Prevalence of the Activating JAK2 Tyrosine Kinase Mutation V617F in the Budd–Chiari Syndrome
2006; Elsevier BV; Volume: 130; Issue: 7 Linguagem: Inglês
10.1053/j.gastro.2006.04.008
ISSN1528-0012
AutoresRaj Patel, Nicholas Lea, Michael A. Heneghan, Nigel Westwood, Dragana Milojković, Murugaiyan Thanigaikumar, Deborah Yallop, Roopen Arya, Antonio Pagliuca, Joop Gäken, Julia Wendon, Nigel Heaton, Ghulam J. Mufti,
Tópico(s)Chronic Myeloid Leukemia Treatments
ResumoBackground & Aims: Budd–Chiari Syndrome (BCS) results from obstruction to hepatic venous outflow, with myeloproliferative disorder (MPD) accounting for up to 40% of cases. A number of BCS cases labelled as “idiopathic” do not fulfill the diagnostic criteria for MPD but have features suggestive of a latent form based on hyperplastic bone marrow and erythroid progenitor cell culture; these cases may subsequently develop overt MPD. A clonal mutation in JAK2 tyrosine kinase (JAK2V617F) occurs in a high proportion of patients with MPD and is of use in the characterization of latent MPD in BCS. Methods: We performed allele-specific polymerase chain reaction to screen for JAK2V617F in subjects with BCS (n = 41) and polycythemia vera (PV) (n = 20) and in hematologically normal controls (n = 27). Results: AK2V617F was detected in 24 of 41 (58.5%) subjects with BCS, 19 of 20 PV controls, and 0 of 27 hematologically normal controls. Mean hemoglobin concentration and hematocrit were significantly higher in patients with JAK2V617F. Bone marrow was hyperplastic in 16 of 41 subjects (12/16 JAK2V617F positive). Nine of 33 (27.3%) showed endogenous erythroid colony formation (7/9 JAK2V617F positive). Eleven of 41 subjects developed overt MPD (8/11 essential thrombocythemia, 3/11 PV) after the diagnosis of BCS (median, 49 months; range, 8–87 months), and in 90.9% of these JAK2V617F was detected. Conclusions: JAK2V617F occurs in a high proportion of patients with BCS. Latent MPD was missed in a substantial number of our subjects by using standard techniques. Such cases should be screened for JAK2V617F and carefully observed for the subsequent development of overt MPD. Background & Aims: Budd–Chiari Syndrome (BCS) results from obstruction to hepatic venous outflow, with myeloproliferative disorder (MPD) accounting for up to 40% of cases. A number of BCS cases labelled as “idiopathic” do not fulfill the diagnostic criteria for MPD but have features suggestive of a latent form based on hyperplastic bone marrow and erythroid progenitor cell culture; these cases may subsequently develop overt MPD. A clonal mutation in JAK2 tyrosine kinase (JAK2V617F) occurs in a high proportion of patients with MPD and is of use in the characterization of latent MPD in BCS. Methods: We performed allele-specific polymerase chain reaction to screen for JAK2V617F in subjects with BCS (n = 41) and polycythemia vera (PV) (n = 20) and in hematologically normal controls (n = 27). Results: AK2V617F was detected in 24 of 41 (58.5%) subjects with BCS, 19 of 20 PV controls, and 0 of 27 hematologically normal controls. Mean hemoglobin concentration and hematocrit were significantly higher in patients with JAK2V617F. Bone marrow was hyperplastic in 16 of 41 subjects (12/16 JAK2V617F positive). Nine of 33 (27.3%) showed endogenous erythroid colony formation (7/9 JAK2V617F positive). Eleven of 41 subjects developed overt MPD (8/11 essential thrombocythemia, 3/11 PV) after the diagnosis of BCS (median, 49 months; range, 8–87 months), and in 90.9% of these JAK2V617F was detected. Conclusions: JAK2V617F occurs in a high proportion of patients with BCS. Latent MPD was missed in a substantial number of our subjects by using standard techniques. Such cases should be screened for JAK2V617F and carefully observed for the subsequent development of overt MPD. Budd–Chiari syndrome (BCS) describes a heterogeneous group of disorders resulting from obstruction to hepatic venous outflow, usually because of venous thrombosis.1Ludwig J. Hashimoto E. McGill D.B. et al.Classification of hepatic venous outflow obstruction ambiguous terminology of the Budd–Chiari syndrome.Mayo Clin Proc. 1990; 65: 51-55Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar The clinical presentation is highly variable; although some patients are asymptomatic,2Hadengue A. Poliquin M. Vilgrain V. et al.The changing scene of hepatic vein thrombosis recognition of asymptomatic cases.Gastroenterology. 1994; 106: 1042-1047PubMed Google Scholar others present as fulminant, acute, subacute, and chronic subtypes depending on duration of disease, biochemical disturbance, and liver histology.3Bismuth H. Sherlock D.J. Portosystemic shunting versus liver transplantation for the Budd–Chiari syndrome.Ann Surg. 1991; 214: 581-589Crossref PubMed Scopus (104) Google Scholar An identifiable cause can be found in 75% of patients with BCS,4Narayanan Menen K.V. Shah V. Kamath P. The Budd–Chiari Syndrome.N Engl J Med. 2004; 350: 578-585Crossref PubMed Scopus (417) Google Scholar including hereditary and acquired prothrombotic states, trauma, and infection; the role of multiple concurrent factors is now well recognized.5Denninger M.H. Chait Y. Casadevall N. et al.Cause of portal or hepatic vein thrombosis in adults the role of multiple concurrent factors.Hepatology. 2000; 31: 587-591Crossref PubMed Scopus (575) Google Scholar Myeloproliferative disorders (MPDs) are the commonest cause of BCS in the developed world with polycythemia vera (PV) accounting for 10–40% of cases.5Denninger M.H. Chait Y. Casadevall N. et al.Cause of portal or hepatic vein thrombosis in adults the role of multiple concurrent factors.Hepatology. 2000; 31: 587-591Crossref PubMed Scopus (575) Google Scholar, 6Valla D. Casadevall N. Lacombe C. et al.Primary myeloproliferative disorder and hepatic vein thrombosis a prospective study of erythroid colony formation in vitro in 20 patients with Budd–Chiari Syndrome.Ann Intern Med. 1985; 103: 329-334Crossref PubMed Scopus (275) Google Scholar, 7Primignani M. Martinelli I. Bucciarelli P. Risk factors for thrombophilia in extrahepatic portal vein obstruction.Hepatology. 2005; 41: 603-608Crossref PubMed Scopus (165) Google Scholar In 25% of cases, the cause for BCS is not apparent (“idiopathic BCS”). Although these cases fail to fulfill recognized diagnostic criteria for MPD8Wasserman L. The management of Polycythemia Vera.Br J Haematol. 1971; 21: 371-376Crossref PubMed Scopus (81) Google Scholar, 9Pearson T.C. Evaluation of diagnostic criteria in polycythemia vera.Semin Hematol. 2001; 38: 21-24Abstract Full Text PDF PubMed Google Scholar, 10Vardiman J.W. Harris N.L. Brunnung R.D. The World Health Organization (WHO) classification of the myeloid neoplasms.Blood. 2002; 100: 2292-2302Crossref PubMed Scopus (1795) Google Scholar, 11Murphy S. Therapeutic dilemmas balancing the risks of bleeding, thrombosis and leukemic transformation in myeloproliferative disorders (MPD).Thromb Haemost. 1997; 78: 622-626PubMed Google Scholar and have a normal peripheral blood picture, the presence of an underlying latent form of MPD is suspected on bone marrow (BM) morphology and erythroid progenitor cell culture studies.12Pagliuca A. Mufti G.J. Janossa-Tahernia M. et al.In vitro colony culture and chromosomal studies in hepatic and portal vein thrombosis—possible evidence of an occult myeloproliferative state.Q J Med. 1990; 76: 981-989PubMed Google Scholar, 13Valla D. Casadevall N. Lacombe C. et al.Primary myeloproliferative disorder and hepatic vein thrombosis. A prospective study of erythroid colony formation in vitro in 20 patients with Budd–Chiari syndrome.Ann Intern Med. 1985; 103: 329-334Crossref PubMed Google Scholar, 14Valla D. Casadevall N. Huisse M.G. et al.Aetiology of portal vein thrombosis in adults. A prospective evaluation of primary myeloproliferative disorders.Gastroenterology. 1988; 94: 1063-1069Abstract PubMed Google Scholar, 15Muller E.W. De Wolf J.T. Haagsma E.B. Portal hypertension as a presenting feature of a myeloproliferative disorder. Diagnosis and therapeutic dilemmas.Scand J Gastroenterol Suppl. 1993; 200: 74-79Crossref PubMed Scopus (14) Google Scholar, 16De Stefano V. Teofili L. Leone G. et al.Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd–Chiari syndrome or portal vein thrombosis.Semin Thromb Haemost. 1997; 23: 411-418Crossref PubMed Scopus (144) Google Scholar Several of these cases prospectively develop overt MPD even years later.12Pagliuca A. Mufti G.J. Janossa-Tahernia M. et al.In vitro colony culture and chromosomal studies in hepatic and portal vein thrombosis—possible evidence of an occult myeloproliferative state.Q J Med. 1990; 76: 981-989PubMed Google Scholar, 17McNamara C. Juneja S. Wolf M. et al.Portal or hepatic vein thrombosis as the first presentation of a myeloproliferative disorder in patients with normal peripheral blood counts.Clin Lab Hematol. 2002; 24: 239-242Crossref PubMed Scopus (21) Google Scholar Why these latent forms of MPD lack the characteristic blood picture (including neutrophilia, thrombocytosis, and elevated hematocrit) is unclear and cannot be fully explained by factors such as concomitant iron deficiency, hypersplenism, and hemodilution effects,18Dudley J.M. Westwood N. Leonard S. et al.Primary polycythemia positive diagnosis using the differential response of primitive and mature erythroid progenitors to erythropoietin, interleukin 3 and alpha-interferon.Br J Haematol. 1990; 75: 188-194Crossref PubMed Scopus (37) Google Scholar all of which occur frequently in liver disease. On the basis of endogenous erythroid colony (EEC) and endogenous megakaryocytic colony formation in cultures of bone marrow progenitor cells, it has been suggested that up to 87% of “idiopathic BCS” is caused by occult MPD.4Narayanan Menen K.V. Shah V. Kamath P. The Budd–Chiari Syndrome.N Engl J Med. 2004; 350: 578-585Crossref PubMed Scopus (417) Google Scholar, 12Pagliuca A. Mufti G.J. Janossa-Tahernia M. et al.In vitro colony culture and chromosomal studies in hepatic and portal vein thrombosis—possible evidence of an occult myeloproliferative state.Q J Med. 1990; 76: 981-989PubMed Google Scholar, 13Valla D. Casadevall N. Lacombe C. et al.Primary myeloproliferative disorder and hepatic vein thrombosis. A prospective study of erythroid colony formation in vitro in 20 patients with Budd–Chiari syndrome.Ann Intern Med. 1985; 103: 329-334Crossref PubMed Google Scholar, 14Valla D. Casadevall N. Huisse M.G. et al.Aetiology of portal vein thrombosis in adults. A prospective evaluation of primary myeloproliferative disorders.Gastroenterology. 1988; 94: 1063-1069Abstract PubMed Google Scholar, 15Muller E.W. De Wolf J.T. Haagsma E.B. Portal hypertension as a presenting feature of a myeloproliferative disorder. Diagnosis and therapeutic dilemmas.Scand J Gastroenterol Suppl. 1993; 200: 74-79Crossref PubMed Scopus (14) Google Scholar, 16De Stefano V. Teofili L. Leone G. et al.Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd–Chiari syndrome or portal vein thrombosis.Semin Thromb Haemost. 1997; 23: 411-418Crossref PubMed Scopus (144) Google Scholar, 17McNamara C. Juneja S. Wolf M. et al.Portal or hepatic vein thrombosis as the first presentation of a myeloproliferative disorder in patients with normal peripheral blood counts.Clin Lab Hematol. 2002; 24: 239-242Crossref PubMed Scopus (21) Google Scholar Whereas EEC and endogenous megakaryocytic colony were previously assumed to have 100% sensitivity and specificity for PV and essential thrombocythemia (ET), positive results in nonclonal polycythemia and in normal individuals have severely limited the diagnostic value of these tests.18Dudley J.M. Westwood N. Leonard S. et al.Primary polycythemia positive diagnosis using the differential response of primitive and mature erythroid progenitors to erythropoietin, interleukin 3 and alpha-interferon.Br J Haematol. 1990; 75: 188-194Crossref PubMed Scopus (37) Google Scholar, 19Dainiak N. Hoffman R. Lebowitz A.I. et al.Erythropoietin-dependent primary pure erythrocytosis.Blood. 1979; 53: 1076-1084PubMed Google Scholar, 20Eridani S. Dudley J.M. Sawyer B.M. et al.Erythropoietic colonies in a serum-free system results in primary proliferative polycythemia and thrombocythemias.Br J Haematol. 1987; 67: 387-391Crossref PubMed Scopus (38) Google Scholar In addition, EEC formation is absent in some cases that fulfill the Polycythemia Vera Study Group (PVSG) diagnostic criteria for PV.21Lemoine F. Najman A. Baillou C. et al.A prospective study of the value of bone marrow erythroid progenitor cultures in polycythemia.Blood. 1986; 68: 996-1002PubMed Google Scholar Because detection of EEC is technically challenging, nonstandardized, and only informative in 30%–80% of patients with MPD,22Kaushansky K. On the molecular origins of the chronic myeloproliferative disorders it all makes sense.Blood. 2005; 105: 4258-4263Crossref PubMed Scopus (121) Google Scholar it is not used as a routine diagnostic tool for the detection of MPD. Although bone marrow biopsy is frequently performed in the diagnosis of MPD, this investigation is not part of the PVSG criteria for PV8Wasserman L. The management of Polycythemia Vera.Br J Haematol. 1971; 21: 371-376Crossref PubMed Scopus (81) Google Scholar or ET.11Murphy S. Therapeutic dilemmas balancing the risks of bleeding, thrombosis and leukemic transformation in myeloproliferative disorders (MPD).Thromb Haemost. 1997; 78: 622-626PubMed Google Scholar Bone marrow morphology is included in the more recent World Health Organization (WHO) diagnostic criteria for MPD10Vardiman J.W. Harris N.L. Brunnung R.D. The World Health Organization (WHO) classification of the myeloid neoplasms.Blood. 2002; 100: 2292-2302Crossref PubMed Scopus (1795) Google Scholar but alone is not diagnostic for MPD and does not establish clonality. Furthermore, the robustness of the WHO diagnostic criteria for MPD remains to be established. A single somatic mutation in the tyrosine kinase JAK2 has been recently reported by several independent groups23Baxter E.J. Scott L.M. Campbell P.J. et al.Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative diseases.Lancet. 2005; 365: 1054-1061Abstract Full Text Full Text PDF PubMed Scopus (2296) Google Scholar, 24Levine R.L. Wadleigh M. Cools J. et al.Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis.Cancer Cell. 2005; 7: 387-397Abstract Full Text Full Text PDF PubMed Scopus (2438) Google Scholar, 25James C. Ugo V. Le Couedic J.P. et al.A unique clonal JAK2 mutation leading to constitutive signaling causes polycythemia vera.Nature. 2005; 434: 1144-1148Crossref PubMed Scopus (2883) Google Scholar, 26Kralovics R. Passamonti F. Buser A.S. et al.A gain-of-function mutation of JAK2 in myeloproliferative disorders.N Engl J Med. 2005; 352: 1779-1790Crossref PubMed Scopus (2935) Google Scholar to occur in a high proportion of patients with MPD. JAK2 is a cytoplasmic tyrosine kinase that intermediates between growth factor receptors on the hemopoetic progenitor cell surface (eg, erythropoietin and interleukin-3) and cytoplasmic signalling molecules (eg, STAT5 and PI3 kinase). JAK2 possesses an active kinase domain (JH1), which is negatively regulated by an inactive pseudokinase domain (JH2). A guanine-to-thymine mutation encoding a valine-to-phenylalanine substitution at position 617 (V617F) in the JH2 domain of JAK2 disrupts the autoinhibitory function of JH2 and leads to constitutive JH1 tyrosine kinase activity and a growth factor–independent phenotype. This mutation was found only in hemopoetic progenitor cells and is therefore strongly implicated in the pathogenesis of MPD. Preliminary reports suggest that patients with this mutation have increased rates of thrombosis, hemorrhage, fibrosis, and cytoreductive requirement than wild-type subjects,26Kralovics R. Passamonti F. Buser A.S. et al.A gain-of-function mutation of JAK2 in myeloproliferative disorders.N Engl J Med. 2005; 352: 1779-1790Crossref PubMed Scopus (2935) Google Scholar but data on the functional consequences of the mutation are scarce. Here, we study the clinical and laboratory features of subjects with JAK2V617F and BCS. Sixty patients presenting to King’s College Hospital, London, between 1985 and 2005 were identified from comprehensive databases held within our institution. All patients had objectively confirmed hepatic vein thrombosis. Only patients with “idiopathic BCS” (n = 41) were evaluated; patients with secondary BCS (n = 19) were excluded from the study (Table 1). Fulminant hepatic failure was the presenting feature in 80.5%; the remainder had established chronic liver disease. Racial origin was as follows: 75.6% white, 4.9% black, 17.1% Asian, and 2.4% “mixed.” To confirm the sensitivity and specificity of our JAK2V617F assay, we analyzed DNA from patients with nonthrombotic liver disease (n = 27) as negative controls; these included patients with autoimmune liver disease (n = 10), acetaminophen overdose (n = 12), Gilbert’s syndrome (n = 3), and Wilson’s disease (n = 2). In addition, we analyzed DNA from a well-defined group of patients (n = 20) with PV.27Westwood N.B. Gruszka-Westwood A.M. Atkinson S. et al.Polycythemia vera analysis of DNA from blood granulocytes using comparative genomic hybridisation.Haematologica. 2001; 86: 464-469PubMed Google Scholar Clinical and laboratory data were recorded on all subjects. Thrombophilia screening included genotyping for factor V Leiden and PT20210A and phenotypic studies for activated protein C resistance, antithrombin, protein C, free protein S, and anticardiolipin antibodies. Screening for paroxysmal nocturnal hemoglobinuria was performed by an acidified serum test before 1996 and thereafter by standard flow cytometry techniques by using fluorescent-labeled antibodies against erythrocyte CD59 and neutrophil CD66b. All subjects had bone marrow aspirate and trephine biopsy at diagnosis of BCS. Erythroid progenitors were studied by using a conventional serum-containing clonogenic culture bioassay with and without exogenous erythropoietin for the detection of endogenous erythroid colonies.28Westwood N.B. Pearson T.C. Diagnostic applications of haemopoietic progenitor culture techniques in polycythemias and thrombocythemias.Leukemia Lymphoma. 1996; 22: 95-103Crossref PubMed Scopus (78) Google Scholar G-banded metaphase cytogenetic analysis of bone marrow was performed in all cases. The study received local ethics committee approval (Research Ethics Committee number 05/Q0703/97). All testing was confidential and was linked to patient information with the use of a system of unique identifiers.Table 1Etiology of Secondary BCS in Patients Excluded From the Study (n = 19)Etiology of secondary BCSNumber of cases (n = 19)Adult polycystic liver and renal disease4Hepatic vein stenosis1Inferior vena cava stenosis1Bechet’s disease1Carcinoid tumor1Malignant infiltration (metastases)1Hepatocellular carcinoma3Pregnancy1Sickle cell disease1Ulcerative colitis1Polycythemia vera3Hydatid liver disease1 Open table in a new tab In 35 of 41 subjects with BCS, DNA was extracted from archival bone marrow films. The DNA was extracted from either slides stained with May-Grünwald-Giemsa stain or from unstained slides by using standard methods. Cover slips were removed after soaking slides in xylene overnight, and cells were scraped from the slide into high salt buffer. Samples were made up to 200 μL, and proteinase K, RNase A, and sodium dodecyl sulfate were added. Cells were incubated at 37°C overnight before phenol extraction and ethanol precipitation. In the remaining 6 of 41 subjects with BCS, DNA was obtained from a recent fresh blood sample. In subjects with PV,27Westwood N.B. Gruszka-Westwood A.M. Atkinson S. et al.Polycythemia vera analysis of DNA from blood granulocytes using comparative genomic hybridisation.Haematologica. 2001; 86: 464-469PubMed Google Scholar DNA was prepared from high density blood cells (>1.077 g/mL) by using standard phenol/chloroform extraction. In subjects with nonthrombotic liver disease, fresh whole blood DNA was prepared by using standard phenol/chloroform extraction. An allele-specific polymerase chain reaction (PCR) was used to detect the G to T mutation in exon 12 of JAK2.23Baxter E.J. Scott L.M. Campbell P.J. et al.Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative diseases.Lancet. 2005; 365: 1054-1061Abstract Full Text Full Text PDF PubMed Scopus (2296) Google Scholar Twenty to 80 ng of patient DNA was amplified in a 28-cycle PCR reaction at an annealing temperature of 58°C in a reaction mixture containing 1.5 μmol/L MgCl2 and 1 μmol/L of the common reverse primer 5′CTGAATAGTCCTACAGTGTTTTCAGTTTCA3′ and 0.5 μmol/L of the 2 forward primers were used (specific): 5′AGCATTTGGTTTTAAATTATGGAGTATATT3′ and (internal control): 5′ATCTATAGTCATGCTGAAAGTAGGAGAAAG3′. The first forward primer is specific for the mutant allele, giving a 203-bp product. The second amplifies a 364-bp product from both mutant and wild-type alleles and serves as an internal PCR control. PCR products were resolved on 2% agarose/TBE gels. All BCS patient samples with JAK2V617F were sequenced to verify the specificity of the allele specific PCR. PCR primers23Baxter E.J. Scott L.M. Campbell P.J. et al.Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative diseases.Lancet. 2005; 365: 1054-1061Abstract Full Text Full Text PDF PubMed Scopus (2296) Google Scholar were used which flank the point mutation forward 5′GGGTTTCCTCAGAACGTTGA3′ and reverse 5′TCATTGCTTTCCTTTTTCACAA3′. Twenty–80 ng of patient DNA was amplified in a 45-cycle PCR reaction at an annealing temperature of 59°C. These resulting 460-bp PCR products were sequenced by using the same primers (Geneservice, Cambridge, MA). Data on quantitative characteristics were expressed as median and range or mean and standard deviation. Statistical significance was assessed by a Mann–Whitney U test or Fisher exact test where appropriate. Statistical significance is assigned at P values <.05. All numerical calculations are made with SPSS for Windows 13.0 statistical package (SPSS Inc, Chicago, IL). Clinical and laboratory data were retrospectively studied from 41 patients with BCS (female, n = 26; mean age at diagnosis, 35.5 years [standard deviation, 13.3]) presenting to our hospital between 1985 and 2005 (Table 2, Table 3).Table 2Clinical Data for Subjects With Idiopathic Budd–Chiari Syndrome (n = 41)Liver function tests at presentationSubject no.JAK2 Wild-type (W) Mutated (M)SexAge at diagnosis (years)Splenomegaly at presentationPrevious thrombotic eventSurvival Alive (A) Died (D)Survival since diagnosis of BCS (months)Time to development of overt MPD following BCS (months)Bilirubin (μmol/L)ASTaDenotes aspartate aminotransferase. (IU/L)APbDenotes alkaline phosphatase. (IU/L)Albumin (g/L)OLTcDenotes orthotopic liver transplantation.Survival post OLT (months)1WF47YesNoD0No6735624525No–2WM43YesNoA101No6195643No–3MF34NoNoA54No156526332Yes544WF26NoNoA36No4110184213Yes365MF49YesNoA15ET (7)554629028No–6MM15NoNoA164No324419036No–7WM23YesNoA91No3934027631No–8MF31YesNoA25PV (16)262513344No–9MF29NoNoA126ET (86)5611839426Yes12610MF44YesNoA53PV (39)19015228731No–11MF51NoNoD1No3813615117Yes112WM28NoNoA26No12035625823No–13WF39NoNoA25No373986313No–14MM39NoNoA26No34194612713Yes2615MF21YesNoA38ET (22)944318722Yes3816WF36NoNoA29ET (20)283417819No–17MM30NoNoA81ET (67)1522020228No–18WM37NoNoA38No885617933Yes3819MM42NoNoD4No16112310825No–20WF41NoNoA20No12912026729No–21MF19YesNoD0No272427414No–22WF29NoNoD15No2722112733No–23MF37YesNoA40No13257215124Yes4024MF22NoNoA145No9026836229No–25MF48NoNoA38No6917934620No–26WM61NoNoD0No353194534029No–27WF36NoNoA89No4519329030No–28WM4YesNoA15No2444816736Yes1529WM14NoNoA38No82615532No–30MF55YesNoD3No9038724319No–31WF50YesNoD1No11656937818No–32MF40YesNoA180ET (49)19020115132Yes18033MM45YesNoA156PV (55)52177814926Yes15634MF22YesNoA86No431514428No–35MM32NoNoA240ET (87)212519029Yes24036MM52YesNoA84ET (63)15269436No–37MM36YesNoA26No238926731Yes2638WF39YesNoA156No2111317441Yes2539WF27NoNoA2No253110235No–40MF65YesNoA24No343514028Yes3741MF17YesNoA84No292013438No–NOTE. All patients were anticoagulated with warfarin. –, Data unavailable.a Denotes aspartate aminotransferase.b Denotes alkaline phosphatase.c Denotes orthotopic liver transplantation. Open table in a new tab Table 3Laboratory Data for Subjects With Idiopathic Budd–Chiari Syndrome (n= 41)Complete blood count at first presentation with BCSComplete blood count at most recent follow upSubject no.JAK2 Wild-type (W) Mutated (M)Marrow Pan-myelosisCytogenetic abnormalityEndogenous erythroid colony growthHereditary thrombophiliaACLaDenotes Anticardiolipin antibodies.LACbDenotes Lupus anticoagulant.PNH cloneHb (g/L)HctNeutrophils (×109/L)Platelets (×109/L)Hb (g/L)HctNeutrophils (×109/L)Platelets (×109/L)1WNoNo–PC deficiencyNegNegNo770.21749––––2WNoNoNoNoNegNegNo1010.32383870.281.5733MYesNoNoNoNegNeg–850.27213301260.386.93014WNoNoNoNoNegNegNo920.298101––––5MYesNoNoNoNegNegNo1200.4264321380.393.82436MYesNoNo–––No1270.464.32451220.374.83607WNoNoNoNoNegNegNo1170.364.72391050.331.91778MYesNoNoNoNegNegNo1390.463.43311600.485.33679MYesNoYesNoNegNegNo1310.415475910.3335710MNodel (1) (p31)YesFV LeidenNegNeg–1200.4741901380.426.131111MYesNoNoNo––No1800.526394––––12WNoNoNoNoNegNegNo1000.3741281520.46213013WNoNoNoNoNegNegNo930.2171691080.323.427114MNoNoNoNoNegNegNo1500.49112101130.345.340515MYesNo–NoNegNegNo990.3171741130.341.612116WYesNoNoNoNegNegNo1090.212.12351120.353.323117MYesNoYesNoNegNegNo1580.4634821520.43533518WYesNoNoFV LeidenNegNegNo1320.383.3741230.378.342019MNoNoNoNoNegNegNo800.21130––––20WNoNoNo––––800.25478––––21MNoNoNoNoNegNegNo1440.4111593––––22WNoNoYesNoNegNeg–1380.499226––––23MNoNo–NoNegNegNo850.246711100.364.621824MNoNo–––––930.28890––––25MNoNoYesNoNegNegNo1100.415159––––26WNoNoNo––––700.212168––––27WNoNo–NoNegNegNo1260.392.61581250.392.716928WNoNoYesNoNegNegNo1190.398242790.280.543729WNoNoNoNoNegNegNo1030.337322840.285.942730MYesNoYesNoNegNegNo830.25445––––31WYesNo–––––740.22778––––32MYesdel (20) (q11q13.3)No––––940.3281101160.365.530133MNodel (13) (q12q22)No––––1590.48127151500.456.831834MNoNoNo––––1120.3862181190.372.824035MYesNoYes––––1210.5125230990.291.7511236MYesNoNoNoNegNegNo1120.3443361330.416.926137MNoNoNoNoNegNegNo1400.431.42531540.464.4147238WYesNo–––––1210.421.394910.271.897039WNoNoNoNoNegNegNo820.24.5709740.2116.828940MNoNo–NoNegNegNo1030.3751091200.364.833541MNoNoNoNoNegNegNo1370.484.21681270.382.3120–Denotes missing data.a Denotes Anticardiolipin antibodies.b Denotes Lupus anticoagulant. Open table in a new tab NOTE. All patients were anticoagulated with warfarin. –, Data unavailable. –Denotes missing data. We obtained genomic DNA from archived bone marrow films or from fresh whole blood from patients with BCS (n = 41), hematologically normal nonthrombotic liver disease controls (n = 27), and PV patients (n = 20). Genomic DNA was screened by an allele-specific PCR for the JAK2V617F (G to T) tyrosine kinase mutation (Figure 1). JAK2V617F was detected in 24 of 41 (58.5%) of subjects with BCS. All control subjects (n = 27) with nonthrombotic liver disease were negative for JAK2V617F. Nineteen of 20 (95%) patients with previously diagnosed PV were positive for JAK2V617F. A 460-bp portion of the JAK2 allele containing the G to T mutation site was amplified by PCR and sequenced to verify the specificity of the AS-PCR (Figure 2). Samples from all subjects with BCS with JAK2V617F were sequenced. The sequencing results showed 100% concordance with the allele-specific PCR. In many cases, the sequence traces show the presence of both wild-type and mutant alleles with a predominant wild-type peak. This reflects the fact that these samples may be heterozygous for the JAK2V617F allele and that DNA for this analysis comes from a mixed population of cells a portion of which are lymphocytes, which are likely to be wild-type in sequence at this position. Pyrosequencing was used to confirm these sequence data and also shows complete concordance with the allele-specific PCR (data not shown). Fulminant hepatic failure was the presenting feature in 80.1%. No subject had a prior history of arterial or venous thromboembolism. One subject had been taking the combined oral contraceptive pill at diagnosis of BCS and was positive for JAK2V617F. Mean hemoglobin concentration and mean hematocrit at presentation with BCS (Table 4) were significantly higher in patients with JAK2V617F. There was no difference between the mean neutrophil count and mean platelet count at presentation in both groups. Twenty of 41 cases had splenomegaly, of which 70% had JAK2V617F detected (P = .21).Table 4Laboratory Characteristics at Presentation in Patients With Budd–Chiari SyndromeJAK2V617F (24/41)Wild-type (17/41)P valueFemale (26/41)16/26 (61.5%)10/26 (38.5%)0.75aSignificance calculated by Fisher exact test.Male (15/41)8/15 (53.3%)7/15 (46.7%)Mean hemoglobin at presentation (g/L)1201020.03bSignificance calculated by Mann–Whitney U test. SD (range)27 (80–180)21 (70–138)Mean hematocrit at presentation0.390.310.01bSignificance calculated by Mann–Whitney U test. SD (range)0.09 (0.2–0.52)0.09 (0.2–0.49)Mean neutrophil count at presentation (×109/L)7.66.10.33bSignificance calculated by Mann–Whitney U test. SD (range)5.5 (1.4–25)4.5 (1.3–21)Mean platelet count at presentation (×109/L)2661800.06bSignificance calculated by Mann–Whitney U test. SD (range)192 (30–715)158 (49–709)Clonal cytogenetic abnormality3/24 (12.5%)0/17 (0%)0.13aSignificance calculated by Fisher exact test.Endogenous erythroid colonies7/20 (35%)2/13 (15%)0.62aSignificance calculated by Fisher exact test.Bone marrow pan-myelosis12/24 (50%)4/17 (24%)0.11aSignificance calculated by Fisher exact test.a Significance calculated by Fisher exact test.b Significance calculated by Mann–Whitney U test. Open table in a new tab Follow-up complete blood counts take
Referência(s)