Identification of Flow-dependent Endothelial Nitric-oxide Synthase Phosphorylation Sites by Mass Spectrometry and Regulation of Phosphorylation and Nitric Oxide Production by the Phosphatidylinositol 3-Kinase Inhibitor LY294002
1999; Elsevier BV; Volume: 274; Issue: 42 Linguagem: Inglês
10.1074/jbc.274.42.30101
ISSN1083-351X
AutoresByron Gallis, Garry L. Corthals, David R. Goodlett, Hiroto Ueba, Francis Kim, Steven R. Presnell, Daniel Figeys, David G. Harrison, Bradford C. Berk, Ruedi Aebersold, Marshall A. Corson,
Tópico(s)Nitric Oxide and Endothelin Effects
ResumoEndothelial cells release nitric oxide (NO) acutely in response to increased laminar fluid shear stress, and the increase is correlated with enhanced phosphorylation of endothelial nitric-oxide synthase (eNOS). Phosphoamino acid analysis of eNOS from bovine aortic endothelial cells labeled with [32P]orthophosphate demonstrated that only phosphoserine was present in eNOS under both static and flow conditions. Fluid shear stress induced phosphate incorporation into two specific eNOS tryptic peptides as early as 30 s after initiation of flow. The flow-induced tryptic phosphopeptides were enriched, separated by capillary electrophoresis with intermittent voltage drops, also known as "peak parking," and analyzed by collision-induced dissociation in a tandem mass spectrometer. Two phosphopeptide sequences determined by tandem mass spectrometry, TQpSFSLQER and KLQTRPpSPGPPPAEQLLSQAR, were confirmed as the two flow-dependent phosphopeptides by co-migration with synthetic phosphopeptides. Because the sequence (RIR)TQpSFSLQER contains a consensus substrate site for protein kinase B (PKB or Akt), we demonstrated that LY294002, an inhibitor of the upstream activator of PKB, phosphatidylinositol 3-kinase, inhibited flow-induced eNOS phosphorylation by 97% and NO production by 68%. Finally, PKB phosphorylated eNOS in vitro at the same site phosphorylated in the cell and increased eNOS enzymatic activity by 15–20-fold. Endothelial cells release nitric oxide (NO) acutely in response to increased laminar fluid shear stress, and the increase is correlated with enhanced phosphorylation of endothelial nitric-oxide synthase (eNOS). Phosphoamino acid analysis of eNOS from bovine aortic endothelial cells labeled with [32P]orthophosphate demonstrated that only phosphoserine was present in eNOS under both static and flow conditions. Fluid shear stress induced phosphate incorporation into two specific eNOS tryptic peptides as early as 30 s after initiation of flow. The flow-induced tryptic phosphopeptides were enriched, separated by capillary electrophoresis with intermittent voltage drops, also known as "peak parking," and analyzed by collision-induced dissociation in a tandem mass spectrometer. Two phosphopeptide sequences determined by tandem mass spectrometry, TQpSFSLQER and KLQTRPpSPGPPPAEQLLSQAR, were confirmed as the two flow-dependent phosphopeptides by co-migration with synthetic phosphopeptides. Because the sequence (RIR)TQpSFSLQER contains a consensus substrate site for protein kinase B (PKB or Akt), we demonstrated that LY294002, an inhibitor of the upstream activator of PKB, phosphatidylinositol 3-kinase, inhibited flow-induced eNOS phosphorylation by 97% and NO production by 68%. Finally, PKB phosphorylated eNOS in vitro at the same site phosphorylated in the cell and increased eNOS enzymatic activity by 15–20-fold. endothelial nitric-oxide synthase nitric oxide fluid shear stress high pressure liquid chromatography protein kinase B mitogen-activated protein free intracellular calcium bovine aortic endothelial cells Dulbecco's modified Eagle's medium collision-induced dissociation tandem mass spectrometry immobilized metal affinity chromatography solid phase extraction-capillary electrophoresis polyvinylidene difluoride high voltage electrophoresis mass to charge ratio nitrogen oxides inducible nitric-oxide synthase neuronal nitric-oxide synthase polyacrylamide gel electrophoresis phosphatidylinositol 3-kinase Endothelial nitric-oxide synthase (eNOS1 or type III NOS) is one of three isoenzymes that converts l-arginine tol-citrulline and nitric oxide (NO). Endothelial cells synthesize NO tonically and increase NO production in response to agonists and increased fluid shear stress (FSS). Endothelial NO contributes to blood vessel homeostasis by regulating vessel tone (1Palmer R.M. Ferrige A.G. Moncada S. Nature. 1987; 327: 524-526Crossref PubMed Scopus (9366) Google Scholar), cell growth (2Garg U.C. Hassid A. J. Clin. Invest. 1989; 83: 1774-1777Crossref PubMed Scopus (1997) Google Scholar), platelet aggregation (3Ignarro L.J. Circ. Res. 1989; 65: 1-21Crossref PubMed Scopus (904) Google Scholar), and leukocyte binding to endothelium (4Radomski M.W. Vallance P. Whitley G. Foxwell N. Moncada S. Cardiovasc. Res. 1993; 27: 1380-1382Crossref PubMed Scopus (209) Google Scholar). In vivo eNOS is both myristoylated and palmitoylated. These modifications increase eNOS compartmentalization to plasmalemmal caveolae and facilitate release of NO from cells (5Liu J. Garcia-Cardena G. Sessa W.C. Biochemistry. 1996; 35: 13277-13281Crossref PubMed Scopus (203) Google Scholar, 6Garcia-Cardena G. Oh P. Liu J. Schnitzer J.E. Sessa W.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6448-6453Crossref PubMed Scopus (578) Google Scholar, 7Shaul P.W. Smart E.J. Robinson L.J. German Z. Yuhanna I.S. Ying Y. Anderson R.G. Michel T. J. Biol. Chem. 1996; 271: 6518-6522Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar). In caveolae, which are small plasmalemmal invaginations that sequester signaling proteins (8Okamoto T. Schlegel A. Scherer P.E. Lisanti M.P. J. Biol. Chem. 1998; 273: 5419-5422Abstract Full Text Full Text PDF PubMed Scopus (1347) Google Scholar), eNOS specifically interacts with the scaffolding protein caveolin-1 through a caveolin (9Garcia-Cardena G. Martasek P. Masters B.S. Skidd P.M. Couet J. Li S. Lisanti M.P. Sessa W.C. J. Biol. Chem. 1997; 272: 25437-25440Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar, 10Feron O. Belhassen L. Kobzik L. Smith T.W. Kelly R.A. Michel T. J. Biol. Chem. 1996; 271: 22810-22814Abstract Full Text Full Text PDF PubMed Scopus (598) Google Scholar) binding motif (11Couet J. Li S. Okamoto T. Ikezu T. Lisanti M.P. J. Biol. Chem. 1997; 272: 6525-6533Abstract Full Text Full Text PDF PubMed Scopus (811) Google Scholar), located near the domain that binds Ca2+/calmodulin. Recent studies suggest that the activity of eNOS is regulated in a reciprocal manner through caveolin-1 inhibition and Ca2+/calmodulin stimulation (12Ju H. Zou R. Venema V.J. Venema R.C. J. Biol. Chem. 1997; 272: 18522-18525Abstract Full Text Full Text PDF PubMed Scopus (526) Google Scholar, 13Michel J.B. Feron O. Sase K. Prabhakar P. Michel T. J. Biol. Chem. 1997; 272: 25907-25912Abstract Full Text Full Text PDF PubMed Scopus (271) Google Scholar, 14Michel J.B. Feron O. Sacks D. Michel T. J. Biol. Chem. 1997; 272: 15583-15586Abstract Full Text Full Text PDF PubMed Scopus (512) Google Scholar). Increased FSS stimulates an increase in free intracellular calcium [Ca2+]i from intracellular stores (15James N.L. Harrison D.G. Nerem R.M. FASEB J. 1995; 9: 968-973Crossref PubMed Scopus (48) Google Scholar, 16Geiger R.V. Berk B.C. Alexander R.W. Nerem R.M. Am. J. Physiol. 1992; 262: C1411-C1417Crossref PubMed Google Scholar) leading to a Ca2+/calmodulin-dependent increase in eNOS activity. However, recent investigations show that increases in [Ca2+]i do not fully explain the rapid rise in NO production in response to FSS (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar). Exposure of bovine aortic endothelial cells (BAEC) to 25 dynes/cm2 FSS for 30 s caused a 7-fold rise in NO production and a corresponding 2-fold increase in eNOS phosphorylation, whereas the calcium ionophore A23187 neither caused rapid NO production nor any net increase in eNOS phosphorylation (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar). We therefore hypothesized that an increase in FSS could be transduced to increased NO production via activation of a protein kinase cascade resulting in phosphorylation and activation of eNOS. The objectives of the present work were to elucidate the eNOS sites phosphorylated in response to increased FSS and to identify potential protein kinase mediators of the mechanotransduction of FSS to NO production. The amino acid residues phosphorylated in small proteins may be determined by fractionation of tryptic peptides by high pressure liquid chromatography (HPLC) and mass spectrometry (18Gygi S.P. Han D.K. Gingras A.C. Sonenberg N. Aebersold R. Electrophoresis. 1999; 20: 310-319Crossref PubMed Scopus (89) Google Scholar). However, tryptic fragmentation of large proteins such as eNOS creates numerous peptides whose rapid elution from HPLC exceeds the scan rate of the triple quadrupole mass spectrometer. This prevents acquisition of sequences, by collision-induced dissociation (CID), of a substantial fraction of the peptides. Additionally, phosphopeptides from proteins isolated from a cell will nearly always exist as minor ions due to sub-stoichiometric phosphorylation compared with nonphosphorylated peptides and will not be scanned as major parent ions. In order to identify phosphorylation sites in eNOS, tryptic phosphopeptides were first enriched by immobilized metal affinity chromatography (IMAC). The peptides were then separated by peak parking solid phase extraction capillary electrophoresis (SPE-CE), which extends the peak analysis time to provide for both increased scan times of parent ions and increased MS/MS analyses of each selected peptide according to optimized CID parameters. The identity of two specific eNOS residues phosphorylated in response to flow was determined, and evidence was obtained linking FSS to eNOS phosphorylation and NO production via activation of phosphatidylinositol 3-kinase (PI3-kinase) and protein kinase B (PKB). We present evidence that PKB phosphorylates eNOSin vitro at the same site phosphorylated in the cell and that the phosphorylation increases eNOS enzymatic activity. The monoclonal antibody (H32) to eNOS was purchased from Biomol (Plymouth Meeting, NJ). Anti-phosphoserine 473-PKB rabbit polyclonal antibody was purchased from New England Biolabs (Beverly, MA), and anti-PKB (pleckstrin homology domain) sheep polyclonal antibody and activated recombinant PKB were purchased from Upstate Biotechnology Inc. (Lake Placid, NY). Sequencing grade modified trypsin and compound U0126 were obtained from Promega (Madison, WI). Cellulose thin layer chromatography sheets (20 × 20 cm) were from Eastman Kodak Co. Constant boiling 6 n hydrochloric acid was from Pierce. Hybond ECL nitrocellulose membranes andl-[U-14C]arginine monohydrochloride (278 mCi/mmol) were purchased from Amersham Pharmacia Biotech. [32P]Orthophosphoric acid (185 MBq) was purchased from NEN Life Science Products. Phosphoserine, phosphothreonine, phosphotyrosine, ninhydrin, polyvinylpyrrolidone (PVP40,M r = 40,000), silver nitrate ultra, sodium thiosulfate ultra, sodium carbonate, and 8-(chlorophenylthio)-guanosine 3′:5′-cyclic monophosphate were purchased from Sigma. Protein A-agarose was obtained from Life Technologies, Inc. Polyvinylidene difluoride (PVDF) Immobilon P was purchased from Millipore (Bedford, MA). DETA-NONOate was purchased from Alexis Biochemicals (San Diego, CA). Formaldehyde and ammonium bicarbonate were purchased from J. T. Baker Inc. High purity acetonitrile for HPLC was obtained from Burdick and Jackson (Muskegon, MI). LY294002 and PD98059 were purchased from Calbiochem. The synthetic peptides RIRTQpSFSLQER and KLQTRPpSPGPPPAEQLLSQAR were purchased from SynPep Corp. (Dublin, CA). BAEC cultures were established and maintained in culture in medium 199 (Life Technologies, Inc.) supplemented with fetal calf serum as described (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar). Cells from passage 3–8 were seeded in 100-mm tissue culture dishes and used at 60–80% confluency for labeling and shear stress experiments. Cells were exposed to laminar FSS in a cone and plate viscometer as described (19Traub O. Yan C. Berk B. Lelkes P. Mechanical Forces and the Endothelium. Hardood Academic Publishers, UK1999Google Scholar). BAEC at 60–80% confluence in 100-mm dishes were washed twice with phosphate-free DMEM and labeled with 1 mCi/ml [32P]orthophosphate for 3 h in phosphate-free DMEM containing 10% dialyzed fetal bovine serum. Na3VO4 (200 μm) was added to the culture medium for 10 min prior to harvest. Cells were maintained in static culture or exposed to 12–15 dynes/cm2 FSS for the indicated times in a cone and plate viscometer (19Traub O. Yan C. Berk B. Lelkes P. Mechanical Forces and the Endothelium. Hardood Academic Publishers, UK1999Google Scholar). Cells were rapidly washed with ice-cold phosphate-buffered saline and lysed in 0.7 ml of phosphate-buffered saline containing 1% Triton X-100, 50 mm β-glycerophosphate, 200 μmNa3VO4, 10 μg/ml leupeptin, 10 μg/ml soybean trypsin inhibitor, 2 mm benzamidine HCl, and 2 mm EDTA. Lysates were centrifuged for 5 min at 14,000 rpm at 4 °C. Equivalent amounts of protein as determined by Bradford assay were used for all immunoprecipitations. The supernatants were precleared as described (20Acres R.B. Conlon P.J. Mochizuki D.Y. Gallis B. J. Biol. Chem. 1986; 261: 16210-16214Abstract Full Text PDF PubMed Google Scholar) and incubated for 4 h at a final NaCl concentration of 400 mm (21Peltz G.A. Gallis B. Peterlin B.M. Anal. Biochem. 1987; 167: 239-244Crossref PubMed Scopus (6) Google Scholar) on a rocker with 60 μl of a 20% suspension (v/v) of protein A-agarose and 5 μg of anti-eNOS monoclonal antibody. The immune pellets were washed four times with 0.8 ml of lysis buffer without protease inhibitors, boiled in sodium dodecyl sulfate (SDS) sample buffer, and the eluates from the immune pellets were stored at −20 °C. Immunoprecipitated eNOS in SDS sample buffer was fractionated on a 9% SDS-polyacrylamide gel in a Bio-Rad Mini-PROTEAN II electrophoresis apparatus. The gel was soaked in 100 ml of transfer buffer (24 mm Tris base, 181 mmglycine) for 10 min, and the proteins were transferred to nitrocellulose at 100 V for 70 min. For Western blotting, proteins (30 μg/lane) were fractionated on a 9% SDS-polyacrylamide gel and transferred to nitrocellulose. After blocking for 1 h in 100 mm NaCl, 100 mm Tris-HCl, pH 7.4, 0.1% Tween 20, and 1% bovine serum albumin, the membranes were reacted with anti-phospho-PKB or anti-PKB antibodies at a 1:1000 dilution. After washing, the blot was reacted with horseradish peroxidase-conjugated antibodies (Amersham Pharmacia Biotech), and chemiluminescence was performed. For blotting of proteins to PVDF Immobilon P membrane, the gel was transferred at 35 V for 5 h in transfer buffer containing 20% methanol. Phosphopeptide mapping and phosphoamino acid analysis were performed as described (22Affolter M. Watts J.D. Krebs D.L. Aebersold R. Anal. Biochem. 1994; 223: 74-81Crossref PubMed Scopus (45) Google Scholar, 23van der Geer P. Hunter T. Electrophoresis. 1994; 15: 544-554Crossref PubMed Scopus (125) Google Scholar). eNOS was immunoprecipitated from six [32P]orthophosphate-labeled 100-mm culture dishes and 12 non-labeled culture dishes of BAEC exposed to 15 dynes/cm2FSS for 1 min. The pooled immunoprecipitates were separated on a 0.75-mm thick, 9% SDS-polyacrylamide gel. The eNOS was located by silver staining (24Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7831) Google Scholar), excised from the gel, and the incorporation of32P was determined by Cerenkov counting. The gel slices were washed in 1% ammonium bicarbonate, pH 8.3, shrunk by dehydration in acetonitrile, and dried in a vacuum centrifuge. eNOS was reduced in the gel slices by incubation in 1% ammonium bicarbonate, pH 8.3, containing 10 mm dithiothreitol and 2 mm EDTA under N2 gas for 1 h at 56 °C. For alkylation (25Moritz R.L. Eddes J.S. Reid G.E. Simpson R.J. Electrophoresis. 1996; 17: 907-917Crossref PubMed Scopus (92) Google Scholar), 4-vinylpyridine was diluted to 2% (v/v) directly into the reduction buffer, and the gel slices were incubated with intermittent shaking for 1 h at 25 °C in the dark. After S-pyridylethylation, the buffer was removed, and the gel slices were washed with 1% ammonium bicarbonate and shrunk with acetonitrile. Gel slices were dried in a vacuum centrifuge, and the washing, shrinking, and drying procedure was repeated (24Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7831) Google Scholar). The gel slices containing reduced and alkylated eNOS were digested with 100 ng of sequencing grade trypsin as described (24Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7831) Google Scholar). Ninety-five percent of the tryptic phosphopeptides were recovered from the gel slice, as determined by Cerenkov counting. An ion metal affinity column (IMAC) was constructed and operated as described previously (22Affolter M. Watts J.D. Krebs D.L. Aebersold R. Anal. Biochem. 1994; 223: 74-81Crossref PubMed Scopus (45) Google Scholar) with the following exceptions. To each end of a 10-cm-long piece of Teflon tubing (1/16 inches outer diameter × 0.0001 inches inner diameter) a piece of polyimide-coated fused silica capillary (PlymicroTechnologies, Tucson, AZ) was inserted and held in place by a union (Valco, Houston, TX). Prior to fixing the second of the two polyimide capillaries in place the open Teflon end was placed in a slurry of POROS-MC (PerSeptive) inside a vessel pressurized by helium, and the IMAC column was packed to a length of 5 cm under 500 pounds/square inch pressure. The second piece of fused silica capillary was then fixed in place with a second union. For operation one of the two polyimide capillaries was placed in a helium pressure vessel and the other served as an outlet. The IMAC column was prepared for use by washing (5 min/wash at 5 pounds/square inch) sequentially with water, 0.1 m EDTA, water, 0.1 m acetic acid, 0.1m FeCl3, and 0.1 m acetic acid. The sample, reconstituted in 0.1 m acetic acid, was loaded in entirety and followed by washing with 0.1 m acetic acid, water, 0.1% NH4H2PO4 for elution of bound phosphopeptides, water, and 0.1 m EDTA. Peptides were concentrated after IMAC, reconstituted in 0.4% acetic acid, 0.005% heptafluorobutyric acid (solvent A) and injected onto the HPLC column. HPLC was carried out on a Michrome Bioresources instrument (Auburn, CA) equipped with a 0.5-mm C18 column. A linear gradient from 0 to 60% acetonitrile, which contained 0.4% acetic acid and 0.005% heptafluorobutyric acid wash, was used to elute peptides from the column. One-minute fractions were collected and 32P content per fraction estimated by Cerenkov counting. Fractions from the HPLC separation intended for SPE-CE were concentrated slightly to remove excess acetonitrile, as described (26Figeys D. Corthals G. Gallis B. Ducret A. Corson M. Aebersold R. Anal. Chem. 1999; 71: 2279-2287Crossref PubMed Scopus (54) Google Scholar). The sample was pressure-injected on a C18 cartridge (1 mm × 250 μm) placed at the head of the CE capillary. A series of washes both desalted and prepared the sample for CE which began when a small plug of organic solvent was pressure-injected onto the SPE cartridge (27Figeys D. Ducret A. Yates III, J.R. Aebersold R. Nat. Biotechnol. 1996; 14: 1579-1583Crossref PubMed Scopus (167) Google Scholar, 28Figeys D. van Oostveen I. Ducret A. Aebersold R. Anal. Chem. 1996; 68: 1822-1828Crossref PubMed Scopus (136) Google Scholar). Peptides were sequenced on a Finnigan (San Jose, CA) TSQ 7000 triple quadrupole mass spectrometer equipped with a home-built electrospray ionization device described previously (26Figeys D. Corthals G. Gallis B. Ducret A. Corson M. Aebersold R. Anal. Chem. 1999; 71: 2279-2287Crossref PubMed Scopus (54) Google Scholar). Data acquisition was computer-controlled using a program written in instrument control language that automatically provided data-dependent ion selection and varied capillary electrophoretic voltage. Ion selection and CE voltage were dependent on ion intensity such that as an ion reached a given intensity the mass spectrometer simultaneously switched from full scan mode to MS/MS mode and the CE voltage decreased from −20 to −5 kV. When the ion signal decreased below a preset threshold, the mass spectrometer returned to initial scanning/electrophoretic conditions. NO released by BAEC was measured as its nitrogen oxide (NOx) metabolites, using a chemiluminescence detector as described in detail (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar). pCeNOS, the plasmid for the expression of His6 eNOS inEscherichia coli, was constructed using two sequential two-piece ligations. An NdeI-SfiI fragment including the initial 533 nucleotides of bovine eNOS cDNA (29Nishida K. Harrison D.G. Navas J.P. Fisher A.A. Dockery S.P. Uematsu M. Nerem R.M. Alexander R.W. Murphy T.J. J. Clin. Invest. 1992; 90: 2092-2096Crossref PubMed Scopus (616) Google Scholar) was created using the following sense and antisense primers: 5′-TGATTACCATATGGCC[CATCAC]3AACTTGAAGAGTGTGGGCCAGGAG and 5′-GCGCCAGGCCTGCTTGGCCCCGAAC. This fragment was purified and used as a template to create a HindIII-SfiI1 fragment using additional polymerase chain reaction, using this sense primer 5′-TATCCCAAGCTTGGGTGATTACCATATGGCCCA and the former antisense primer. This fragment (a HindIII-SfiI fragment with an internal NdeI site) was purified and cut withHindIII and SfiI. pBluescript eNOS (29Nishida K. Harrison D.G. Navas J.P. Fisher A.A. Dockery S.P. Uematsu M. Nerem R.M. Alexander R.W. Murphy T.J. J. Clin. Invest. 1992; 90: 2092-2096Crossref PubMed Scopus (616) Google Scholar) was similarly cut and dephosphorylated. Ligation products were transformed into DH5α cells, and colonies were screened for positive recombinants via restriction digest. A positive clone (pBlueNOS NDE) was maxiprepped and then cut with NdeI and XbaI. pCW ori+ (30Muchmore D.C. McIntosh L.P. Russell C.B. Anderson D.E. Dahlquist F.W. Methods Enzymol. 1989; 177: 44-73Crossref PubMed Scopus (474) Google Scholar) was cut similarly, and the two pieces ligated, transformed, and screened as before. A positive clone (pCeNOS) allowed isopropyl-1-thio-β-d-galactopyranoside-induced eNOS expression at 23 °C (31Roman L.J. Sheta E.A. Martasek P. Gross S.S. Liu Q. Masters B.S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8428-8432Crossref PubMed Scopus (244) Google Scholar) as judged by immunoblot analysis. The clone was sequenced through the region that was amplified by polymerase chain reaction, and this sequence was found to be perfectly consistent with the published bovine eNOS sequence (29Nishida K. Harrison D.G. Navas J.P. Fisher A.A. Dockery S.P. Uematsu M. Nerem R.M. Alexander R.W. Murphy T.J. J. Clin. Invest. 1992; 90: 2092-2096Crossref PubMed Scopus (616) Google Scholar) in the region. eNOS was expressed and purified from E. coli as described (32Venema R.C. Sayegh H.S. Arnal J.F. Harrison D.G. J. Biol. Chem. 1995; 270: 14705-14711Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 33Rodriguez-Crespo I. Gerber N.C. Ortiz de Montellano P.R. J. Biol. Chem. 1996; 271: 11462-11467Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar) with minor modifications. pCeNOS was transformed into BL21(DE3)pLysS cells. A colony was grown to log phase and innoculated into 2-liter flasks containing 500 ml of Terrific broth and 100 μg/ml ampicillin. At an A 600 = 0.8, 500 μmisopropyl-1-thio-β-d-galactopyranoside, 500 μm aminolevulinic acid, and 3 μm riboflavin were added. The culture was shaken at 23 °C for 24 h at 200 rpm, and bacteria were pelleted and lysed in 50 mm Tris, pH 8.0, a protease mixture (1 mm phenylmethylsulfonyl fluoride, 10 μg of 1 ml each of leupeptin, pepstatin A, chymostatin, benzamidine, antipain, 2. 5 mm β-mercaptoethanol, 1 mm EDTA, 1 mm EGTA), 1 mg/ml lysozyme, 30 units/ml DNase I, and 0.15 mg/ml RNase A) for 15 min at 37 °C. Then 5 μm flavin adenine dinucleotide, 5 μmflavin mononucleotide, 20 μm (6Garcia-Cardena G. Oh P. Liu J. Schnitzer J.E. Sessa W.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6448-6453Crossref PubMed Scopus (578) Google Scholar) (R-5,6,7,8-tetrahydro-l-biopterin, and 40 mm β-mercaptoethanol were added, and the lysate was centrifuged at 50,000 × g for 20 min at 4 °C. eNOS in the supernatant was purified using 2′,5′-ADP-Sepharose chromatography as described (32Venema R.C. Sayegh H.S. Arnal J.F. Harrison D.G. J. Biol. Chem. 1995; 270: 14705-14711Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). The protein was further purified by Ni2+ chelate chromatography as described (33Rodriguez-Crespo I. Gerber N.C. Ortiz de Montellano P.R. J. Biol. Chem. 1996; 271: 11462-11467Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). eNOS was 95% pure by silver stain after SDS-PAGE and was stored in aliquots in 10% glycerol at −80 °C. Kinase reactions using PKB to phosphorylate eNOS were performed according to the manufacturer's instructions. For determination of stoichiometry 150 ng of PKB was used to phosphorylate 10 μg of eNOS with [γ-32P]ATP (90 μm) at a specific activity of 2800 cpm/pmol. At the indicated time points, aliquots of the reaction were boiled in SDS sample buffer, and eNOS was separated by SDS-PAGE and then localized by silver staining. The eNOS bands were excised, and incorporation was determined by Cerenkov counting. For activation of eNOS by PKB, 300 ng of PKB (specific activity 560 nmol/min mg using eNOS as a substrate) was incubated with 2.5 μg of recombinant eNOS in a 20-min protein kinase reaction at 30 °C. Reactions without PKB were run in parallel. After phosphorylation, 1-μg aliquots of eNOS from the kinase reactions with and without PKB were diluted into 100-μl eNOS assays containing 20 μml-[U-14C]arginine (1375 cpm/pmol), 3 μm CaCl2, 4 μmFAD, 4 μm FMN, 4 μm BH4, 1 mm NADPH, 50 mm Tris, pH 7.5, 3 μm calmodulin, and reactions were carried out exactly as described (34Kumar V.B. Bernardo A.E. Alshaher M.M. Buddhiraju M. Purushothaman R. Morley J.E. Anal. Biochem. 1999; 269: 17-20Crossref PubMed Scopus (20) Google Scholar) at 30 °C. Labeled arginine was separated from labeled citrulline by thin layer chromatography (34Kumar V.B. Bernardo A.E. Alshaher M.M. Buddhiraju M. Purushothaman R. Morley J.E. Anal. Biochem. 1999; 269: 17-20Crossref PubMed Scopus (20) Google Scholar) and [14C]citrulline counts/min formed were determined by scraping and counting the silica gel containing [14C]citrulline in scintillant after localization by autoradiography. Previously we and others (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar, 35Michel T. Li G.K. Busconi L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6252-6256Crossref PubMed Scopus (305) Google Scholar) have shown that eNOS is phosphorylated in BAEC in static conditions and that the phosphorylation of eNOS is enhanced in response to flow (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar). BAEC were labeled with [32P]orthophosphate in phosphate-free DMEM containing 200 μm Na3VO4. Cells were maintained in static condition or subjected to laminar FSS (19Traub O. Yan C. Berk B. Lelkes P. Mechanical Forces and the Endothelium. Hardood Academic Publishers, UK1999Google Scholar). The cells were lysed; eNOS was immunoprecipitated with a monoclonal antibody, and the immunoprecipitate was fractionated on an SDS-polyacrylamide gel. The proteins in the gel were transferred to nitrocellulose and detected by autoradiography (Fig.1 A). eNOS was basally phosphorylated in cells maintained in static culture (Fig. 1 A, lane 1), and exposure to laminar FSS caused a rapid, nearly 2-fold increase (17Corson M.A. James N.L. Latta S.E. Nerem R.M. Berk B.C. Harrison D.G. Circ. Res. 1996; 79: 984-991Crossref PubMed Scopus (411) Google Scholar) in eNOS phosphorylation (see Fig. 1 A and legend). Previous investigators have labeled endothelial cells under static conditions with [32P]orthophosphate in the presence of phenylarsine oxide (36Venema V.J. Marrero M.B. Venema R.C. Biochem. Biophys. Res. Commun. 1996; 226: 703-710Crossref PubMed Scopus (98) Google Scholar) or pervanadate (37Garcia-Cardena G. Fan R. Stern D.F. Liu J. Sessa W.C. J. Biol. Chem. 1996; 271: 27237-27240Abstract Full Text Full Text PDF PubMed Scopus (428) Google Scholar) and have shown that eNOS contains predominantly phosphoserine and a small amount of phosphotyrosine. BAEC were labeled with [32P]orthophosphate in the presence of Na3VO4 (see "Experimental Procedures") and maintained under static condition or exposed to FSS at 15 dynes/cm2 for 1 min. Fig. 1 B shows that eNOS contains only phosphoserine under both static and flow conditions (n = 3). No other phosphoamino acid was detected in eNOS. The eNOS transferred to nitrocellulose (shown in Fig. 1 A) was subjected to tryptic cleavage and the tryptic peptides were spotted onto a thin layer plate. The peptides were fractionated in the first dimension by HVE and in the second dimension by TLC. Autoradiograms of the thin layer plates are shown in Fig. 2. Under static conditions eNOS contained 8–10 phosphopeptides (Fig. 2 A), two of which, F1 and F2, increased with time when BAEC are exposed to 15 dynes/cm2 FSS (Fig. 2, B—D). The relative volumes of each of the basal and flow-stimulated phosphopeptides were quantified by PhosphorImager analysis in two independent experiments examining phosphate incorporation as a function of shear stress duration (Table I). Whereas the incorporation of phosphate into eNOS during a 10-min time course was approximately 2-fold, the specific incorporation into the flow-dependent phosphorylation sites F1 and F2 was more pronounced. Flow-dependent phosphorylation of pep
Referência(s)