Tissue-specific knockouts of ACAT2 reveal that intestinal depletion is sufficient to prevent diet-induced cholesterol accumulation in the liver and blood
2012; Elsevier BV; Volume: 53; Issue: 6 Linguagem: Inglês
10.1194/jlr.m024356
ISSN1539-7262
AutoresJun Zhang, Kathryn L. Kelley, Stephanie Marshall, Matthew A. Davis, Martha D. Wilson, Janet K. Sawyer, Robert V. Farese, J. Mark Brown, Lawrence L. Rudel,
Tópico(s)Peroxisome Proliferator-Activated Receptors
ResumoAcyl-CoA:cholesterol acyltransferase 2 (ACAT2) generates cholesterol esters (CE) for packaging into newly synthesized lipoproteins and thus is a major determinant of blood cholesterol levels. ACAT2 is expressed exclusively in the small intestine and liver, but the relative contributions of ACAT2 expression in these tissues to systemic cholesterol metabolism is unknown. We investigated whether CE derived from the intestine or liver would differentially affect hepatic and plasma cholesterol homeostasis. We generated liver-specific (ACAT2L−/L−) and intestine-specific (ACAT2SI−/SI−) ACAT2 knockout mice and studied dietary cholesterol-induced hepatic lipid accumulation and hypercholesterolemia. ACAT2SI−/SI− mice, in contrast to ACAT2L−/L− mice, had blunted cholesterol absorption. However, specific deletion of ACAT2 in the intestine generated essentially a phenocopy of the conditional knockout of ACAT2 in the liver, with reduced levels of plasma very low-density lipoprotein and hepatic CE, yet hepatic-free cholesterol does not build up after high cholesterol intake. ACAT2L−/L− and ACAT2SI−/SI− mice were equally protected from diet-induced hepatic CE accumulation and hypercholesterolemia. These results suggest that inhibition of intestinal or hepatic ACAT2 improves atherogenic hyperlipidemia and limits hepatic CE accumulation in mice and that depletion of intestinal ACAT2 is sufficient for most of the beneficial effects on cholesterol metabolism. Inhibitors of ACAT2 targeting either tissue likely would be beneficial for atheroprotection. Acyl-CoA:cholesterol acyltransferase 2 (ACAT2) generates cholesterol esters (CE) for packaging into newly synthesized lipoproteins and thus is a major determinant of blood cholesterol levels. ACAT2 is expressed exclusively in the small intestine and liver, but the relative contributions of ACAT2 expression in these tissues to systemic cholesterol metabolism is unknown. We investigated whether CE derived from the intestine or liver would differentially affect hepatic and plasma cholesterol homeostasis. We generated liver-specific (ACAT2L−/L−) and intestine-specific (ACAT2SI−/SI−) ACAT2 knockout mice and studied dietary cholesterol-induced hepatic lipid accumulation and hypercholesterolemia. ACAT2SI−/SI− mice, in contrast to ACAT2L−/L− mice, had blunted cholesterol absorption. However, specific deletion of ACAT2 in the intestine generated essentially a phenocopy of the conditional knockout of ACAT2 in the liver, with reduced levels of plasma very low-density lipoprotein and hepatic CE, yet hepatic-free cholesterol does not build up after high cholesterol intake. ACAT2L−/L− and ACAT2SI−/SI− mice were equally protected from diet-induced hepatic CE accumulation and hypercholesterolemia. These results suggest that inhibition of intestinal or hepatic ACAT2 improves atherogenic hyperlipidemia and limits hepatic CE accumulation in mice and that depletion of intestinal ACAT2 is sufficient for most of the beneficial effects on cholesterol metabolism. Inhibitors of ACAT2 targeting either tissue likely would be beneficial for atheroprotection. Acyl-CoA:cholesterol acyltransferase (ACAT), also known as sterol O-acyltransferase, is a microsomal protein responsible for intracellular cholesterol ester (CE) synthesis. ACAT typically uses monounsaturated fatty acids, such as oleate from the acyl-CoA pool together with free cholesterol (FC) as substrates. Two subtypes of ACAT exist: ACAT1 is expressed in a variety of tissues, and ACAT2 is expressed exclusively in enterocyte of the intestine and hepatocyte of the liver, where one of its roles is to generate CE for packaging into chylomicrons and very low-density lipoproteins (VLDLs), respectively (1.Joyce C. Skinner K. Anderson R.A. Rudel L.L. Acyl-coenzyme A:cholesteryl acyltransferase 2.Curr. Opin. Lipidol. 1999; 10: 89-95Crossref PubMed Scopus (68) Google Scholar). Cholesterol ester, especially cholesterol oleate, is one of the major components of atherosclerotic plaques and, when found in apoB-containing lipoproteins, may play a critical role in the pathogenesis of atherosclerosis (2.Degirolamo C. Shelness G.S. Rudel L.L. LDL cholesteryl oleate as a predictor for atherosclerosis: evidence from human and animal studies on dietary fat.J. Lipid Res. 2009; 50: S434-S439Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Deletion of ACAT2 in LDLr−/− mice led to a 78% decrease of aortic surface area as lesion and an 88% decrease in CE deposited in atherosclerotic plaques (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar). The proatherogenic effect of ACAT2-derived CE also was found in APOE−/− mice after ACAT2 was deleted, and atherosclerosis was almost absent (4.Willner E.L. Tow B. Buhman K.K. Wilson M. Sanan D.A. Rudel L.L. Farese Jr, R.V. Deficiency of acyl CoA:cholesterol acyltransferase 2 prevents atherosclerosis in apolipoprotein E-deficient mice.Proc. Natl. Acad. Sci. USA. 2003; 100: 1262-1267Crossref PubMed Scopus (154) Google Scholar). These data indicate a critical role of CE as a sensitive marker in atherosclerotic lesion development. In the past few years, the role of hepatic ACAT2 on cholesterol homeostasis has been extensively studied using an antisense oligonucleotide (ASO)-mediated knockdown in mice (5.Bell 3rd, T.A. Brown J.M. Graham M.J. Lemonidis K.M. Crooke R.M. Rudel L.L. Liver-specific inhibition of acyl-coenzyme a:cholesterol acyltransferase 2 with antisense oligonucleotides limits atherosclerosis development in apolipoprotein B100-only low-density lipoprotein receptor−/− mice.Arterioscler. Thromb. Vasc. Biol. 2006; 26: 1814-1820Crossref PubMed Scopus (68) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). ASO-mediated hepatic ACAT2 depletion resulted in the lack of hepatic CE production, reduced plasma total cholesterol and VLDL-cholesterol, decreased plasma CE, and increased plasma triglyceride (TG) concentration. These studies indicate that the lack of hepatic cholesterol esterification and the reduced CE secretion into VLDL, as also observed in total body ACAT2−/− mice, is atheroprotective. Intestinal ACAT2 determines how much cholesterol gets packaged into chylomicrons as CE and transported in lymph and plasma (8.Nguyen T.M. Sawyer J.K. Kelley K.L. Davis M.A. Rudel L.L. Cholesterol esterification by ACAT2 is essential for efficient intestinal cholesterol absorption: evidence from thoracic lymph duct cannulation.J. Lipid Res. 2012; 53: 95-104Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Isotopic tracer measurements revealed that the cholesterol absorption rates varied from 20% to 80% of total cholesterol (around 1,500 mg/day in humans) present in the lumen (9.Grundy S.M. Absorption and metabolism of dietary cholesterol.Annu. Rev. Nutr. 1983; 3: 71-96Crossref PubMed Scopus (208) Google Scholar). The majority of cholesterol delivered to the liver is esterified and resides in the core of chylomicron remnants. Nonspecific ACAT inhibitors have been shown to decrease cholesterol absorption by 20 to 80% in rats, hamsters, rabbits, pigs, and nonhuman primates (10.Heider J.G. Pickens C.E. Kelly L.A. Role of acyl CoA:cholesterol acyltransferase in cholesterol absorption and its inhibition by 57–118 in the rabbit.J. Lipid Res. 1983; 24: 1127-1134Abstract Full Text PDF PubMed Google Scholar, 11.Krause B.R. Anderson M. Bisgaier C.L. Bocan T. Bousley R. DeHart P. Essenburg A. Hamelehle K. Homan R. Kieft K. et al.In vivo evidence that the lipid-regulating activity of the ACAT inhibitor CI-976 in rats is due to inhibition of both intestinal and liver ACAT.J. Lipid Res. 1993; 34: 279-294Abstract Full Text PDF PubMed Google Scholar, 12.Lee H.T. Sliskovic D.R. Picard J.A. Roth B.D. Wierenga W. Hicks J.L. Bousley R.F. Hamelehle K.L. Homan R. Speyer C. et al.Inhibitors of acyl-CoA: cholesterol O-acyl transferase (ACAT) as hypocholesterolemic agents. CI-1011: an acyl sulfamate with unique cholesterol-lowering activity in animals fed noncholesterol-supplemented diets.J. Med. Chem. 1996; 39: 5031-5034Crossref PubMed Scopus (91) Google Scholar, 13.Ramharack R. Spahr M.A. Sekerke C.S. Stanfield R.L. Bousley R.F. Lee H.T. Krause B.K. CI-1011 lowers lipoprotein(a) and plasma cholesterol concentrations in chow-fed cynomolgus monkeys.Atherosclerosis. 1998; 136: 79-87Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar–14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). Whole body ACAT2−/− mice also have a 40% to 85% reduced level of cholesterol absorption (8.Nguyen T.M. Sawyer J.K. Kelley K.L. Davis M.A. Rudel L.L. Cholesterol esterification by ACAT2 is essential for efficient intestinal cholesterol absorption: evidence from thoracic lymph duct cannulation.J. Lipid Res. 2012; 53: 95-104Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 15.Buhman K.K. Accad M. Novak S. Choi R.S. Wong J.S. Hamilton R.L. Turley S. Farese Jr, R.V. Resistance to diet-induced hypercholesterolemia and gallstone formation in ACAT2-deficient mice.Nat. Med. 2000; 6: 1341-1347Crossref PubMed Scopus (296) Google Scholar–18.Turley S.D. Valasek M.A. Repa J.J. Dietschy J.M. Multiple mechanisms limit the accumulation of unesterified cholesterol in the small intestine of mice deficient in both ACAT2 and ABCA1.Am. J. Physiol. Gastrointest. Liver Physiol. 2010; 299: G1012-G1022Crossref PubMed Scopus (28) Google Scholar). Collectively, this implies that cholesterol esterification by intestinal ACAT2 plays an important role in regulating cholesterol sequestration for transport into the body. Although the blunted cholesterol absorption via intestinal ACAT2 inhibition is anticipated to be hypocholesterolemic, the specific contribution made by intestine-derived CE to whole body cholesterol homeostasis is still unclear. A nonselective deletion or inhibition of ACAT2 would be expected to render the maximal cholesterol-lowering effect as described above and is apparently due to a combined inhibitory effect on hepatic and intestinal ACAT2 activities. To design effective therapeutic strategies targeting ACAT2-driven cholesterol esterification, we believe it is critically important to understand the function of ACAT2 in the small intestine and liver. This prompted us to create tissue-specific ACAT2 knockout (KO) mouse models. The hypothesis tested herein is whether blocking the influx of cholesterol only from intestine, as expected from intestine-specific ACAT2 KO mice, would protect animals from hypercholesterolemia and tissue cholesterol accumulation to a similar extent as seen in liver-specific ACAT2 KO mice. Conditional targeting of the mouse ACAT2 gene was achieved as depicted in Fig. 1A. An ACAT2 targeting vector was constructed to introduce loxP sites upstream and downstream of exons 11 to 13, which contain active site residues necessary for enzyme catalysis. To generate this targeting vector, regions of homology were generated by PCR using genomic DNA from mouse liver (129S6/SvEv strain) as a template. Both the short and long arm of homology were then inserted into the targeting vector pJB1 (kindly provided by Joachim Herz, University of Texas Southwestern Medical Center), which contained the NEO gene driven by the murine phosphoglycerate kinase promoter, flanked by loxP and FRT sites, and followed by two copies of the herpes simplex virus thymidine kinase genes. This vector also contains FRT sites flanking the neomycin resistance gene, which facilitates removal of the NEO cassette by Flp recombinase. This construct was linearized by digestion with PmeI and electroporated into SvEv mouse-derived embryonic stem cells. The cells were seeded onto STO feeder layers for 24 h before the addition of G418 (250 μg/ml). Forty-eight hours after electroporation the cells were selected with gancyclovir (2.5 μM) for 8 to 10 days. The embryonic stem cell colonies were expanded and screened for homologous recombination by PCR and Southern blotting. Two positive clones were injected into C57BL/6N blastocysts. Five chimeric male and two chimeric female mice with >70% agouti coat color were fertile. Two chimeric males were capable of germline transmission of the ACAT2 floxed allele. These mice were originally bred to homozygosity, but the floxed allele with NEO cassette intact was severely hypomorphic (<10% normal hepatic ACAT activity), necessitating removal of the NEO cassette. To accomplish this, we bred ACAT2 floxed mice with transgenic mice expressing FLP1 recombinase [129S4-Gt(ROSA)26Sortm1(FLP1)Dym/RainJ] maintained on a 129S/SvJae background (Jackson Laboratory, Bar Harbor, ME). Once FLP1-mediated excision of the NEO cassette was confirmed by PCR, the FLP1 transgene was bred out of resulting ACAT2 floxed mice. When the FLP1 recombined allele was bred to homozygosity, it was confirmed that the hypomorphic allele had been rescued, given that ACAT2 protein and ACAT2 enzymatic activity was not significantly different from that of ACAT2 wild-type mice (data not shown). To generate intestine-specific and liver-specific ACAT2 knockout, mice with two ACAT2 floxed alleles were bred to mice transgenically expressing Cre recombinase under the villin promoter (B6.SJL-Tg(Vil-cre)997Gum/J) or albumin promoter (B6.Cg-Tg(Alb-cre)21Mgn/J), respectively. The Cre trangenics were purchased from Jackson Laboratory (Bar Harbor, ME). Genotyping was confirmed by PCR of genomic DNA using primers flanking the loxP site in intron 13–14 using the following primers (forward: 5′ CTGACCACAGAAAAGCATTTG ATCA 3′ reverse: 5′ AATCCGTATTGCTCAGTTTACCCCT 3′) and PCR conditions (Step 1: 93°C for 3 min; Step 2: 93°C for 30 s; Step 3: 60°C for 30 s; Step 4: 65°C for 2 min; repeat step 2 to 4 for 40 cycles). Liver-specific ACAT2 KO (ACAT2fl/fl/AlbCre+) are designated as ACAT2L−/L−, intestine-specific ACAT2 KO (ACAT2fl/fl/VilCre+) are designated as ACAT2SI−/SI−, and appropriate littermate controls (ACAT2fl/flAlbCre— or VilCre—) are designated as ACAT2fl/fl. Only female mice were included in the study having been bred on a mixed background as described above. At the age of 7 to 12 weeks, subgroups of mice were fed with a semisynthetic diet containing 20% of energy as lard and added cholesterol at levels of 0.05, 0.1, or 0.5% (wt/wt) for a total of 6 weeks. Blood was drawn at baseline, 3 weeks, and 6 weeks. Necropsies were performed in mice fasted from 9:00 AM until 1:00 PM as previously described (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). All mice used in the studies were housed in a pathogen-free barrier facility at Wake Forest University School of Medicine with the approval of the American Association for Accreditation of Laboratory Animal Care. The Institutional Animal Care and Use Committee approved all protocols before execution of the studies. Total plasma cholesterol (TPC) and TG concentrations were measured using colorimetric assay as previously described (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). Cholesterol distribution was quantified by FPLC as previously described (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). Microsomal proteins (25 μg/lane of liver and 15 μg/lane of intestine) were separated by 4 to 12% SDS-PAGE Tris-glycine gel, transferred to nitrocellulose membranes, and incubated with anti-ACAT2 rabbit polyclonal (19.Lee R.G. Willingham M.C. Davis M.A. Skinner K.A. Rudel L.L. Differential expression of ACAT1 and ACAT2 among cells within liver, intestine, kidney, and adrenal of nonhuman primates.J. Lipid Res. 2000; 41: 1991-2001Abstract Full Text Full Text PDF PubMed Google Scholar) or anti-BiP rabbit polyclonal antibodies (Stressgen Biotechnologies Corp., Canada) as described previously (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). ACAT activity was quantified by methods previously published (20.Parini P. Davis M. Lada A.T. Erickson S.K. Wright T.L. Gustafsson U. Sahlin S. Einarsson C. Eriksson M. Angelin B. et al.ACAT2 is localized to hepatocytes and is the major cholesterol-esterifying enzyme in human liver.Circulation. 2004; 110: 2017-2023Crossref PubMed Scopus (168) Google Scholar, 21.Rudel L.L. Haines J. Sawyer J.K. Shah R. Wilson M.S. Carr T.P. Hepatic origin of cholesteryl oleate in coronary artery atherosclerosis in African green monkeys. Enrichment by dietary monounsaturated fat.J. Clin. Invest. 1997; 100: 74-83Crossref PubMed Scopus (67) Google Scholar). Briefly, an aliquot of liver and small intestine segment 2 were homogenized in ACAT homogenization buffer in the presence of protease inhibitor cocktail. The microsomes were isolated, and the ACAT assays were performed in the absence and presence of 0.1 mM pyripyropene A, an ACAT2-specific inhibitor, so that ACAT1 and ACAT2 activities could be calculated from total ACAT activity. Relative ACAT enzyme activity was expressed as nmol CE synthesized per mg microsomal protein per min (nmol/mg/min). During the fourth week of diet treatment, all mice were gavaged with 50 μl soybean oil containing [14C]cholesterol and β-[3H]sitosterol. Fractional cholesterol absorption and fecal neutral sterol loss were quantified using previously published methods (6.Brown J.M. Bell 3rd, T.A. Alger H.M. Sawyer J.K. Smith T.L. Kelley K. Shah R. Wilson M.D. Davis M.A. Lee R.G. et al.Targeted depletion of hepatic ACAT2-driven cholesterol esterification reveals a non-biliary route for fecal neutral sterol loss.J. Biol. Chem. 2008; 283: 10522-10534Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). Extraction of biliary, intestinal, and liver lipids for enzymatic quantification of total triglyceride, cholesteryl esters, FC, phospholipids, and bile acids were performed as previously described (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar). During necropsy, small intestine was flushed thoroughly with saline. The entire intestine was folded and cut into four equal length segments. Only segment 2 was used for cholesterol assay. Tissue RNA extraction and quantitative PCR was conducted as previously described (3.Lee R.G. Kelley K.L. Sawyer J.K. Farese Jr, R.V. Parks J.S. Rudel L.L. Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite atherosclerotic potential.Circ. Res. 2004; 95: 998-1004Crossref PubMed Scopus (100) Google Scholar–7.Alger H.M. Brown J.M. Sawyer J.K. Kelley K.L. Shah R. Wilson M.D. Willingham M.C. Rudel L.L. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.J. Biol. Chem. 2010; 285: 14267-14274Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 14.Suckling K.E. Stange E.F. Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J. Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar) using the applied biosystems 7500 Real-Time PCR System. Primer sequences used for quantitative PCR are available on request. All graphs were plotted by GraphPad Prism 5.05. Data were analyzed by ANOVA with Tukey post hoc test. Statistically significant differences were considered at P < 0.05. Initial studies indicated that homozygous floxed mice (ACAT2fl/fl) that had been crossed with FLP-1 expressing mice had similar ACAT2 protein and activity as wild-type mice (ACAT2WT/WT; data not shown). For tissue-specific ACAT2 knockouts, intercrosses of heterozygotes (ACAT2WT/fl) yielded the expected 25% homozygotes. Both the ACAT2L−/L− and ACAT2SI−/SI− mice developed normally, were fertile, and exhibited normal body weight when fed rodent chow or a cholesterol-enriched diet. ACAT2 protein in ACAT2L−/L− mice was undetectable in the liver but was expressed at normal levels in the intestine compared with the ACAT2fl/fl mice (Fig. 1B). Hepatic ACAT2 activity was reduced by 99.7% in ACAT2L−/L− mice compared with ACAT2fl/fl mice (Fig. 1C). As anticipated, this pattern was opposite in ACAT2SI−/SI− mice, where ACAT2 protein was not detected in the small intestine, whereas hepatic ACAT2 was unaltered in ACAT2SI−/SI− mice (Fig. 1B). Intestinal ACAT2 activity was decreased by 95.6% compared with ACAT2fl/fl mice (Fig. 1C). ACAT2fl/fl mice had a stepwise decrease of percentage cholesterol absorption in response to increased dietary cholesterol (Fig. 2A). ACAT2L−/L− mice did not have significantly different percentage absorption values compared with control mice at any dietary cholesterol level (Fig. 2A). However, significantly decreased levels of cholesterol absorption were observed in ACAT2SI−/SI− mice for each different dietary cholesterol level when compared with control and ACAT2L−/L− mice (Fig. 2A). ACAT2fl/fl mice had a stepwise increase in fecal sterol loss that occurred to similar levels as that of ACAT2L−/L− mice (Fig. 2B). ACAT2SI−/SI− mice had significantly more fecal sterol loss at 0.05% and 0.1% dietary cholesterol levels, but values were comparable at the 0.5% cholesterol level when compared with ACAT2fl/fl control mice (Fig. 2B). After consuming the experimental diets for 6 weeks, ACAT2L−/L− mice had significantly higher concentrations of plasma TG at any given dietary cholesterol level compared with ACAT2fl/fl mice (Fig. 3A). An increased level of plasma TG also was observed in ACAT2SI−/SI− mice when fed with 0.05% and 0.5% (wt/wt) cholesterol diet (Fig. 3A). ACAT2L−/L− mice had a lower level of TPC on 0.05% cholesterol diet (Fig. 3B). The difference was presumably due to the reduction of LDL-C when compared with the response in ACAT2fl/fl mice (Fig. 3C). TPC was not different among three genotypes of mice when the mice were fed the 0.1% cholesterol diet (Fig. 3B). After being fed the 0.5% cholesterol diet for 6 weeks, conditional KO mice had decreased levels of TPC compared with control mice (Fig. 3B). Cholesterol distribution by FPLC indicated that VLDL-C was significantly reduced among ACAT2L−/L− and ACAT2SI−/SI− mice after consuming 0.1% and 0.5% cholesterol diet for 6 weeks (Fig. 3D). There was no effect of diet or genotype on HDL cholesterol levels (Fig. 3E). Liver weight and body weight were not different among experimental animals at the time of necropsy (Fig. 4A). ACAT2fl/fl mice had a stepwise increase of hepatic total cholesterol (TC) (Fig. 4B) and CE (Fig. 4C) in response to increased dietary cholesterol. In contrast, ACAT2L−/L− and ACAT2SI−/SI− mice had only modest levels of TC and CE at any given dietary cholesterol level (Fig. 4B, C). Interestingly, hepatic TC and CE levels were reduced to strikingly similar concentrations in ACAT2L−/L− and ACAT2SI−/SI− mice regardless of dietary cholesterol levels. Hepatic free cholesterol (FC) was not different among three genotypes when fed with 0.05% and 0.1% dietary cholesterol (Fig. 4D). However, ACAT2L−/L− and ACAT2SI−/SI− mice had significantly lower levels of FC in the liver on the 0.5% cholesterol diet, although it was the same as in other dietary groups (Fig. 4D). The average for hepatic TG was slightly lower in both groups of KO mice fed 0.1% dietary cholesterol compared with the level of TG in the ACAT2fl/fl mice. The TG concentration differences were statistically significant when ACAT2L−/L− and ACAT2SI−/SI− mice consumed 0.5% dietary cholesterol (Fig. 4E). Phospholipid concentrations were not significantly different at any level of dietary cholesterol feeding for any of the genotypes (Fig. 4F). After dietary cholesterol intake, all the experimental mice had similar intestine weights, represented by segment 2 in Fig. 5A. ACAT2SI−/SI− mice appeared to have slightly increased levels of TC in the intestine in response to increasing levels of dietary cholesterol (Fig. 5B), although only the intestine of ACAT2SI−/SI− mice had significantly higher concentrations of TC after 6 weeks of consumption of 0.5% dietary cholesterol compared with that of control mice (Fig. 5B). When the mice had no intestinal ACAT2, CE concentrations of intestine were significantly lower at all levels of dietary cholesterol intake compared with control and ACAT2L−/L− mice (Fig. 5C). Intestinal FC was significantly increased in ACAT2SI−/SI− mice fed 0.5% dietary cholesterol (Fig. 5D). However, no difference in FC was observed among animals of either genotype fed diets with 0.05% or 0.1% cholesterol. In response to cholesterol feeding, ACAT2fl/fl mice tend to have a small increase of biliary cholesterol, although the dietary effect was not statistically significant (Fig. 6A). ACAT2L−/L− mice had similar level of biliary cholesterol compared with control mice (Fig. 6A). In contrast, ACAT2SI−/SI− mice had significantly lower levels of biliary cholesterol with no evidence of a response to increasing dietary cholesterol compared with ACAT2fl/fl and ACAT2L−/L− mice. There was no dietary or genotype difference in biliary phospholipids and total bile acid among the animals (Fig. 6B, C). Previous ACAT2 ASO studies (5.Bell 3rd, T.A. Brown J.M. Graham M.J. Lemonidis K.M. Crooke R.M. Rudel L.L. Liver-specific inhibition of acyl-coenzyme a:cholesterol a
Referência(s)