containing orchid-associated Rhizoctonia species, morphological species delimitation is difficult. This difficulty is further multiplied when even the cryptic, resupinate fruiting structures are rarely seen. In the Ceratobasidiaceae, vegetative hyphal morphologies are mostly homogeneous within genera, while many characters overlap between species or vary environmentally or developmentally within individuals (Andersen, 1990). Basidial morphology provides reliable identification of orchid-associated Rhizoctonia species at the morpho-species level (Warcup & Talbot, 1966, 1967, 1971, 1980), but orchid isolates have very rarely been induced to fruit in culture (Ramsay et al., 1986; Currah et al., 1987, 1990; Milligan & Williams, 1988). Septal ultrastructure is a concrete character which clearly distinguishes the major clades within Rhizoctonia (Khan & Kimbrough, 1982; Marchisio et al., 1985; Currah & Sherburne, 1992), although the Sebacinaceae and Tulasnellaceae require detailed observation to separate (Andersen, 1996). However, the methods involved are laborious and ultrastructure does not separate species within a genus. The fungal isolation step is another major stumbling block in orchid mycorrhizal research. The symbionts of some orchid species can be routinely isolated (Rasmussen, 1995). However, isolation success in many orchids varies with season and prior disturbance (Ramsay et al., 1986) and has been shown to decline within hours of collection in some epiphytic Andean orchids (Suarez et al., 2006). Furthermore, the symbionts of a number of orchids, especially nonphotosynthetic ones, are difficult or impossible to isolate (Downie, 1943; Burgeff, 1959; Warcup, 1981, 1985; Taylor & Bruns, 1997; Taylor et al., 2003). Finally, nonsymbiotic fungi can be isolated (Warcup & Talbot, 1967; Suarez et al., 2006), leading to suspect conclusions concerning the biology of the symbiosis (see Taylor et al., 2002). Molecular methods based on fungal-specific PCR amplification of the nuclear ribosomal internal transcribed spacer (ITS) have revolutionized characterization of ecto-, ericoid and arbuscular mycorrhizas (Gardes et al., 1991; Gardes & Bruns, 1993; Redecker, 2000; Horton & Bruns, 2001; Vralstad et al., 2002). While the ITS region has certain limitations, it is unlikely to be displaced as the most effective single locus for identification of environmental fungi at the species to genus level (Bruns, 2001 contra Seifert et al., 2007). PCR-based approaches are helping to overcome the problems associated with limited morphological variation and culture biases in orchid mycorrhizal research (Taylor & Bruns, 1997; Bidartondo et al., 2004; McCormick et al., 2004; Selosse et al., 2004; Taylor et al., 2004; Suarez et al., 2006). However, three major hurdles still stand in the way of comprehensive and unbiased molecular identification of orchid mycorrhizal symbionts. First, the most commonly encountered fungal symbionts of orchids belong to the Tulasnellaceae, yet these fungi have proven difficult to characterize using standard PCR primer sets, apparently because of accelerated evolution of the nuclear ribosomal operon (Binder et al., 2005; Moncalvo et al., 2006) and consequent mutation of bases in conserved regions to which primers hybridize (Taylor et al., 2002). A compelling example of this problem is seen in the recent study of mycorrhizal associations in several epiphytic species of the Pleurothallinae growing in the Andes (Suarez et al., 2006). Electron microscopic examination of mycorrhizal tissues with pelotons revealed a predominance of fungi with dolipore septa and imperforate, slightly curved parenthesomes that are diagnostic of the Tulasnellaceae. However, using an array of standard primers, few of these fungi were amplified. Instead, a variety of low-level contaminants, particularly ascomycetes, were amplified (the septa of which were not seen in mycorrhizal structures). Only when nested PCR and several Tulasnella-specific primers were used did the true mycorrhizal fungi appear in the molecular surveys. Secondly, owing to the extremely high diversity of fungi in environmental samples such as ectomycorrhizal roots or soil, it has been difficult to track particular fungal species outside of the orchids with which they associate. Third, there is a paucity of ITS sequences from well characterized isolates or fruitbodies in several of the most important orchid-associated clades, particularly within the Tulasnellaceae, Sebacinaceae and Ceratobasidiaceae. The result is that many fungal clades are known only from sequence data, without connection to a whole organism whose physiology, morphology, anatomy, etc. can be studied. To help combat these issues, we have developed new fungal-selective primers which minimize amplification of plant sequences while allowing robust amplification of all tested Basidiomycota, including Tulasnella. The purpose of this primer pair is to characterize fungal diversity in mycorrhizas of unstudied orchids. In addition, we have developed more selective primer sets to amplify the ITS from the orchid-associated core of the genus Tulasnella, and the Thelephora–Tomentella complex. These primers sets should help to elucidate the distribution and natural histories of particular orchid-associated fungi in natural environments. Lastly, we have sequenced the ITS region from several fungi isolated from orchids in the landmark studies of Jack Warcup and Randolf Currah in order to improve phylogenetic resolution of orchid-associated fungi and in the hope that additional clades of environmental sequences can be connected to whole organisms. Warcup and Talbot isolated mycorrhizal fungi from a wide spectrum of Australian terrestrial orchids and were one of the few teams who succeeded in inducing teleomorph formation from a large percentage of their isolates. The sexual structures allowed detailed taxonomic work as well as analyses of patterns of specificity in these orchids (Warcup & Talbot, 1966, 1967, 1971, 1980; Warcup, 1971, 1981, 1985). In turn, Currah and colleagues obtained numerous isolates from North American terrestrial orchids, characterized their anamorphic states (rarely, teleomorphs) and conducted a study of septal ultrastructure in representative strains (Currah, 1987; Currah et al., 1987, 1988, 1990, 1997; Mordue et al., 1989; Currah & Sherburne, 1992; Currah & Zelmer, 1992; Zelmer et al., 1996). These studies are widely used for comparison of newly isolated orchid strains. Materials and Methods Primer design and testing An alignment of the 3′ region of the nuclear small subunit ribosomal gene with representatives of the major fungal phyla (Chytridiomycota, Blastocladiomycota, Zygomycota, Glomeromycota, Ascomycota, Basidiomycota), diverse basidiomycetes, the major Rhizoctonia groups and other orchid-associated lineages was initiated in ClustalW and modified by eye in paup*b10 (Swofford, 1990) and Se-Al (Rambaut, 1996). A similar alignment of the 5′ end of the nuclear large subunit ribosomal gene was also constructed. GenBank sequences from diverse vascular plants, including several members of the Orchidaceae, were added to both alignments. Previously described primers commonly used to amplify the ITS region were located on the SSU and LSU alignments. Prospective new primer regions were then imported to NetPrimer (Premier Biosoft, Palo Alto, CA, USA) and checked for unwanted secondary structure and cross-hybridization and also modified to achieve desirable annealing temperatures (between 50 and 65˚C and < 3˚C difference between paired primers). Prospective primers obtaining relatively high scores in Net Primer (above 87) were then tested for specificity to the target clade and breadth of amplification within the target clade both in silico and empirically. In silico testing was carried out using the 'find short nearly exact matches' version of nucleotide blast for searching GenBank on the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST/; Altshul et al., 1997). The top 1000–5000 matches from each search were assessed using the Taxonomy Reports and Lineage Reports output options. The optimal primers we developed are listed in Table 1. Table 1. Primer sequences, recommended primer pairs and annealing temperatures Primer Target clade Sequence Paired primer Temperature (ºC) ITS1-OF All Basidiomycota (mix these two primers) AACTCGGCCATTTAGAGGAAGTAACTTGGTCATTTAGAGGAAGT ITS4-OF 60 ITS4-OF All Basidiomycota GTTACTAGGGGAATCCTTGTT ITS1-OF ITS4-Tul Tulasnella CCGCCAGATTCACACATTGA ITS1 or ITS5 54 SSU1318-Tom Thelephoraceae CGATAACGAACGAGACCTTAT LSU-Tom4 62 LSU-Tom4 Tomentella/Thelephora GCCCTGTTCCAAGAGACTTA SSU1318-Tom Sequences of new primers designed in this study are given, along with recommendations for primers with which to pair the new primers and annealing temperatures for the PCR. In one case, one of the two primers in the recommended pair has been previously published: ITS1; ITS5 is also a good option (White et al., 1990). Empirical tests of primer performance were carried out using 56 DNA extracts, representing the following: most major clades of the Agaricomycotina (= 'hymenomycetes') (Hibbett et al., 2007), including Tremellomycetes, Dacrymycetes, Auriculariales, Gomphales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Sebacinales, Thelephorales, and Agaricales, but missing the Geastrales, Hysterangiales, Phallales, Gloeophorales, Wallemiomycetes and Entorhizomycetes; the major orchid-associated Rhizoctonia clades Tulasnellaceae, Ceratobasidiaceae, and Sebacinaceae; diverse members of the Thelephoraceae; several vascular plants, including three orchid species (Table 2; additional details of DNA sources are given in Supplementary Material, Table S1). Table 2. Results of empirical polymerase chain reaction (PCR) trials to test primer breadth and selectivity Family/lineage ITS1/ITS4 ITS1F/ITS4 ITS1OF/ITS4OF ITS1/ITS4-Tul SSU1318 Tom/LSU-Tom4 Cortinarius traganus Agaricales +++ +++ +++ – (+) Galerina patagonica Agaricales +++ +++ +++ (+) – Fomitopsis pinicola Aphyllophorales +++ +++ +++ – – Auricularia cornea Auriculariales +++ +++ +++ (+) (+) Exidia crenata Auriculariales +++ +++ +++ (+) + Exidia sp. Auriculariales +++ +++ +++ – – Exidiopsis punicea Auriculariales +++ + + – – Heterochaete sp. Auriculariales +++ +++ +++ – – Tipularia protocorm mycorrhiza Auriculariales MB +++ +++ +++ – Tipularia protocorm mycorrhiza Auriculariales MB + ++ – – Alpova sp. Boletales +++ +++ +++ (+) – Boletus edulis Boletales +++ +++ +++ – – Dacrymyces capitatus Dacrymycetales +++ +++ +++ – – Dacrymyces cerasi Dacrymycetales ++ +++ + – – Geastrum mammosum Geastrales +++ +++ +++ – – Gomphus floccosus Gomphoid-Phalloid ++ +++ + – – Polyporus brumalis Polyporoid +++ +++ ++ – – Trametes versicolor Polyporoid +++ +++ +++ – (+) Trichaptum abietinum Polyporoid ++ +++ ++ – – Ceratobasidium sp. Rhizoctonia, Ceratobasidiaceae +++ +++ +++ – – Ceratobasidium sphaerosporum Rhizoctonia, Ceratobasidiaceae ++ +++ ++ – – Moniliopsis anomala Rhizoctonia, Ceratobasidiaceae +++ +++ +++ – – Rhizoctonia versicolor Rhizoctonia, Ceratobasidiaceae +++ +++ +++ – – Sistotrema sp. Rhizoctonia, Ceratobasidiaceae +++ +++ +++ – – Thanatephorus ochraceus Rhizoctonia, Ceratobasidiaceae +++ +++ +++ – – Fungus isolated from Hexalectris spicata Rhizoctonia, Sebacinaceae +++ ++ +++ – – Sebacina vermifera Rhizoctonia, Sebacinaceae +++ +++ +++ – – Epulorhiza anaticula Rhizoctonia, Tulasnellaceae +++ (+) +++ +++ – Tulasnella cystidiophora Rhizoctonia, Tulasnellaceae +++ (+) ++ (+) – Tulasnella calospora Rhizoctonia, Tulasnellaceae +++ ++ +++ +++ – Tulasnella irregularis Rhizoctonia, Tulasnellaceae +++ + +++ +++ – Tulasnella sp. from Goodyera Rhizoctonia, Tulasnellaceae +++ (+) +++ +++ – Tulasnella sp. from Tipularia Rhizoctonia, Tulasnellaceae +++ ++ +++ +++ ++ Tulasnella sp. from Tipularia Rhizoctonia, Tulasnellaceae ++ + +++ +++ – Tulasnella sp. from Tipularia Rhizoctonia, Tulasnellaceae +++ + +++ +++ – Tulasnella violea Rhizoctonia, Tulasnellaceae +++ (+) +++ +++ – Lactarius resimus Russulaceae +++ ++ ++ – – Lactarius torminosus Russulaceae +++ ++ +++ – – Russula brevipes Russulaceae +++ +++ +++ – + Hydnellum peckii Thelephorales, Bankeraceae ++ ++ +++ – – Fungus isolated from Cephalanthera austinae Thelephorales, Thelephoraceae +++ +++ +++ – +++ Fungus isolated from Cephalanthera austinae Thelephorales, Thelephoraceae +++ +++ +++ – +++ Fungus isolated from Corallorhiza odontorhiza Thelephorales, Thelephoraceae +++ +++ +++ + +++ Fungus isolated from Corallorhiza odontorhiza Thelephorales, Thelephoraceae +++ +++ +++ + +++ Tomentella sp. Thelephorales, Thelephoraceae +++ +++ +++ + ++ Tomentella sp. Thelephorales, Thelephoraceae +++ +++ +++ + +++ Tomentella sp. Thelephorales, Thelephoraceae +++ +++ +++ – +++ Sirobasidium magnum Tremellales +++ +++ +++ – – Tremella mesenterica Tremellales +++ +++ +++ – – Cuphea miniata stem Eudicots; Myrtales +++ (+) – – – Phacelia viscida stem Eudicots; Solanales +++ (+) – – – Verbena speciosa stem Eudicots; Lamiales +++ MB – – (+) Silene vulgaris stem Eudicots; Caryophyllales +++ (+) – – (+) Dalechampia volubilis stem Eudicots; Malpighiales +++ – – – – Corallorhiza maculata stem Monocots; Orchidaceae +++ ++ + – – Corallorhiza mertensiana stem Monocots; Orchidaceae +++ MB + – – Cypripedium guttatum stem Monocots; Orchidaceae +++ – – – – The intensity of PCR products produced from each taxon with the various primer pairs are indicated from barely visible, (+), to very bright, +++. Unless otherwise indicated, the band is of the expected size for a given primer pair. MB stands for multiple bands of incorrect sizes. Note that the amplicons from Corallorhiza stems when using ITS1-OF and ITS4-OF were found to derive from basidiomycetous yeasts. DNA extraction In general, fungal genomic DNAs for empirical primer tests and sequencing were extracted from either dried fruitbodies or mycelium grown from pure cultures in broth. Because the DNAs were obtained over a 15-yr period, a variety of extraction methods were utilized, including the CTAB method of Gardes & Bruns (1996a), the SDS/Gene Clean method of O'Donnell (see Taylor & Bruns, 1997), the Qiagen Plant DNeasy and Genomic Tip kits (Qiagen, Valencia, CA, USA) and the Omega Fungal EZNA kit (Omega Biotek, Doraville, GA, USA). In selecting strains for DNA sequencing, we acquired representative strains from the landmark studies of Warcup & Talbot (1966, 1967, 1971, 1980) and Currah et al. (1987, 1990) (JHW 062; JHW 0632 – type strain; JHW 0750; UAMH 5404; UAMH 5428; UAMH 5430; UAMH 5443; UAHM 6440). PCR amplification Amplification reactions of 25 µl were carried out with final concentrations of 200 µm of each dNTP, 50 mm KCl, 10 mm Tris-HCl (pH 8.3), 25 mm MgCl, 0.1 mg ml−1 gelatin, and 0.5 units of Sigma RedTaq DNA polymerase (Sigma-Aldrich, Saint Louis, MO, USA). Routine amplifications consisted of 35 cycles in a MJ PTC-200 thermocycler and employed a 2 min initial denaturation at 96˚C before thermocycling, with 30 s denaturation at 94˚C followed by a 40 s annealing at various temperatures (Table 1) and 72˚C elongation for 1 min. The last cycle was followed by extension at 72˚C for 10 min. DNA sequencing and cloning Primer pairs ITS1-OF plus ITS4-OF; ITS1 (White et al., 1990) plus ITS4-Tul; and ITS1-F (Gardes & Bruns, 1993) plus TW13, (GGTCCGTGTTTCAAGACG http://plantbio.berkeley.edu/~bruns/) were used for initial amplification, followed by Qiagen Qiaquick cleanup and cycle sequencing with BigDye Terminator 3.1 (Applied Biosystems, Foster City, CA, USA) using ITS1 and ITS4 (White et al., 1990). Products were cleaned over Sephadex G50 and separated on an ABI 3130XL capillary system. Mixed fragments were obtained from ITS1-OF/ITS4-OF amplifications from stems of two Corallorhiza species. We therefore cloned and sequenced these amplicons. PCR products were purified with Zymo 5 Clean & Concentrator columns (Zymo Research, Orange, CA, USA) then cloned using the TOPO TA for sequencing kit with vector PCR4.0 (Invitrogen, Carlsbad, CA, USA) following manufacturers' instructions. Discrete colonies were directly amplified using M13 primers and sequenced, as described earlier. Sequences have been submitted to GenBank under accessions EU218878-EU218895. Phylogenetic analyses Close relatives of our sequenced specimens were identified through Discontinuous MegaBLAST searches of GenBank and masked, FASTA searches of our website (http://biotech.inbre.alaska.edu/fungal-metagenomics/). Sets of closely related sequences were then aligned using Muscle (Edgar, 2004) followed by manual optimization in Se-Al (Rambaut, 1996). The ITS sequences within the Tulasnellaceae were extremely diverse, and positional homology when we attempted a global alignment of all sequences was highly suspect. We therefore created an alignment including only the 5.8S portion of the ITS region, then a maximum parsimony tree for all sequences was estimated in paup*4.0b10, which was used to identify clades that could be used to create three separate alignments spanning the entire ITS1–5.8S-ITS2 region. Similar approaches were used by Suarez et al. (2006) and Shefferson et al. (2007). We started with 154 taxa in the Tulasnellaceae, but pruned numerous highly similar sequences for ease of visualization of the resulting trees. To further evaluate the effects of uncertain positional homology in the alignments, all alignments were also pruned to leave only conserved positions using the lenient settings in the Gblocks web server (Castresana, 2000). Trees produced from complete alignments versus pruned 'Gblock' alignments were compared. Best-fitting models of molecular evolution were determined for each alignment using ModelTest 2.0 (Posada & Crandall, 1998) and Aikake Information Criteria. Maximum-likelihood trees were inferred using the genetic algorithm-driven program garli (Zwickl, 2006) using default search settings; the same settings were used to carry out 100 bootstrap replicates for each dataset, except that the search termination criterion for consecutive generations without an improvement in likelihood was dropped from 10 000 to 5000. For the three Tulasnellaceae alignments, the GTR + I + G model was used, since it was the closest available model to the ones specified by ModelTest. For the Ceratobasidiaceae, the HKY + I + G model was used. Likelihood trees were compared to parsimony trees estimated in paup*4.0b10 using heuristic searches with 10 random addition replicates, equal weights and maximum trees set to 100 000. The three Tulasnellaceae trees are shown with midpoint rooting (Farris, 1972), because of a lack of an alignable, a priori, outgroup. Botryobasidium plus Hyplotrichum were designated as outgroups in the Ceratobasidiaceae analyses based upon Moncalvo et al. (2006). Alignments and additonal information are available on our website (http://mercury.bio.uaf.edu/~lee_taylor/orchid_primers.html). Results and discussion New basidiomycete ITS primers: ITS1-OF/ITS4-OF A very effective primer for the amplification of the ITS region from essentially all Eumycota, ITS1-F, and which minimizes the amplification of plant sequences, was developed by Gardes & Bruns (1993). However, the nuclear ribosomal operon of the Tulasnellaceae is evolving exceedingly rapidly (Taylor et al., 2002; Binder et al., 2005; Moncalvo et al., 2006), and hence many primer sites which are generally conserved across the Eumycota are not conserved in the Tulasnellaceae (1, 2). The primer ITS-1F does not effectively amplify some core species within the Tulasnellaceae (e.g. Tulasnella irregularis and Epulorhiza anaticula, Table 2; also see Suarez et al., 2006). Hence, we sought to design a pair of ITS primers that would amplify Tulasnella species and as many other Basidiomycota as possible, while selecting against amplification of orchid genomic regions. The forward primer ITS1-OF overlaps with ITS1-F but is positioned two bases 5′ in the small subunit. Note that ITS1-OF is really two primers of nearly identical sequence that must be ordered separately and then combined before use; synthesis of a single degenerate primer is not recommended. The altered placement and two positions that differ among the primer forms provide an improved fit to the few available Tulasnella sequences, and the 10 3′ bases perfectly match all other Basidiomycota inspected (see alignment, Fig. 1). The primer has one fewer mismatch with conserved vascular plant sequences than does ITS1-F, but still has a mismatch at the critical 3′-most base and at three other positions. The reverse primer ITS4-OF is slightly 3′ of ITS4 and binds in a highly conserved region of the large subunit (see alignment, Fig. 2). Again, however, the primer has a mismatch with all inspected orchid sequences at the 3′-most base. The primer is a perfect match to all inspected Basidiomycota with the exception of a few noncritical bases at the 5′ end in various Tulasnellaceae (owing to the rapid evolution in this lineage, no entirely conserved regions were found). The primer has a few mismatches with some inspected members of the Ascomycota, Zygomycota and Chytridiomycota, although it is not safe to assume that amplification of species in these taxa will be prevented. Figure 1Open in figure viewerPowerPoint Alignment of a region of the ribosomal small subunit from diverse fungi used for primer design. The small subunit (SSU) alignment shows locations of previously published and new primers for amplification of the internal transcribed spacer (ITS) region. The alignment is in pretty format with all sequences compared to Thanatephorus cucumeris as the reference sequence, shown at both the top and bottom. Bases in other taxa which are identical to the reference sequence are indicated with a '.' while alternative bases are spelled out. To maximize representation in several clades of orchid fungi, sequences that do not span the entire aligned region were included, with missing bases coded as '?', while gaps resulting from indels are represented by the '–' symbol. Boxes highlight bases within particular taxa that contribute to the specificity of particular primers. Two portions at the 3′ end of the SSU have been concatenated, with the join indicated by '+++'. The portions span positions 1307–1341 and 1713–1821 of the Saccharomyces cerevisiae GenBank V01335 nuclear SSU gene. Figure 2Open in figure viewerPowerPoint Alignment of a region of the ribosomal large subunit from diverse fungi used for primer design. The large subunit (LSU) alignment shows the locations of previously published and new primers for amplification of the internal transcribed spacer (ITS) region. Note that primer sequences shown are reverse complements of the actual oligonucleotides that should be synthesized (Table 1). The alignment format follows Fig. 1. Two concatenated portions are again shown, which span positions 37–138 and 179–209 of the Saccharomyces cerevisiae GenBank J01355 nuclear LSU gene. Broader in silico analyses of primer specificity were performed using the short-exact match option in blastn searches of the complete nr database on GenBank. These analyses were largely congruent with the patterns seen in the alignments of a few selected taxa. blast lineage reports utilize the hierarchical NCBI taxonomy and sort taxa in order of the proportion of best matches to the query within a taxon. The top taxon reported for ITS1-OF was Entoloma (Basidiomycota), but equally high matches were distributed throughout the Basidiomycota and occurred in many other Eumycota. Taxonomy reports show all significant matches to a query, organized according to the NCBI taxonomic hierarchy. For ITS1-OF there were 5007 hits in the following groups: Fungi, 4694; Ascomycota, 2611; Basidiomycota, 1214; Glomeromycota, 615; Zygomycota, 75; Chytridiomycota, 74; Embryophyta and Orchidaceae, both 0. The top-ranked taxon in the ITS4-OF lineage report was Tulasnella. The taxonomy report showed hits to important groups as follows: Fungi, 4661; Basidiomycota, 4253; Glomeromycota, 191; Zygomycota, 53; Chytridiomycota, 3; Embryophyta, 16; Orchidaceae, 0. To some degree, the numbers of hits to particular lineages likely reflect biases in the sequences available on GenBank. For example, the 3′ end of the SSU is sequenced less often than the 5′ end of the LSU in molecular systematic studies of basidiomycetes, which may explain the lower number of basidiomycete hits to ITS1-OF. It should also be noted that many of the blast