COMMD Proteins, a Novel Family of Structural and Functional Homologs of MURR1
2005; Elsevier BV; Volume: 280; Issue: 23 Linguagem: Inglês
10.1074/jbc.m501928200
ISSN1083-351X
AutoresEzra Burstein, Jamie E. Hoberg, Amanda S. Wilkinson, Julie M. Rumble, Rebecca A. Csomos, Christine M. Komarck, Gabriel N. Maine, John Wilkinson, Marty W. Mayo, Colin S. Duckett,
Tópico(s)RNA regulation and disease
ResumoMURR1 is a multifunctional protein that inhibits nuclear factor κB (NF-κB), a transcription factor with pleiotropic functions affecting innate and adaptive immunity, apoptosis, cell cycle regulation, and oncogenesis. Here we report the discovery of a new family of proteins with homology to MURR1. These proteins form multimeric complexes and were identified in a biochemical screen for MURR1-associated factors. The family is defined by the presence of a conserved and unique motif termed the COMM (copper metabolism gene MURR1) domain, which functions as an interface for protein-protein interactions. Like MURR1, several of these factors also associate with and inhibit NF-κB. The proteins designated as COMMD or COMM domain containing 1–10 are extensively conserved in multicellular eukaryotic organisms and define a novel family of structural and functional homologs of MURR1. The prototype of this family, MURR1/COMMD1, suppresses NF-κB not by affecting nuclear translocation or binding of NF-κB to cognate motifs; rather, it functions in the nucleus by affecting the association of NF-κB with chromatin. MURR1 is a multifunctional protein that inhibits nuclear factor κB (NF-κB), a transcription factor with pleiotropic functions affecting innate and adaptive immunity, apoptosis, cell cycle regulation, and oncogenesis. Here we report the discovery of a new family of proteins with homology to MURR1. These proteins form multimeric complexes and were identified in a biochemical screen for MURR1-associated factors. The family is defined by the presence of a conserved and unique motif termed the COMM (copper metabolism gene MURR1) domain, which functions as an interface for protein-protein interactions. Like MURR1, several of these factors also associate with and inhibit NF-κB. The proteins designated as COMMD or COMM domain containing 1–10 are extensively conserved in multicellular eukaryotic organisms and define a novel family of structural and functional homologs of MURR1. The prototype of this family, MURR1/COMMD1, suppresses NF-κB not by affecting nuclear translocation or binding of NF-κB to cognate motifs; rather, it functions in the nucleus by affecting the association of NF-κB with chromatin. NF-κB is a dimeric complex formed by members of a highly conserved family of proteins that share a defining motif designated the Rel homology domain (RHD). 1The abbreviations used are: RHD, Rel homology domain; EGFP, enhanced green fluorescence protein (GFP); TAP, tandem affinity purification; GST, glutathione S-transferase; TNF, tumor necrosis factor; MS, mass spectroscopy; RT, reverse transcription; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; RNAi, RNA interference; siRNA, small interfering RNA; HIV-1, human immunodeficiency virus-1. Through transcriptional regulation of many gene products, NF-κB participates in a number of biological processes including innate and adaptive immune responses, programmed cell death, cell cycle progression, and oncogenesis (1Ghosh S. May M.J. Kopp E.B. Annu. Rev. Immunol. 1998; 16: 225-260Crossref PubMed Scopus (4631) Google Scholar, 2Silverman N. Maniatis T. Genes Dev. 2001; 15: 2321-2342Crossref PubMed Scopus (777) Google Scholar, 3Karin M. Yamamoto Y. Wang Q.M. Nat. Rev. Drug Discov. 2004; 3: 17-26Crossref PubMed Scopus (1249) Google Scholar, 4Joyce D. Albanese C. Steer J. Fu M. Bouzahzah B. Pestell R.G. Cytokine Growth Factor Rev. 2001; 12: 73-90Crossref PubMed Scopus (346) Google Scholar, 5Karin M. Lin A. Nat. Immunol. 2002; 3: 221-227Crossref PubMed Scopus (2470) Google Scholar, 6Baldwin A.S. J. Clin. Investig. 2001; 107: 241-246Crossref PubMed Scopus (1199) Google Scholar). Additionally, by its ability to regulate transcription of various viral genomes including human immunodeficiency virus-1 (HIV-1) (7Perkins N.D. Edwards N.L. Duckett C.S. Agranoff A.B. Schmid R.M. Nabel G.J. EMBO J. 1993; 12: 3551-3558Crossref PubMed Scopus (399) Google Scholar, 8Alcami J. Lain de Lera T. Folgueira L. Pedraza M.A. Jacque J.M. Bachelerie F. Noriega A.R. Hay R.T. Harrich D. Gaynor R.B. EMBO J. 1995; 14: 1552-1560Crossref PubMed Scopus (218) Google Scholar, 9Nabel G.J. Baltimore D. Nature. 1987; 326: 711-713Crossref PubMed Scopus (1456) Google Scholar, 10Bohnlein E. Lowenthal J.W. Siekevitz M. Ballard D.W. Franza B.R. Greene W.C. Cell. 1988; 53: 827-836Abstract Full Text PDF PubMed Scopus (248) Google Scholar), NF-κB also participates in viral cycle progression. Studies into the regulation of NF-κB activation have largely focused on the role of cytoplasmic sequestration of the NF-κB complex as a mainstay level of control. In most cells NF-κB is localized in the cytoplasm through the interaction of the complex with members of the IκB family (11Baldwin A.S. Annu. Rev. Immunol. 1996; 14: 649-681Crossref PubMed Scopus (5592) Google Scholar). These proteins contain ankyrin repeats that allow their interaction with NF-κB and mask the nuclear localization signal present in the RHD. Phosphorylation of IκB by a multimeric kinase known as the IκB kinase complex targets these proteins for ubiquitination and proteasomal degradation (3Karin M. Yamamoto Y. Wang Q.M. Nat. Rev. Drug Discov. 2004; 3: 17-26Crossref PubMed Scopus (1249) Google Scholar, 12Chen Z. Hagler J. Palombella V.J. Melandri F. Scherer D. Ballard D. Maniatis T. Genes Dev. 1995; 9: 1586-1597Crossref PubMed Scopus (1172) Google Scholar). This allows the translocation of NF-κB to the nucleus where it binds to cognate DNA sequences present in an array of gene promoters. MURR1 is a recently identified factor that has been shown to participate in two apparently distinct activities, regulation of the transcription factor NF-κB and control of copper metabolism (13Greene W.C. Nat. Immunol. 2004; 5: 18-19Crossref PubMed Scopus (13) Google Scholar). Mutations in MURR1 are responsible for copper toxicosis in an inbred canine strain (Bedlington terriers) (14van De Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (316) Google Scholar), and an interaction between MURR1 and the copper transporter ATP7B (15Tao T.Y. Liu F. Klomp L. Wijmenga C. Gitlin J.D. J. Biol. Chem. 2003; 278: 41593-41596Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar) has been recently reported. In addition to its role in copper metabolism in mammals, more recent studies implicate MURR1 in the regulation of the transcription factor NF-κB (13Greene W.C. Nat. Immunol. 2004; 5: 18-19Crossref PubMed Scopus (13) Google Scholar, 16Ganesh L. Burstein E. Guha-Niyogi A. Louder M.K. Mascola J.R. Klomp L.W. Wijmenga C. Duckett C.S. Nabel G.J. Nature. 2003; 426: 853-857Crossref PubMed Scopus (194) Google Scholar). MURR1 was found to be a broad inhibitor of NF-κB, affecting κB-responsive transcription from endogenous and viral promoters including the HIV-1 enhancer (16Ganesh L. Burstein E. Guha-Niyogi A. Louder M.K. Mascola J.R. Klomp L.W. Wijmenga C. Duckett C.S. Nabel G.J. Nature. 2003; 426: 853-857Crossref PubMed Scopus (194) Google Scholar). Through this effect, MURR1 can function as a factor that limits HIV-1 replication in resting CD4+ lymphocytes. Here we report the discovery of a family of proteins structurally and functionally related to MURR1. These factors contain a unique and defining domain termed the COMM (copper metabolism gene MURR1) domain, and thus, these proteins have been named COMM domain-containing or COMMD proteins. Similar to MURR1/COMMD1, several of these factors associate with NF-κB and inhibit its transcriptional activity. In addition, we find that COMMD proteins form heteromeric complexes that are mediated by the COMM domain. The prototype of the family, MURR1/COMMD1, exerts its ability to inhibit κB-mediated transcription without affecting nuclear translocation but through nuclear regulation of NF-κB. We show here that MURR1/COMMD1 is recruited to chromatin of a κB-responsive promoter upon NF-κB activation and negatively regulates the association of RelA to chromatin. Therefore, this work identifies a novel family of factors that regulate NF-κB-mediated transcription by controlling the occupancy of NF-κB on chromatin. Plasmids—The plasmids pEBB, pEBG, pEBB-MURR1-Flag and pEBB-MURR1-GST, pEBB-T7-IκB-αS.D., 2κB-luc, and EGFP-p65 (kindly provided by Dr. Rainer de Martin) have been described previously (17Duckett C.S. Li F. Wang Y. Tomaselli K.J. Thompson C.B. Armstrong R.C. Mol. Cell. Biol. 1998; 18: 608-615Crossref PubMed Scopus (193) Google Scholar, 18Richter B.W.M. Mir S.S. Eiben L.J. Lewis J. Reffey S.B. Frattini A. Tian L. Frank S. Youle R.J. Nelson D.L. Notarangelo L.D. Vezzoni P. Fearnhead H.O. Duckett C.S. Mol. Cell. Biol. 2001; 21: 4292-4301Crossref PubMed Scopus (87) Google Scholar, 19Burstein E. Ganesh L. Dick R.D. van De Sluis B. Wilkinson J.C. Lewis J. Klomp L.W.J. Wijmenga C. Brewer G.J. Nabel G.J. Duckett C.S. EMBO J. 2004; 23: 244-254Crossref PubMed Scopus (183) Google Scholar, 20Duckett C.S. Gedrich R.W. Gilfillan M.C. Thompson C.B. Mol. Cell. Biol. 1997; 17: 1535-1542Crossref PubMed Google Scholar, 21Schmid J.A. Birbach A. Hofer-Warbinek R. Pengg M. Burner U. Furtmuller P.G. Binder B.R. de Martin R. J. Biol. Chem. 2000; 275: 17035-17042Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 22Mir S.S. Richter B.W.M. Duckett C.S. Blood. 2000; 15: 4307-4312Crossref Google Scholar). pEBB-COMMD1-GST vectors expressing exon 1, exon 2-3, and exon 1-3 were generated by PCR amplification using pEBB-MURR1-Flag as template with the boundaries outlined in Fig. 3C. pEBB-MURR1-TAP was constructed by subcloning MURR1 into pEBB-TAP, which was generated by PCR amplification of the coding sequence for the tandem affinity purification (TAP) tag using pBS1539 as template (23Puig O. Caspary F. Rigaut G. Rutz B. Bouveret E. Bragado-Nilsson E. Wilm M. Seraphin B. Methods. 2001; 24: 218-229Crossref PubMed Scopus (1428) Google Scholar). Expression vectors for COMMD proteins in fusion with Flag and glutathione S-transferase (GST) (pEBB-COMMD-Flag or pEBB-COMMD-GST) were generated by PCR amplification of the coding sequences for each of these proteins. To that effect the following full-length IMAGE clones were used as templates to amplify COMMD2 through COMMD10, respectively: 4443942, 3531636, 5743903, 6644608, 1692591, 5275167, 4051246, 4333615, and 3683093. pEBG-RelA-(1–305), pEBG-RelA-(306–551), and pEBG-RelA-(1–180), pEBG-c-Rel-(1–180), pEBG-RelB-(97–267), and pEBG-p50-(1–233) and pEBG-p52-(1–212) were generated by PCR using the vectors RSV-RelA, RSV-c-Rel, RSV-RelB, RSV-p50, and RSV-p52 as templates, respectively (kindly provided by Dr. Neil Perkins) (24Duckett C.S. Perkins N.D. Kowalik T.F. Schmid R.M. Huang E.S. Baldwin Jr., A.S. Nabel G.J. Mol. Cell. Biol. 1993; 13: 1315-1322Crossref PubMed Google Scholar). Cell Culture, Transfection, and Luciferase Assays—Human embryonic kidney 293 cells and prostate cancer and DU145 cells were obtained from ATCC. 293 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and l-glutamine, and DU145 cells were cultured in minimum Eagle's medium supplemented with 10% fetal bovine serum, l-glutamine, sodium bicarbonate, and pyruvate. A standard calcium phosphate transfection protocol (20Duckett C.S. Gedrich R.W. Gilfillan M.C. Thompson C.B. Mol. Cell. Biol. 1997; 17: 1535-1542Crossref PubMed Google Scholar) was used to transfect plasmids and siRNA oligonucleotides into 293 cells. Delivery of siRNA oligonucleotides into DU145 cells was performed using Oligofectamine (Invitrogen) as specified by the manufacturer. For luciferase reporter experiments, cells were seeded in 6-well plates and transfected with 4 μg of pEBB plasmid, and 25 ng of the reporter plasmid 2κB-luciferase. Luciferase assays were performed as described previously (25Birkey Reffey S. Wurthner J.U. Parks W.T. Roberts A.B. Duckett C.S. J. Biol. Chem. 2001; 276: 26542-26549Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). TNF (Roche Applied Science) treatments consisted of 1000 units/ml for 12 h. For immunoprecipitation experiments cells were seeded in 10-cm plates and transfected with a total of 12 μg of plasmid. Finally, suppression of endogenous COMMD expression was achieved by transfection of 293 cells seeded in 6-well plates with 2 μg of the corresponding siRNA oligonucleotides (Qiagen). TAP Screening—293 cells seeded in 15-cm plates were transiently transfected with pEBB-MURR1-TAP (15 μg of plasmid/plate) and 2 days later were lysed in Triton lysis buffer (25 mm HEPES, 100 mm NaCl, 1 mm EDTA, 10% glycerol, 1% Triton X-100, protease inhibitors). The lysate was supplemented with NaCl and Nonidet P-40 and applied to a chromatography column containing IgG-Sepharose beads (Amersham Biosciences). After 2 h of incubation at 4 °C the column was drained and washed with IPP150 buffer (10 mm Tris-HCl, pH+ 8.0, 150 mm NaCl, 0.1% Nonidet P-40, protease inhibitors) and TEV cleavage buffer (10 mm Tris-HCl, pH+ 8.0, 150 mm NaCl, 0.1% Nonidet P-40, 0.5 mm EDTA, 1 mm dithiothreitol, protease inhibitors). After incubation for 2 h at 16 °C in TEV cleavage buffer supplemented with TEV enzyme (Invitrogen), the eluate was collected and supplemented with CaCl2 and IPP150 calmodulin binding buffer (10 mm Tris-HCl, pH+ 8.0, 150 mm NaCl, 0.1% Nonidet P-40, 1 mm magnesium acetate, 1 mm imidazole, 2 mm CaCl2, 10 mm β-mercaptoethanol). This was then applied to a chromatography column containing calmodulin 4B beads (Amersham Biosciences) and incubated at 4 °C for 1 h. The column was then drained and washed with IPP150 calmodulin binding buffer. After incubation at 4 °C with IPP150 calmodulin elution buffer (10 mm Tris-HCl, pH+ 8.0, 150 mm NaCl, 0.1% Nonidet P-40, 1 mm magnesium acetate, 1 mm imidazole, 2 mm EGTA, 10 mm β-mercaptoethanol), a final eluate was collected. Proteins were precipitated by adding cold 10% trichloroacetic acid in acetone; after overnight incubation at –20 °C, the precipitate was collected by centrifugation at 4 °C (10,000 × g for 30 min), rinsed in 100% acetone, and allowed to air dry. These samples were then submitted to the Proteomics Centre at the University of Victoria for further processing, including tryptic digestion, high performance liquid chromatography separation, and tandem mass spectrometry (MS/MS) to determine peptide sequences. RT-PCR and Expression Data—Total RNA was extracted from 293 cells using RNeasy (Qiagen) according to the manufacturer's instructions. Yield and purity was determined by measuring A260/280 of RNA diluted in water. Oligonucleotides and internal probes for RT-PCR and quantitative RT-PCR of COMMD transcripts were designed with the use of the automated primer design tool, AutoPrime (www.autoprime.de). Detailed information about sequences and cycling parameters are available upon request. For non-quantitative RT-PCR, Titan One-Tube RT-PCR (Roche Applied Science) was used according to the manufacturer's instructions. For quantitative RT-PCR reactions, an RT reaction with 500 ng of total RNA in 25 μl was performed using random hexamers and Taqman reverse transcription reagents (Applied Biosystems). This was followed by quantitative PCR performed in the 7500 real time PCR system (Applied Biosystems). In all reactions, Taqman PCR Master Mix with the appropriate primers and probes was used. Primers and probe sets for c-IAP2 (BIRC3) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal control were obtained from Applied Biosystems. Expression data in normal tissues were obtained from the Genomics Institute of the Novartis Research Foundation (26Su A.I. Wiltshire T. Batalov S. Lapp H. Ching K.A. Block D. Zhang J. Soden R. Hayakawa M. Kreiman G. Cooke M.P. Walker J.R. Hogenesch J.B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6062-6067Crossref PubMed Scopus (2862) Google Scholar), downloaded, and further analyzed. Immunoblotting and Immunoprecipitation—Cell lysates were prepared by adding Triton lysis buffer; immunoblotting and GSH precipitations were performed as previously described (19Burstein E. Ganesh L. Dick R.D. van De Sluis B. Wilkinson J.C. Lewis J. Klomp L.W.J. Wijmenga C. Brewer G.J. Nabel G.J. Duckett C.S. EMBO J. 2004; 23: 244-254Crossref PubMed Scopus (183) Google Scholar). A polyclonal COMMD1 antiserum was raised by immunizing New Zealand White rabbits. Recombinant protein, which was used as immunogen, was produced in Escherichia coli by expressing GST-COMMD1 using the pGEX-4T1 bacterial expression vector (Amersham Biosciences). GST-COMMD1 was purified over a glutathione-Sepharose chromatography column (Amersham Biosciences), and COMMD1 was generated by thrombin cleavage of the GST affinity tag according to the manufacturer's instructions. Antibodies against Flag (Sigma, A8592), RelA (BD Transduction Laboratories, 610868), c-Rel (Santa Cruz, sc-6955), RelB (Santa Cruz, sc-226), p50 (Upstate Biotechnology, 06–886), p52 (Upstate Biotechnology, 05–361), IκB-α (Upstate Biotechnology, 06–494), GST (Santa Cruz, sc-459), α-tubulin (Molecular Probes, A11126), and GCN5 (Santa Cruz, sc-20698) were used as indicated. Confocal and Fluorescence Microscopy—293 cells were plated in chambered cover glass plates or 6-well plates and transfected with EGFP-p65 (25 or 50 ng/well, respectively). Morphological assays for nuclear translocation of EGFP-p65 were performed by observing cells with a Zeiss Axiovert 100 m confocal microscope before and after treatment with TNF. Representative images were obtained, and 250–400 cells were observed and scored accordingly. Electrophoretic Mobility Shift Assay (EMSA)—293 cells were seeded in 10-cm dishes and transfected as indicated. TNF stimulation, when performed, consisted of treating cells with 1000 units/ml for 30 min before lysis. The preparation of nuclear extracts and EMSA have been described previously (24Duckett C.S. Perkins N.D. Kowalik T.F. Schmid R.M. Huang E.S. Baldwin Jr., A.S. Nabel G.J. Mol. Cell. Biol. 1993; 13: 1315-1322Crossref PubMed Google Scholar). For our studies, a double-stranded oligonucleotide encompassing a canonical κB sequence was used as probe (forward sequence, AGCTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGG). Cellular Fractionation—293 cells were plated in 10-cm plates 48 h before the procedure. Medium was aspirated, and the cells were rinsed in phosphate-buffered saline, scraped, and collected in a microcentrifuge tube. The cells were resuspended in 200 μl of buffer 1 (25 mm HEPES, 5 mm KCl, 0.5 mm MgCl2, 1 mm phenylmethylsulfonyl fluoride, 1 mm dithiothreitol, and protease inhibitors). After that, 200 μl of buffer 2 were added (Buffer 1 with 1% Nonidet P-40), and the cells were incubated with constant rotation at 4 °C for 15 min. The samples were centrifuged for 1 min at 600 × g, and the supernatant, corresponding to the cytoplasmic fraction, was collected. The precipitated material was gently rinsed in 100 μl of buffer 3 (1:1 mixture of buffers 1 and 2). After centrifuging the samples again as before, the supernatant was collected as part of the cytoplasmic fraction. The remaining precipitated material was then treated by the addition of 500 μl of buffer 5 (25 mm HEPES, 10% sucrose, 350 mm NaCl, 1 mm phenylmethylsulfonyl fluoride, 1 mm dithiothreitol, 0.01% Nonidet P-40, protease inhibitors) and incubated with constant rotation at 4 °C for 60 min. After this, the samples were centrifuged for 10 min at 16,100 × g. The supernatant, corresponding to the nuclear fraction, was collected separately. Chromatin Immunoprecipitation—Subconfluent DU145 cells were treated with TNF (1000 units/ml) before cross-linking for chromatin immunoprecipitation (ChIP) analysis. For attachment assays, 293 cells were re-plated in serum-free media on laminin-coated plates (Discovery Labware) as previously described (27Hoberg J.E. Yeung F. Mayo M.W. Mol. Cell. 2004; 16: 245-255Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar). ChIP protocol and primers sequences have been previously described (28Yeung F. Hoberg J.E. Ramsey C.S. Keller M.D. Jones D.R. Frye R.A. Mayo M.W. EMBO J. 2004; 23: 2369-2380Crossref PubMed Scopus (2224) Google Scholar). Antibodies used in the ChIP studies include COMMD1 (described above), M2 Flag (Sigma, F3165), RNA polymerase II (Santa Cruz, SC-9001), and RelA (Upstate, 06-418). Biochemical Screen for MURR1-associated Factors—To further understand the cellular activities of MURR1, a biochemical screen for associated proteins was performed based on the TAP scheme that has been previously described (23Puig O. Caspary F. Rigaut G. Rutz B. Bouveret E. Bragado-Nilsson E. Wilm M. Seraphin B. Methods. 2001; 24: 218-229Crossref PubMed Scopus (1428) Google Scholar). Briefly, MURR1 in fusion with the TAP affinity tag was transiently expressed in 293 cells, and MURR1-TAP was subsequently purified from cells lysates using two sequential chromatography columns containing IgG and calmodulin beads, respectively (Fig. 1A). The material obtained was subjected to tryptic digestion, and the peptides generated were then identified by tandem mass spectrometry (MS/MS) after initial separation using liquid chromatography. A number of associated factors were identified, including three proteins that upon close inspection demonstrated the presence of a region with close homology to MURR1 in their carboxyl termini (Fig. 1, A and B). These factors were later designated as COMMD3, -4, and -6 (see below). Identification of the COMMD Protein Family—After the identification of three MURR1 homologous factors in our biochemical screen, we performed an extensive search of the sequence databases for additional homologs. Through this approach we were able to identify 10 proteins in humans, including MURR1, that contain highly conserved carboxyl-terminal sequences (Fig. 1B). The majority of these genes were only known as open reading frames and had not been previously characterized. Further analysis of orthologs present across multiple species demonstrated that the area of close homology in the carboxyl termini of these proteins represents a previously unrecognized, unique, and highly conserved motif (Fig. 1C). This leucine-rich, 70–85 amino acid long sequence is predicted to form a β-sheet. We have termed this region the copper metabolism gene MURR1 (COMM) domain. The designation of homologs of MURR1 identified here required the generation of a new nomenclature. Murr1 derived its name from its proximity to the U2af1-rs1 locus in mice (mouse U2af1-rs1 region 1); however, this genomic organization is not observed in other organisms including humans. In addition, an unrelated gene that also lies in close proximity to U2af1-rs1 has been designated Murr2, precluding the use of this name for MURR1 homologs (29Nabetani A. Hatada I. Morisaki H. Oshimura M. Mukai T. Mol. Cell. Biol. 1997; 17: 789-798Crossref PubMed Scopus (90) Google Scholar). In consultation with the HUGO gene nomenclature committee, the term COMMD (COMMDomain containing) is proposed to designate these factors based on the shared structural domain that defines this family of proteins and has been adopted in NCBI public databases. The name COMMD1 is suggested for MURR1 as a means to standardize the nomenclature to designate this protein family and will be used hereafter. With the exception of COMMD1, no other COMMDs have been previously described in any detail. COMMD5 was identified as an open reading frame that is overexpressed in naturally hypertensive rats and suppressed in a number of primary tumors and cancer cell lines (30Solban N. Jia H.P. Richard S. Tremblay S. Devlin A.M. Peng J. Gossard F. Guo D.F. Morel G. Hamet P. Lewanczuk R. Tremblay J. J. Biol. Chem. 2000; 275: 32234-32243Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). The expressed protein localizes to the nucleus, although a direct role in transcription had not been previously demonstrated. COMMD6 is orthologous to a mouse gene located in a region that is necessary for normal embryonic development, although it is unclear whether COMMD6 itself is required for normal embryogenesis (31Semenova E. Wang X. Jablonski M.M. Levorse J. Tilghman S.M. Hum. Mol. Genet. 2003; 12: 1301-1312Crossref PubMed Scopus (58) Google Scholar). Similarly, COMMD3 was previously identified as a locus with close proximity to the Polycomb-group gene Bmi-1 (32Haupt Y. Barri G. Adams J.M. Mol. Biol. Rep. 1992; 17: 17-20Crossref PubMed Scopus (5) Google Scholar). Finally, an expressed sequence tag corresponding to COMMD7 was found to be consistently repressed in an experimental system designed to screen for factors involved in leukemogenesis (33Roperch J.P. Lethrone F. Prieur S. Piouffre L. Israeli D. Tuynder M. Nemani M. Pasturaud P. Gendron M.C. Dausset J. Oren M. Amson R.B. Telerman A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8070-8073Crossref PubMed Scopus (106) Google Scholar). COMMD Genes Are Highly Conserved—We found that all 10 genes have been conserved throughout vertebrate evolution, as can be gleaned from orthologs found in Silurana tropicalis, Xenopus laevis, Danio rerio, Oncorhynchus mykiss, and Oryzias latipes (see the supplemental table). In general, mammalian sequences are about 90% conserved when compared with their human orthologs. Furthermore, lower metazoans, including insects, worms, and molds, also possess COMMD genes; however, none of these genes were identified in unicellular eukaryotic organisms or bacteria. Five of these genes were found in Drosophila melanogaster (COMMD2, -3, -4, -5, and -10) and Dictyostelium discoideum (COMMD4, -5, -7, -8, and -10). Overall, eight of the COMMD genes can be found in lower metazoans, with COMMD1 and COMMD9 orthologs being restricted to vertebrate species (see the supplemental figure). Despite the presence of a conserved and defining motif in all these proteins, a significant proportion of the sequence of each COMMD protein is composed of unique regions that are divergent across members of the family. For example, human and zebrafish COMMD1 are 72% conserved, whereas human COMMD1 and COMMD10 are only 34% conserved when regions outside the COMM domain are included in the comparison (data not shown). COMMD Genes Are Widely Expressed—Given that COMMD proteins were initially identified as COMMD1-associated factors in 293 cells, we first investigated the pattern of expression of human COMMD genes in this cell line. To this end, we designed primers for RT-PCR of each one of these genes including in each case one primer that was selected at an exon-exon junction. This strategy minimizes the possibility of spurious amplification from contaminating genomic DNA because such junctions are generated only after splicing. In addition, the potential for mispriming against the intronic boundary was taken into account in the design. With this algorithm we identified primers for all 10 human COMMD genes, with the amplicon size and position of exon-exon primers indicated in Fig. 2A. Using these primers and total RNA extracted from 293 cells we were able to amplify the appropriate size products for each of the COMMD genes (Fig. 2B). Template-lacking negative controls did not amplify these products (data not shown). This indicated that 293 cells express all COMMD genes, a fact that was also confirmed by publicly available expression data (not shown here). Next, the level of COMMD expression in multiple tissues was analyzed using data available from the Genomics Institute of the Novartis Research Foundation. Utilizing oligonucleotide arrays, expression levels for more than 44,000 mRNA transcripts across 79 human tissues were determined (26Su A.I. Wiltshire T. Batalov S. Lapp H. Ching K.A. Block D. Zhang J. Soden R. Hayakawa M. Kreiman G. Cooke M.P. Walker J.R. Hogenesch J.B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6062-6067Crossref PubMed Scopus (2862) Google Scholar). This raw data were downloaded, and the corresponding probes for most COMMD genes (with the exception of COMMD6) were identified. Expression levels in 13 selected tissues were further analyzed and are presented in Fig. 2C. As shown, COMMDs are widely expressed in human tissues, but the relative abundance of any given COMMD mRNA is different across the samples. For example, whereas COMMD1 expression is highest in the testis, COMMD3 is the highest expressed in the thymus, COMMD7 in the lung, and COMMD8 in the thyroid. Conversely, any given tissue has a complement of COMMD genes that demonstrate highest expression, and these subsets are not identical in each case (data not shown). COMMD1 Can Associate with Other COMMD Proteins— COMMD3, -4, and -6 were initially identified biochemically by their ability to interact with COMMD1. Therefore, the ability of all the members of the family to interact with COMMD1 was evaluated. Each of the 10 COMMD proteins was fused to GST and expressed in 293 cells. COMMD-GST fusion proteins were then precipitated from cell lysates with glutathione-Sepharose beads, and the recovered material was immunoblotted for endogenous COMMD1 (Fig. 3A). COMMD1–8 and COMMD10 could readily precipitate endogenous COMMD1; COMMD9 also co-associates with COMMD1 but to a lesser extent (not shown here). These experiments demonstrated that COMMD1 can interact with itself and with all other COMMD proteins, consistent with the interactions detected in the initial TAP screen. COMMD-COMMD Protein Interactions Are Mediated by the COMM Domain—To define the domain(s) required for COMMD multimer formation, a variety of deletion constructs of COMMD1 were tested for their ability to bind COMMD1 and COMMD3. The coding regions corresponding to each exon of COMMD1 were used as boundaries in constructs expressing fusion proteins with GST (Fig. 3B). The hereditary canine copper toxicosis mutation described previously consists of a genomic deletion encompassing exon 2 of COMMD1 such that the expressed open reading fram
Referência(s)