Molecular Characterization of Mammalian Dicarbonyl/l-Xylulose Reductase and Its Localization in Kidney
2002; Elsevier BV; Volume: 277; Issue: 20 Linguagem: Inglês
10.1074/jbc.m110703200
ISSN1083-351X
AutoresJunichi Nakagawa, Syuhei Ishikura, Jun Asami, Tomoya Isaji, Noriyuki Usami, Akira Hara, Takanobu Sakurai, Katsuki Tsuritani, Koji Oda, Masayoshi Takahashi, Makoto Yoshimoto, Noboru Otsuka, Kunihiro Kitamura,
Tópico(s)Diet, Metabolism, and Disease
ResumoIn this report, we first cloned a cDNA for a protein that is highly expressed in mouse kidney and then isolated its counterparts in human, rat hamster, and guinea pig by polymerase chain reaction-based cloning. The cDNAs of the five species encoded polypeptides of 244 amino acids, which shared more than 85% identity with each other and showed high identity with a human sperm 34-kDa protein, P34H, as well as a murine lung-specific carbonyl reductase of the short-chain dehydrogenase/reductase superfamily. In particular, the human protein is identical to P34H, except for one amino acid substitution. The purified recombinant proteins of the five species were about 100-kDa homotetramers with NADPH-linked reductase activity for α-dicarbonyl compounds, catalyzed the oxidoreduction between xylitol and l-xylulose, and were inhibited competitively by n-butyric acid. Therefore, the proteins are designated as dicarbonyl/l-xylulose reductases (DCXRs). The substrate specificity and kinetic constants of DCXRs for dicarbonyl compounds and sugars are similar to those of mammalian diacetyl reductase and l-xylulose reductase, respectively, and the identity of the DCXRs with these two enzymes was demonstrated by their co-purification from hamster and guinea pig livers and by protein sequencing of the hepatic enzymes. Both DCXR and its mRNA are highly expressed in kidney and liver of human and rodent tissues, and the protein was localized primarily to the inner membranes of the proximal renal tubules in murine kidneys. The results imply that P34H and diacetyl reductase (EC 1.1.1.5) are identical tol-xylulose reductase (EC 1.1.1.10), which is involved in the uronate cycle of glucose metabolism, and the unique localization of the enzyme in kidney suggests that it has a role other than in general carbohydrate metabolism. In this report, we first cloned a cDNA for a protein that is highly expressed in mouse kidney and then isolated its counterparts in human, rat hamster, and guinea pig by polymerase chain reaction-based cloning. The cDNAs of the five species encoded polypeptides of 244 amino acids, which shared more than 85% identity with each other and showed high identity with a human sperm 34-kDa protein, P34H, as well as a murine lung-specific carbonyl reductase of the short-chain dehydrogenase/reductase superfamily. In particular, the human protein is identical to P34H, except for one amino acid substitution. The purified recombinant proteins of the five species were about 100-kDa homotetramers with NADPH-linked reductase activity for α-dicarbonyl compounds, catalyzed the oxidoreduction between xylitol and l-xylulose, and were inhibited competitively by n-butyric acid. Therefore, the proteins are designated as dicarbonyl/l-xylulose reductases (DCXRs). The substrate specificity and kinetic constants of DCXRs for dicarbonyl compounds and sugars are similar to those of mammalian diacetyl reductase and l-xylulose reductase, respectively, and the identity of the DCXRs with these two enzymes was demonstrated by their co-purification from hamster and guinea pig livers and by protein sequencing of the hepatic enzymes. Both DCXR and its mRNA are highly expressed in kidney and liver of human and rodent tissues, and the protein was localized primarily to the inner membranes of the proximal renal tubules in murine kidneys. The results imply that P34H and diacetyl reductase (EC 1.1.1.5) are identical tol-xylulose reductase (EC 1.1.1.10), which is involved in the uronate cycle of glucose metabolism, and the unique localization of the enzyme in kidney suggests that it has a role other than in general carbohydrate metabolism. Carbonyl compounds are routinely generated in the course of metabolic reactions and by oxidative stresses in a variety of biological systems. When two carbonyl groups juxtapose on a carbon chain, the reactivity of each carbonyl group tends to be elevated, and those compounds with such α-dicarbonyl groups are known to be prone to conversion into advanced glycation end-products (AGEs). 1The abbreviations used are: AGEadvanced glycation endproductMLCRmouse lung carbonyl reductaseSDRshort-chain dehydrogenase/reductaseDCXRdicarbonyl/l-xylulose reductaseRT-PCRreverse transcription-PCRESTexpressed sequence tagRACErapid amplification of cDNA endsRTroom temperatureP26hhamster sperm 26-kDa proteinP34Hhuman sperm 34-kDa proteinPBSphosphate-buffered saline AGEs are a group of insoluble complex compounds that frequently accumulate in the plasma proteins and tissues of diabetic subjects and are also associated with renal failure regardless of diabetic background (1Sell D.R. Monnier V.M. J. Clin. Invest. 1990; 85: 380-384Crossref PubMed Scopus (272) Google Scholar, 2Makita Z Radoff S. Rayfield E.J. Yang Z. Skolnik E. Delaney V. Friedman E.A. Cerami A. Vlassara H. N. Engl. J. Med. 1991; 325: 836-842Crossref PubMed Scopus (832) Google Scholar, 3Weiss M.F. Erhard P. Kader-Attia F.A. Wu Y.C. Deoreo P.B. Araki A. Glomb M.A. Monnier V.M. Kidney Int. 2000; 57: 2571-2585Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). Advanced aging also accounts for the triggering of AGE accumulation (4Raj D.S. Choudhury D. Welbourne T.C. Levi M. Am. J. Kidney Dis. 2000; 35: 365-380Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar). The starting compounds are assumed to originate from carbohydrates such as glucose and fructose, or from lipid compounds, which then undergo a non-enzymatic Maillard reaction followed by a series of as yet unidentified non-enzymatic and enzymatic reactions, via major intermediate compounds harboring an α-dicarbonyl group in their molecules (1Sell D.R. Monnier V.M. J. Clin. Invest. 1990; 85: 380-384Crossref PubMed Scopus (272) Google Scholar, 3Weiss M.F. Erhard P. Kader-Attia F.A. Wu Y.C. Deoreo P.B. Araki A. Glomb M.A. Monnier V.M. Kidney Int. 2000; 57: 2571-2585Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 4Raj D.S. Choudhury D. Welbourne T.C. Levi M. Am. J. Kidney Dis. 2000; 35: 365-380Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 5Bucala R. Makita Z. Vega G. Grundy S. Koschinsky T. Cerami A. Vlassara H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6434-6438Crossref PubMed Scopus (562) Google Scholar). The AGEs subsequently stimulate a group of scavenger receptors called RAGEs, leading to an aberrant production of inflammatory cytokines (6Schmidt A.M. Vianna M. Gerlach M. Brett J. Ryan J. Kao J. Esposito C. Hegarty H. Hurley W. Clauss M. Wang F. Pan Y.-C. E. Tsang T.C. Stern D. J. Biol. Chem. 1992; 267: 14987-14997Abstract Full Text PDF PubMed Google Scholar, 7Horiuchi S. Murakami M. Takata K. Morino Y. J. Biol. Chem. 1986; 261: 4692-4696Abstract Full Text PDF Google Scholar). In addition, by cross-linking proteins, especially those with long lives such as collagen, laminin, and other extracellular matrix proteins, AGEs may cause sclerotic disorders in the blood vessels and in tissues (8Dyer D.G. Dunn J.A. Thorpe S.R. Bailie K.E. Lyons T.J. McCance D.R. Baynes J.W. J. Clin. Invest. 1993; 91: 2463-2469Crossref PubMed Scopus (646) Google Scholar). This may eventually lead to the progression of diabetic retinopathy (9Hammes H.P. Martin S. Federin K. Geisen K. Brownlee M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11555-11558Crossref PubMed Scopus (487) Google Scholar). advanced glycation endproduct mouse lung carbonyl reductase short-chain dehydrogenase/reductase dicarbonyl/l-xylulose reductase reverse transcription-PCR expressed sequence tag rapid amplification of cDNA ends room temperature hamster sperm 26-kDa protein human sperm 34-kDa protein phosphate-buffered saline The potential relevance of aldose reductase and aldehyde reductase in detoxifying such dicarbonyl compounds has been documented (10Feather M.S. Flynn T.G. Munro K.A. Kubiseski T.J. Walton D.J. Biochim. Biophys. Acta. 1995; 197: 373-379Google Scholar, 11Sato K. Inazu A. Yamaguchi S. Nakayama T. Deyashiki Y. Sawada H. Hara A. Arch. Biochem. Biophys. 1993; 307: 286-294Crossref PubMed Scopus (69) Google Scholar); however, a question remained of whether there exists one or more reductases working specifically in the renal system. Supporting this notion, it is widely noted that renal failure is one of the major causes accounting for the accumulation of AGEs on plasma proteins and tissues, most prominently in the tubules of the nephron (12Makita Z. Bucala R. Rayfield E.J. Friedman E.A. Kaufman A.M. Korbet S.M. Barth R.H. Winston J.A. Fuh H. Manogue K.R. Cerami A. Vlassara H. Lancet. 1994; 343: 1519-1522Abstract PubMed Scopus (361) Google Scholar). Accordingly, it has been postulated that the function of the renal tubules is pivotal to the clearance of AGEs and their precursors, dicarbonyl compounds (13Gugliucci M. Bendayan M. Diabetologia. 1996; 39: 149-160Crossref PubMed Scopus (217) Google Scholar). In the course of screening potential renal therapeutic target genes, we have constructed a 3′-directed cDNA library from materials enriched with renal tubules and glomeruli of mouse kidney to generate a gene expression profile of the kidney. Following large-scale sequencing of about 1000 random cDNA clones, a non-biased representation of the mRNA population in the kidney was obtained. A data base survey of the sequences revealed that one of these candidate clones displayed significant sequence homology with mouse lung carbonyl reductase (MLCR (14Nakanishi M. Deyashiki Y. Ohshima K. Hara A. Eur. J. Biochem. 1995; 228: 381-387Crossref PubMed Scopus (61) Google Scholar)), which is a member of the short-chain dehydrogenase/reductase (SDR) superfamily (15Jörnvall H. Persson B. Krook M. Atrian S. González-Duarte R. Jeffery J. Ghosh D. Biochemistry. 1995; 34: 6003-6013Crossref PubMed Scopus (1161) Google Scholar). This inspired us to further investigate its possible involvement in renal carbonyl detoxification. Subsequent PCR-based homologue cloning yielded the isolation of human, hamster, rat, and guinea pig counterparts of the murine cDNA. The enzymatic characterization of the recombinant proteins expressed from the cDNAs of the five species shows that they turn out to be reductases that are specific for dicarbonyl compounds, i.e. diacetyl reductase (EC 1.1.1.5). Surprisingly, the recombinant proteins also displayed significant reductase activity toward l-xylulose, and the identity of diacetyl reductase with l-xylulose reductase (EC 1.1.1.10) has been demonstrated by co-purification of the two enzyme activities from guinea pig liver, in whichl-xylulose reductase was first identified (16Touster O. Reynolds V.H. Hutcheson R.M. J. Biol. Chem. 1954; 221: 697-709Abstract Full Text PDF Google Scholar). Based on these findings, we designated the protein encoded in the isolated cDNA as dicarbonyl/l-xylulose reductase (DCXR). Furthermore, we report the distribution of DCXR in the tissues of the five mammals investigated as well as its immunohistochemical localization in rat and mouse kidneys. Fractions enriched with glomeruli and renal tubules were prepared from male BALB/c mice using magnetic beads (Dynabeads M280 and M450, Dynal A.S., Oslo, Norway). Heparin (10 units/100 μl) was injected into the tail vein of a mouse, and 0.2 ml of a Dynabeads M280 suspension (6×108/ml), followed by 0.2 ml of a Dynabeads M450 suspension (4×108/ml), was injected through the renal afferent arteriole after a ventral opening operation. The kidney was removed and minced, and then the glomerular fraction was collected following the sieving selection (17Grant M.E. Harwood R. Williams I.F. Eur. J. Biochem. 1975; 54: 531-540Crossref PubMed Scopus (38) Google Scholar). The tissue fraction containing the Dynabeads was separated from the other tissues by magnetic force to obtain the fraction enriched with glomeruli and renal tubules. The collected fragments were examined under a light microscope to confirm the enrichment of glomeruli (roughly 7.5 × 103glomeruli and 4 × 103 renal tubule fragments in a 0.1-ml suspension). The extraction of RNA, the synthesis of cDNA followed by its MboI digestion, the construction of the cDNA library, and the subsequent body mapping analysis were performed as described previously (18Okubo K. Hori N. Matoba R. Niiyama T. Fukushima A. Kojima Y. Matsubara K. Nat. Genet. 1992; 2: 173-179Crossref PubMed Scopus (475) Google Scholar, 19Takenaka M. Imai E. Kaneko T. Ito T. Moriyama T. Yamauchi A. Hori M. Kawamoto S. Okubo K. Kidney Int. 1998; 53: 562-572Abstract Full Text PDF PubMed Scopus (41) Google Scholar), and other miscellaneous handling of DNA and protein was performed according to general procedures (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). The short cDNA fragments (average size of 256 bp) generated by the MboI digestion were sequenced using a PRIM 377 DNA sequencer (Applied Biosystems, Foster City, CA). A cDNA clone that showed high expression frequency (3 out of 958 clones) was subjected to further cloning of the cDNA containing a full-length open reading frame. The complete cDNA was isolated by PCR using a forward primer (5′-TGCTGCGAGAAGACGACAGAAT-3′) in the CapFinder cDNA library construction kit (CLONTECH, Palo Alto, CA) and a reverse primer (5′-AGTGGTCATGCCACTCCGGTTGCTCAG-3′), which was designed based on the sequence of one DCXR cDNA fragment containing a putative 3′-untranslated sequence. The sequence of this clone was determined by repeating PCR using a set of primers, Expf and Expr (see Table I), and then sequencing of the amplified products.Table INucleotide sequences of the primers used in this studyPrimerSequencePositionRestriction enzymehu-1fTACGGCTGCGAGAAGACGACAGAGGGhu-2fTACGGCTGCGAGAAGACGACAGAAhu-3rCCAAGCTTGTAGGATGAGCACGGCATGG759–786hu-4fCAGGATCCATG GAGCTGTTCCTCGCGGGC1–21BamHIhu-5rCAGAATTCTCA GCAGGCCCAGAAGCCCCCTTC711–735EcoRIExpfCC GAATTC ATG GACCTGGGGCTTGCA1–18EcoRIExprCC AAGC TTA GGTAGCCAGGAAGCCC717–735Hin dIIIra-NfAA CAT ATG GACCTGGGTCTTGCAG1–19NdeIha-KrCC AAGC TTA GGTAACCAGGAAGCCC717–735Hin dIIIhu-NfGG CAT ATG GAGCTGTTCCTCGCGGGCCG1–23NdeIhu-KrAA GGTACC TTA GCAGGCCCAGAAG720–735KpnIRace-1rCAGTGCTGCGCCCGATGCCTTT49–70Race-2rCCACCGGTCCCACACTGCTTA212–232Race-3rGGTGACCTCCAGGAA274–288Race-4rCAGGTCCACACACACAGGCT164–183Race-5rCCTGTTCTGTGGCCTCCCAGT188–208Race-2fGGTGCTCTGGACATGCTGAC460–479Race-4fAAGATGATGGCCCTTGAGC481–499Race-5fCTGGATCGAATCCCACTTGG601–620The restriction enzyme cutting site in each sequence is shown in italic, and the initiation and stop codons are indicated in bold. The nucleotide positions correspond to those of the cDNA species isolated, and Race-1r through -5r and Race-2f through -5f were the primers used in the 5′-RACE and 3′-RACE, respectively. Open table in a new tab The restriction enzyme cutting site in each sequence is shown in italic, and the initiation and stop codons are indicated in bold. The nucleotide positions correspond to those of the cDNA species isolated, and Race-1r through -5r and Race-2f through -5f were the primers used in the 5′-RACE and 3′-RACE, respectively. The human counterpart was cloned by reverse transcription-PCR (RT-PCR). First-strand cDNA was prepared from human kidney mRNA (CLONTECH) using the SMART PCR library construction kit (CLONTECH) with the oligomer hu-1f as a cap finder and then was subjected to PCR with the primers hu-2f (with affinity to the cap-binding site of the single-strand cDNA) and the gene-specific primer, hu-3r. The hu-3r was designed to anneal the sequence outside the putative open reading frame based on a human Expressed Sequence Tag (EST) sequence similar to the mouse DCXR cDNA (see Table I). Finally, the open reading frame was amplified with a pair of primers, hu-4f and hu-5r, containing recognition sites for restriction enzymes for the later subcloning process. The cDNAs for rat, hamster, and guinea pig DCXRs were isolated from the total RNA preparations of rat kidney and livers of hamsters and guinea pigs by RT-PCR and subsequent RACE (rapid amplification of cDNA ends). The amplification of the cDNAs for the DCXRs of the three species by PCR was achieved with a set of primers, Expf and Expr, which correspond to nucleotides 1–18 and 717–735, respectively, of the cDNA for mouse DCXR. The 3′- and 5′-ends of the cDNAs were generated by using 3′- and 5′-RACE kits (Invitrogen, Carlsbad, CA) and the gene-specific primers (see Table I). The cDNAs were subcloned into the sequencing vector, pGEMT (Promega, Madison, WI) or pCR2.1 (Invitrogen) and sequenced as described above. To express the recombinant human and rodent DCXRs, the coding regions of the cDNAs were amplified by PCR using the following sets of primers containing restriction enzyme cutting sites (see Table I). The PCR primers were hu-Nf and hu-Kr (for human DCXR cDNA), ra-Nf and ha-Kr (for hamster DCXR cDNA), and ra-Nf and Expr (for other rodent DCXR cDNAs). Although the sequences of the primers were different by one or two nucleotides from those of the corresponding regions of the rodent DCXR cDNAs, the deduced amino acids were not changed. The amplified DNA fragments were digested with the restriction enzymes, then ligated into pRset plasmids. DNA sequencing confirmed that no unintended base substitution had been incorporated in the coding regions of the expression plasmids. Expression of the recombinant DCXRs in Escherichia coliBL21(DE3) (Stratagene, La Jolla, CA) and preparation of the cell extract were performed as described previously (14Nakanishi M. Deyashiki Y. Ohshima K. Hara A. Eur. J. Biochem. 1995; 228: 381-387Crossref PubMed Scopus (61) Google Scholar). The recombinant DCXRs were purified from the cell extract according to the procedures for purification of hamster liver diacetyl reductase (21Hara A. Seiriki K. Nakayama T. Sawada H. Flynn T.G. Weiner H. Enzymology of Carbonyl Metabolism 2: Aldehyde Dehydrogenase, Aldo-keto Reductase, and Alcohol Dehydrogenase. Alan R. Liss Inc., New York1985: 291-304Google Scholar), except that a Matrex Red A (Amicon, Beverly, MA) column was used instead of the Blue-Sepharose column. The adsorbed DCXR was eluted from the Matrex Red A column with buffer containing 0.5 mmNADP+. It should be noted that, because the activities of the recombinant rodent DCXRs were gradually inactivated below 10 °C, the chromatography was carried out at room temperature (RT, 20–25 °C), and the buffers were supplemented with 20% (v/v) glycerol to prevent cold inactivation. Recombinant MLCR and hamster sperm 26-kDa protein, P26h, were prepared as described in Refs. 14Nakanishi M. Deyashiki Y. Ohshima K. Hara A. Eur. J. Biochem. 1995; 228: 381-387Crossref PubMed Scopus (61) Google Scholar and22Ishikura S. Usami N. Kitahara K. Isaji T. Oda K. Nakagawa J. Hara A. Biochemistry. 2001; 40: 214-224Crossref PubMed Scopus (22) Google Scholar, respectively. Hamster liver diacetyl reductase was purified as described in Ref. 21Hara A. Seiriki K. Nakayama T. Sawada H. Flynn T.G. Weiner H. Enzymology of Carbonyl Metabolism 2: Aldehyde Dehydrogenase, Aldo-keto Reductase, and Alcohol Dehydrogenase. Alan R. Liss Inc., New York1985: 291-304Google Scholar. l-Xylulose reductase was purified from male Hartley guinea pig livers (50 g) essentially according to the same procedures employed for the purification of hamster diacetyl reductase. Since guinea pig l-xylulose reductase was also unstable at 4 °C, all the chromatography steps were performed at RT using the buffers containing 20% (v/v) glycerol, and the following modifications were made. 1) The enzyme was eluted from the DEAE-Sephacel column with 30 mm NaCl in 10 mmTris-HCl, pH 8.0, containing 1 mm EDTA and 2 mm2-mercaptoethanol after washing the column with buffer containing 10 mm NaCl. 2) The Blue-Sepharose column was washed with buffer A (10 mm Tris-HCl, pH 8.5, containing 2 mm 2-mercaptoethanol), and then the enzyme was eluted with buffer A containing 0.5 mm NADP+. The standard reaction mixture for the reductase activity consisted of 0.1 m potassium phosphate buffer, pH 6.0, 0.1 mm NADPH, substrate and enzyme, in a total volume of 2.0 ml. Diacetyl (5 mm) was employed as the substrate for DCXR and hamster liver diacetyl reductase, and 1 mm l-xylulose was used as the substrate for guinea pig liver l-xylulose reductase. The dehydrogenase activities of the enzymes were measured in 0.1 m potassium phosphate buffer, pH 7.0, containing 0.25 mmNADP+ and alcohol substrate. Sugars were obtained from Sigma-Aldrich (St. Louis, U.S.A.) and Fluka Chemie (Buchs, Switzerland), except that 3-deoxyglucosone was a gift from Dr. V. Monnier (Case Western Reserve University). One unit of enzyme activity was defined as the amount of enzyme that catalyzes the reduction and formation of 1 μmol of NADPH per min at 25 °C. A kinetic analysis of the enzyme reaction was carried out in 0.1m potassium phosphate buffer, pH 7.0, at five different concentrations of the substrate or coenzyme to obtain apparent Km and Vmax values. Kinetic studies in the presence of inhibitors were carried out in a similar manner. In addition to the kinetic constants, the inhibition constant,Ki, was calculated by using the appropriate programs of the ENZFITTER (Biosoft, Cambridge, UK). All standard errors of fits were less than 15%. Cold inactivation experiments were carried out as follows. The enzyme (0.4 mg/ml) was dialyzed against 0.1 m potassium phosphate buffer, pH 7.0, at 25 °C for 8 h, and then diluted with 9 volumes of the buffer containing 1 mg/ml bovine serum albumin. The enzyme solution was incubated in an ice bath or at various temperatures, and 50-μl aliquots of the solution were taken at different times and analyzed for the diacetyl reductase activity as described above. First-strand cDNAs were prepared from the total RNAs (1 μg samples) of mouse, rat, hamster, guinea pig and human tissues (Sawady, Tokyo, Japan) as described above. The cDNAs were subjected to PCR in a 20-μl reaction mixture containing Taq DNA polymerase (1 unit) and the following primers (1 μm). The forward and reverse primers for the amplification of rodent DCXR cDNAs were Expf and Expr, respectively, which did not amplify the cDNAs for MLCR and P26h, and the respective primers for that of human DCXR cDNA were hu-Nf and hu-Kr. cDNAs for human, mouse and rat β-actins were also amplified as internal controls with the specific primers that were obtained from Takara and Toyobo (Osaka, Japan). To prepare an antibody against murine DCXR, a peptide corresponding to positions 38–51 of the enzyme sequence was synthesized, conjugated to Keyhole Limpet Hemocyanin, and injected subcutaneously into rabbits (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). In addition, a polyclonal antibody against recombinant His-tag human DCXR was also raised in rabbits. To express the (His)6-tagged human DCXR, we amplified the cDNA insert using the primers, hu-4f and hu-5r (see Table I). The obtained PCR fragments were digested with the restriction enzymes, then ligated into expression plasmids, pTrcA (Invitrogen). The recombinant enzyme was expressed in E. coli BL21(DE3) cells, and purified using nickel nickel-nitrilotriacetic acid-agarose (Qiagen, Santa Clarita, CA) according to the manufacturer's instructions. The antibodies in the antisera were purified first on a protein-A column and subsequently with an affinity column cross-linked with the corresponding peptide or recombinant protein (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). The anti-mouse DCXR antibody specifically reacted with the mouse and rat DCXRs, whereas the anti-human DCXR antibody cross-reacted with the DCXRs of human and all the rodent species. The tissues of mice, rats, hamsters and guinea pigs were homogenized with 4 volumes of 0.25 m sucrose at 4 °C, and the homogenates were centrifuged at 105,000 × g for 1 h. The supernatant fractions (each comprising 20 μg of protein) and the other human tissue samples (each comprising 40 μg of protein, CLONTECH) were subjected to Western blot analysis (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) using the above antibodies The kidneys removed from Sprague-Dawley rats (20 weeks, male) and BALB/c mice (10 weeks, female) were fixed in neutralized 10% (v/v) formalin, embedded in paraffin, and sectioned at 3 μm. For immunohistochemistry, these sections were stained by the avidin-biotin-peroxidase complex method (23Hsu S.M. Raine L. Fanger H. Am. J. Clin. Pathol. 1981; 75: 816-821Crossref PubMed Scopus (901) Google Scholar). The primary and secondary biotinylated antibodies for DCXR staining were the anti-mouse DCXR antibody (10 μg/ml in PBS) and a goat anti-rabbit immunoglobulin (IgG) antibody (10 μg/ml, Vector Laboratories, Burlingame, CA), respectively. The sections were incubated with the primary antibody for 16 h at 4 °C, then with the secondary antibody for 1 h at RT, and with avidin-biotinylated peroxidase complex (Vector Laboratories) for 1 h. The peroxidase activity was visualized with the AEC Chromogen kit (Sigma Immunochemicals) and counterstained with hematoxylin. For immunofluorescence microscopy, the primary and secondary antibodies for DCXR staining were the same as those used in the immunohistochemistry. Subsequently the sections were incubated with Cy2-labeled streptavidin (100×, Amersham Biosciences, Inc., Buckinghamshire, UK) for 1 h. For double immunofluorescence microscopy, AGEs were stained using a mouse monoclonal anti-AGE antibody (2 μg/ml, Clone 6D12, Wako Pure Chemicals, Osaka, Japan) and Cy2-labeled goat anti-mouse IgG antibody (10 μg/ml, Amersham Biosciences, Inc.) as the primary and secondary antibodies, respectively, while DCXR was stained with the Cy3-labeled streptavidin (100×, Amersham Biosciences, Inc.). Stained sections were examined using the Axiolan2 microscope (Carl Zeiss, Jena, Germany). Under anesthetization with ether, C57BL/6 mice were flushed with PBS from the left ventricle to remove the blood, immediately perfused for fixation with 4% (w/v) paraformaldehyde and 0.2% (v/v) glutaraldehyde in 0.1 msodium cacodylate buffer, pH 7.3, for 30 min. The kidneys were dissected out and immersed in the same fixative for 1 h at 4 °C. The fixed samples were embedded in LR white resin. Then 70-nm Ultrathin sections were incubated at RT with the anti-mouse DCXR antibody (5 μg/ml in PBS) for 1.5 h, and subsequently with 10-nm gold-conjugated anti-rabbit IgG antibody (×50 dilution in 1% bovine serum albumin-Tris buffered saline, British Biocell International, Cardiff, UK) for 2 h. The sections were stained with uranyl acetate and examined by a transmission electron microscope, Model H-7500 (Hitachi, Tokyo, Japan). Control staining was conducted by using normal rabbit IgG (5 μg/ml). The protein concentration was determined by the method of Bradford (24Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar). SDS-PAGE on 12.5% (w/v) slab gels (25Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar) and analytical gel filtration on a Superdex 200 HR column (14Nakanishi M. Deyashiki Y. Ohshima K. Hara A. Eur. J. Biochem. 1995; 228: 381-387Crossref PubMed Scopus (61) Google Scholar, 22Ishikura S. Usami N. Kitahara K. Isaji T. Oda K. Nakagawa J. Hara A. Biochemistry. 2001; 40: 214-224Crossref PubMed Scopus (22) Google Scholar) were carried out as described previously. Protein sequence determination of the peptides derived by digestion of the purified liver enzymes with lysylendopeptidase was performed as described in Ref. 11Sato K. Inazu A. Yamaguchi S. Nakayama T. Deyashiki Y. Sawada H. Hara A. Arch. Biochem. Biophys. 1993; 307: 286-294Crossref PubMed Scopus (69) Google Scholar. In the initial stage of this study, the aim of the cloning scheme was to isolate genes potentially involved in the major renal functions or highly expressed in the kidney, in an attempt to screen potential renal therapeutic target genes. Therefore, candidate genes were screened from a cDNA library prepared from the tissue fractions enriched in glomeruli and renal tubules of C57BL/6 mouse kidney. The library was composed of relatively short 3′-directed DNA fragments (theoretical average size, 256 base pairs) generated by MboI digestion of the cDNA to ensure its non-biased complexity. Following large-scale DNA sequencing of about 1,000 cDNAs, the library was found to contain 958 clones, three of which were from a cDNA species that has not been reported. The cDNA contained a 735-bp open reading frame, in which a polypeptide of 244 amino acids with a molecular weight of 25,744 Da is encoded (Fig. 1). We designated the protein as DCXR based on its enzymatic characteristics described below. To investigate whether other mammalian kidneys contain DCXR, we analyzed sequences deposited in the EST division of the GenBankTM data base, and found several human (AF113123) and rat (AI16935 and BI283134) EST sequences similar to the cDNA for mouse DCXR. Because the human EST sequences corresponded to both 5′- and 3′-noncoding regions of the mouse DCXR cDNA, primers were designed to anneal the non-coding regions of human DCXR cDNA, and the cDNA (806 bp) was isolated by RT-PCR and RACE from the human kidney mRNA preparation. RT-PCR with the primers, Expf and Expr, amplified cDNA fragments of about 735-bp from the total RNA of rat kidney, and the sequence (879 bp) of the full-length cDNA for rat DCXR was determined by 3′- and 5′-RACE with the gene-specific primers (Table I). Eac
Referência(s)