Portal de Periódicos da CAPES

The NF-κB Signaling Pathway Is Not Required for Fas Ligand Gene Induction but Mediates Protection from Activation-induced Cell Death

2000; Elsevier BV; Volume: 275; Issue: 33 Linguagem: Inglês

10.1074/jbc.m000444200

1083-351X

Isis Rivera-Walsh, Mary Ellen Cvijic, Gutian Xiao, Shao‐Cong Sun,

Immune Response and Inflammation

Stimulation of T cells by antigens or mitogens triggers multiple signaling pathways leading to activation of genes encoding interleukin-2 and other growth-regulatory cytokines. The same stimuli also activate the gene encoding an apoptosis-inducing molecule, Fas ligand (FasL), which contributes to activation-induced cell death. It has been proposed that the signaling pathways involved in cytokine gene induction also contribute to activation-induced FasL expression; however, genetic evidence for this proposal is lacking. In the present study, the role of the NF-κB signaling pathway in FasL gene expression was examined using a mutant T cell line deficient in an essential NF-κB signaling component, IκB kinase γ. These mutant cells have a blockade in signal-induced activation of NF-κB but remained normal in the activation of NF-AT and AP-1 transcription factors. Interestingly, the NF-κB signaling defect has no effect on mitogen-stimulated FasL gene expression, although it completely blocks the interleukin-2 gene induction. We further demonstrate that NF-κB activation is required for protecting T cells from apoptosis induction by mitogens and an agonistic anti-Fas antibody. These genetic results suggest that the NF-κB signaling pathway is not required for activation-induced FasL expression but rather mediates cell growth and protection from activation-induced cell death. Stimulation of T cells by antigens or mitogens triggers multiple signaling pathways leading to activation of genes encoding interleukin-2 and other growth-regulatory cytokines. The same stimuli also activate the gene encoding an apoptosis-inducing molecule, Fas ligand (FasL), which contributes to activation-induced cell death. It has been proposed that the signaling pathways involved in cytokine gene induction also contribute to activation-induced FasL expression; however, genetic evidence for this proposal is lacking. In the present study, the role of the NF-κB signaling pathway in FasL gene expression was examined using a mutant T cell line deficient in an essential NF-κB signaling component, IκB kinase γ. These mutant cells have a blockade in signal-induced activation of NF-κB but remained normal in the activation of NF-AT and AP-1 transcription factors. Interestingly, the NF-κB signaling defect has no effect on mitogen-stimulated FasL gene expression, although it completely blocks the interleukin-2 gene induction. We further demonstrate that NF-κB activation is required for protecting T cells from apoptosis induction by mitogens and an agonistic anti-Fas antibody. These genetic results suggest that the NF-κB signaling pathway is not required for activation-induced FasL expression but rather mediates cell growth and protection from activation-induced cell death. T cell receptor interleukin-2 Fas ligand activation-induced cell death nuclear factor of activated T cells activator protein 1 nuclear factor κB IκB kinase green fluorescence protein fluorescein isothiocyanate propidium iodide RNase protection assay enzyme-linked immunosorbent assay phorbol 12-myristate 13-acetate reverse transcription polymerase chain reaction hemaglutinin electrophoretic mobility shift assay nuclear localization signal Stimulation of T cells via the T cell receptor (TCR)1 and the CD28 costimulatory molecule triggers a cascade of signaling events that lead to transcriptional expression of genes encoding interleukin-2 (IL-2) and many other cytokines involved in T cell proliferation and differentiation (for reviews see Refs. 1Fraser J.D. Straus D. Weiss A. Immunol. Today. 1993; 14: 356-362Abstract Full Text PDF Scopus (145) Google Scholar, 2Linsley P.S. Ledbetter J.A. Annu. Rev. Immunol. 1993; 11: 191-212Crossref PubMed Scopus (1237) Google Scholar, 3Crabtree G.R. Clipstone N.A. Annu. Rev. Biochem. 1994; 63: 1054-1083Crossref Scopus (627) Google Scholar). Additionally, the T cell activation program also involves induction of genes mediating activation-induced cell death (AICD), a mechanism required for the maintenance of immune cell homeostasis (4Russell J.H. Curr. Opin. Immunol. 1995; 7: 382-388Crossref PubMed Scopus (234) Google Scholar, 5Lenardo M. Chan K.M. Hornung F. McFarland H. Siegel R. Wang J. Zheng L. Annu. Rev. Immunol. 1999; 17: 221-253Crossref PubMed Scopus (849) Google Scholar). A major gene mediating AICD is Fas ligand (FasL) (6Dhein J. Walczak H. Baumler C. Debatin K.M. Krammer P.H. Nature. 1995; 373: 438-441Crossref PubMed Scopus (1609) Google Scholar, 7Brunner T. Mogil R.J. LaFace D. Yoo N.J. Mahboubi A. Echeverri F. Martin S.J. Force W.R. Lynch D.H. Ware C.F. Green D.R. Nature. 1995; 373: 441-444Crossref PubMed Scopus (1272) Google Scholar, 8Ju S.T. Panka D.J. Cui H. Ettinger R. El-Khatib M. Sherr D.H. Stanger B.Z. Marshak-Rothstein A. Nature. 1995; 373: 444-448Crossref PubMed Scopus (1456) Google Scholar), a member of the tumor necrosis factor family (9Suda T. Takahashi T. Golstein P. Nagata S. Cell. 1993; 75: 1169-1178Abstract Full Text PDF PubMed Scopus (2450) Google Scholar). FasL specifically interacts with its cognate receptor, Fas, thereby triggering a cascade of proteolytic events resulting in the death of Fas-expressing cells (10Nagata S. Cell. 1997; 88: 355-365Abstract Full Text Full Text PDF PubMed Scopus (4561) Google Scholar, 11Hetts S.W. J. Am. Med. Assoc. 1998; 279: 300-307Crossref PubMed Scopus (473) Google Scholar). The importance of Fas-mediated apoptosis is evidenced by studies using the lpr andgld mice that harbor inactivating mutations in the Fas and FasL genes, respectively (12Watanabe-Fukunaga R. Brannan C.I. Copeland N.G. Jenkins N.A. Nagata S. Nature. 1992; 356: 314-317Crossref PubMed Scopus (2737) Google Scholar, 13Takahashi T. Tanaka M. Brannan C.I. Jenkins N.A. Copeland N.G. Suda T. Nagata S. Cell. 1994; 76: 969-976Abstract Full Text PDF PubMed Scopus (1474) Google Scholar). These mice suffer a severe lymphoproliferative disorder and die shortly after birth because of an excessive accumulation of lymphocytes in addition to autoimmune diseases. In T cells and many other cell types, expression of FasL is subject to strict regulation whereas expression of Fas is largely constitutive (9Suda T. Takahashi T. Golstein P. Nagata S. Cell. 1993; 75: 1169-1178Abstract Full Text PDF PubMed Scopus (2450) Google Scholar, 14Watanabe-Fukunaga R. Brannan C.I. Itoh N. Yonehara S. Copeland N.G. Jenkins N.A. Nagata S. J. Immunol. 1992; 148: 1274-1279PubMed Google Scholar, 15Brunner T. Yoo N.J. Griffith T.S. Ferguson T.A. Green D.R. Behring. Inst. Mitt. 1996; 97: 161-174PubMed Google Scholar). Therefore, a large effort has been made to the understanding of how the FasL gene is activated by T cell activation signals. Sequence analysis of the upstream region of FasL gene has revealed potential binding sites for a number of transcription factors known to participate in IL-2 gene regulation. These include the nuclear factor of activated T cells (NF-AT) (16Latinis K.M. Norian L.A. Eliason S.L. Koretzky G.A. J. Biol. Chem. 1997; 272: 31427-31434Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 17Holtz-Heppelmann C.J. Algeciras A. Badley A.D. Paya C.V. J. Biol. Chem. 1998; 273: 4416-4423Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), activator protein-1 (AP-1) (18Kasibhatla S. Brunner T. Genestier L. Echeverri F. Mahboubi A. Green D.R. Mol. Cell. 1998; 1: 543-551Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar,19Faris M. Latinis K.M. Kempiak S.J. Koretzky G.A. Nel A. Mol. Cell. Biol. 1998; 18: 5414-5424Crossref PubMed Google Scholar), and nuclear factor κB (NF-κB) (20Kasibhatla S. Genestier L. Green D.R. J. Biol. Chem. 1999; 274: 987Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 21Kassim O.O. Richards C.S. Exp. Parasit. 1978; 46: 218-224Crossref PubMed Scopus (7) Google Scholar, 22Matsui K. Fine A. Zhu B. Marshak-Rothstein A. Ju S.T. J. Immunol. 1998; 161: 3469-3473PubMed Google Scholar). The physiological role of NF-AT in activation-induced FasL gene expression has been demonstrated through both biochemical and genetic studies (16Latinis K.M. Norian L.A. Eliason S.L. Koretzky G.A. J. Biol. Chem. 1997; 272: 31427-31434Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 17Holtz-Heppelmann C.J. Algeciras A. Badley A.D. Paya C.V. J. Biol. Chem. 1998; 273: 4416-4423Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar,23Latinis K.M. Carr L.I. Peterson E.J. Norian L.A. Eliason S.L. Koretzky G.A. J. Immunol. 1997; 158: 4602-4611PubMed Google Scholar, 24Hodge M.R. Ranger A.M. de la Braousse F.C. Hoey T. Grusby M.J. Glimcher L.H. Immunity. 1996; 4: 397-405Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar, 25Ranger A.M. Oukka M. Rengarajan J. Glimcher L.H. Immunity. 1998; 9: 627-635Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar). Mutation of the NF-AT binding sites in FasL promoter completely blocks the inducible transcription from this promoter (16Latinis K.M. Norian L.A. Eliason S.L. Koretzky G.A. J. Biol. Chem. 1997; 272: 31427-31434Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar,26Rivera I. Harhaj E.W. Sun S.-C. J. Biol. Chem. 1998; 273: 22382-22387Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Consistently, germ line inactivation of the NF-ATp gene in mice largely blocked FasL gene induction by TCR signals (24Hodge M.R. Ranger A.M. de la Braousse F.C. Hoey T. Grusby M.J. Glimcher L.H. Immunity. 1996; 4: 397-405Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar, 25Ranger A.M. Oukka M. Rengarajan J. Glimcher L.H. Immunity. 1998; 9: 627-635Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar). On the other hand, the role of AP-1 and NF-κB in FasL gene regulation remains elusive. Promoter truncation studies reveal that removal of the promoter distal region of FasL gene, which contains the binding sites for AP-1 and NF-κB, has no effect on the inducibility of the FasL promoter (16Latinis K.M. Norian L.A. Eliason S.L. Koretzky G.A. J. Biol. Chem. 1997; 272: 31427-31434Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 23Latinis K.M. Carr L.I. Peterson E.J. Norian L.A. Eliason S.L. Koretzky G.A. J. Immunol. 1997; 158: 4602-4611PubMed Google Scholar). In contrast, other studies using promoter mutation and NF-κB overexpression approaches suggest that NF-κB plays a critical role in FasL promoter induction by T cell activation agents (20Kasibhatla S. Genestier L. Green D.R. J. Biol. Chem. 1999; 274: 987Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 27Hsu S.C. Gavrilin M.A. Lee H.H. Wu C.C. Han S.H. Lai M.Z. Eur. J. Immunol. 1999; 29: 2948-2956Crossref PubMed Google Scholar). These latter findings suggest a proapoptotic role of NF-κB in AICD, as opposed to its well known antiapoptotic function in many other systems (28Van Antwerp D. Martin S.J. Kafri T. Green D.R. Verma I.M. Science. 1996; 274: 787-789Crossref PubMed Scopus (2452) Google Scholar, 29Wang C.-Y. Mayo M.W. Baldwin Jr., A.S. Science. 1996; 274: 784-787Crossref PubMed Scopus (2515) Google Scholar, 30Beg A.A. Baltimore D. Science. 1996; 274: 782-784Crossref PubMed Scopus (2940) Google Scholar, 31Bellas R.E. FitzGerald M.J. Fausto N. Sonenshein G.E. Am. J. Pathol. 1997; 151: 891-896PubMed Google Scholar, 32Guo Q. Robinson N. Mattson M.P. J. Biol. Chem. 1998; 273: 12341-12351Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 33Doi T.S. Marino M.W. Takahashi T. Yoshida T. Sakakura T. Old L.J. Obata Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2994-2999Crossref PubMed Scopus (262) Google Scholar, 34Li Q. Van Antwerp D. Mercurio F. Lee K.F. Verma I.M. Science. 1999; 284: 321-325Crossref PubMed Scopus (857) Google Scholar). However, genetic evidence for a role of NF-κB in the induction of either FasL gene expression or AICD is currently lacking. NF-κB represents a family of transcription factors that regulate a large variety of genes involved in the immune and inflammatory responses (35Gilmore T.D. Oncogene. 1999; 18: 6842-6844Crossref PubMed Scopus (355) Google Scholar). One of the well studied NF-κB target genes in T cells is IL-2 (36Hoyos B. Ballard D.W. Böhnlein E. Siekevitz M. Greene W.C. Science. 1989; 244: 457-460Crossref PubMed Scopus (230) Google Scholar), which plays a critical role in the clonal expansion of antigen-stimulated T cells. In unstimulated T cells, NF-κB is sequestered in the cytoplasm by inhibitors, including IκBα, IκBβ, and related proteins (37Baldwin Jr., A.S. Annu. Rev. Immunol. 1996; 14: 649-683Crossref PubMed Scopus (5592) Google Scholar). T cell activation agents and inflammatory cytokines stimulate site-specific phosphorylation and subsequent proteolysis of IκBs, which allows the released NF-κB to move to the nucleus and transactivate its target genes (38Verma I.M. Stevenon J.K. Schwarz E.M. Antwerp D.V. Miyamoto S. Genes Dev. 1995; 9: 2723-2735Crossref PubMed Scopus (1665) Google Scholar, 39Karin M. Oncogene. 1999; 18: 6867-6874Crossref PubMed Scopus (1012) Google Scholar). Recently, the protein kinase mediating signal-induced IκB phosphorylation has been identified and named IκB kinase (IKK) (39Karin M. Oncogene. 1999; 18: 6867-6874Crossref PubMed Scopus (1012) Google Scholar). The IKK holoenzyme is composed of two catalytic subunits, IKKα and IKKβ (40Regnier C.H. Song H.Y. Cao Z. Rothe M. Cell. 1997; 90: 373-383Abstract Full Text Full Text PDF PubMed Scopus (1072) Google Scholar, 41DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1917) Google Scholar, 42Woronicz J.D. Gao X. Cao Z. Rothe M. Goeddel D.V. Science. 1997; 278: 866-869Crossref PubMed Scopus (1068) Google Scholar, 43Zandi E. Rothwarf D.M. Delhase M. Hayakawa M. Karin M. Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1595) Google Scholar, 44Mercurio F. Zhu H. Murray B.W. Shevchenko A. Bennett B.L. Li J.W. Young D.B. Barbose M. Mann M. Manning A. Rao A. Science. 1997; 278: 860-865Crossref PubMed Scopus (1855) Google Scholar), and a regulatory subunit, IKKγ (also named NEMO, IKKAP1, or FIP-3) (45Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (951) Google Scholar, 46Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 17: 297-300Crossref Scopus (853) Google Scholar, 47Mercurio F. Murray B.W. Shevchenko A. Bennett B.L. Young D.B. Li J.W. Pascual G. Motiwala A. Zhu H. Mann M. Manning A.M. Mol. Cell. Biol. 1999; 19: 1526-1538Crossref PubMed Google Scholar, 48Li Y. Kang J. Friedman J. Tarassishin L. Ye J. Kovalenko A. Wallach D. Horwitz M.S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1042-1047Crossref PubMed Scopus (157) Google Scholar). Although purified recombinant IKKα and IKKβ can directly phosphorylate IκBs in vitro (47Mercurio F. Murray B.W. Shevchenko A. Bennett B.L. Young D.B. Li J.W. Pascual G. Motiwala A. Zhu H. Mann M. Manning A.M. Mol. Cell. Biol. 1999; 19: 1526-1538Crossref PubMed Google Scholar,49Lee F.S. Peters R.T. Dang L.C. Maniatis T. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9319-9324Crossref PubMed Scopus (359) Google Scholar, 50Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar, 51Li J. Peet G.W. Pullen S.S. Schembri-King J. Warren T.C. Marcu K.B. Kehry M.R. Barton R. Jakes S. J. Biol. Chem. 1998; 273: 30736-30741Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), signal-induced IKK activation in vivo critically requires IKKγ (45Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (951) Google Scholar). By somatic mutagenesis, we have isolated a T cell line that lacks IKKγ and is, therefore, completely defective in NF-κB signaling (52Harhaj E.W. Good L. Xiao G.-T. Uhlik M. Cvijic M.E. Rivera I. Sun S.-C. Oncogene. 2000; 19: 1386-1391Crossref PubMed Scopus (92) Google Scholar). Using this NF-κB-defective T cell line, we investigated the role of NF-κB in the FasL gene induction and activation-induced apoptosis. We show that the NF-κB signaling defect has no appreciable effect on mitogen-stimulated expression of FasL mRNA or activation of the FasL promoter. In sharp contrast, the NF-κB signaling defect is associated with a blockade of signal-induced IL-2 gene expression. We further show that activation of NF-κB is not required for AICD but rather confers protection of T cells from undergoing apoptosis. SVT35 is a Jurkat cell line stably transfected with a CD14 reporter gene driven by eight copies of κB enhancers (kindly provided by Dr. Brian Seed; Ref. 53Ting A.T. Pimentel-Muinos F.X. Seed B. EMBO J. 1996; 15: 6189-6196Crossref PubMed Scopus (471) Google Scholar). JM4.5.2 is a mutant form of SVT35 generated by somatic mutagenesis (52Harhaj E.W. Good L. Xiao G.-T. Uhlik M. Cvijic M.E. Rivera I. Sun S.-C. Oncogene. 2000; 19: 1386-1391Crossref PubMed Scopus (92) Google Scholar). The JM4.5.2 cells lack expression of IKKγ and, therefore, are defective in NF-κB activation. JM4.5.2-IKKγ #8 and JM4.5.2-IKKγ #10 are stable cell lines created by retroviral-mediated gene transfer of IKKγ into JM4.5.2 cells. JM4.5.2-GFP is a control cell line created by infection of JM4.5.2 cells with a retroviral vector encoding the GFP. These Jurkat T cell lines were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mml-glutamine, 50 units/ml of penicillin, and 50 μg of streptomycin. The GFP- and IKKγ-expressing stable cell clones were periodically cultured for 2-week intervals in the RPMI medium containing 1.0 mg/ml G418 for selection of the transgene. Human 293 embryonic kidney cells were cultured in Dulbecco's medium supplemented with 10% fetal bovine serum, 2 mml-glutamine, and antibiotics. Phorbol 12-myristate 13-acetate (PMA) and ionomycin were purchased from Sigma and used at concentrations of 10 ng/ml and 1 μm, respectively. The monoclonal antibody for human CD28 (anti-CD28) was kindly provided by the Fred Hutchinson Cancer Research Center and used at a 1:10,000 dilution. The anti-Fas antibody (CH11) was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). The anti-IκBα antiserum was described previously (54Sun S.-C. Ganchi P.A. Ballard D.W. Greene W.C. Science. 1993; 259: 1912-1915Crossref PubMed Scopus (958) Google Scholar). The anti-IKKγ antibody (F1–419) and the FITC-conjugated annexin V (annexin-FITC) were purchased from Santa Cruz, Inc. (Santa Cruz, CA) and Roche Molecular Biochemicals, respectively. The luciferase reporter driven by 1.2 kilobases of the human FasL gene promoter (FasL-Luc) was provided by Dr. Douglas R. Green (18Kasibhatla S. Brunner T. Genestier L. Echeverri F. Mahboubi A. Green D.R. Mol. Cell. 1998; 1: 543-551Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar). The AP1-Luc construct was provided by Dr. Richard Niles (55Desai S.H. Niles R.M. J. Biol. Chem. 1997; 272: 12809-12815Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar). The NF-AT-Luc, κB-Luc, and IL-2-Luc constructs have been previously described (26Rivera I. Harhaj E.W. Sun S.-C. J. Biol. Chem. 1998; 273: 22382-22387Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 56Good L. Maggirwar S.B. Sun S.-C. EMBO J. 1996; 15: 3744-3750Crossref PubMed Scopus (66) Google Scholar). The retroviral vector pCLXSN and the packaging plasmid pCL-Ampho were provided by Dr. Inder Verma (57Naviaux R.N. Costanzi E. Haas M. Verma I.M. J. Virol. 1996; 70: 5701-5705Crossref PubMed Google Scholar). The pCLXSN-GFP was created by subcloning jellyfish GFP to the pCLXSN vector. To generate pCLXSN-IKKγ, the human IKKγ cDNA was cloned by reverse transcription-polymerase chain reaction (RT-PCR) from Jurkat cells, fused with one copy of the hemaglutinin (HA) epitope tag, and inserted into the pCLXSN vector. Human 293 cells were seeded at a density of 2 × 105 cells/well in a 6-well dish. The next day, cells were transfected using Fugene reagent (Roche Molecular Biochemicals) with 1 μg of the retroviral packaging plasmid pCL-Ampho together with 1 μg of either pCLXSN-IKKγ or pCLXSN-GFP. 48 h post-transfection, the viral supernatants were collected, filtered through a 0.45-μm polysulfone filter, and used to infect JM4.5.2 cells. Briefly, 1 × 106 JM4.5.2 cells were resuspended in 2 ml of viral supernatant in 8 μg/ml polybrene, placed in a 6-well plate, and spun in a microtiter rotor at 1800 rpm for 45 min at room temperature. 48 h post-infection, the infected cells were placed under limiting dilution in a 96-well dish and selected for stable transduction using 1 mg/ml G418. Individual JM4.5.2-IKKγ clones were identified by immunoblotting analysis of HA-IKKγ and NF-κB activation assays. JM4.5.2-GFP clones were identified by immuoblotting and microscopic assays for the presence of GFP. Approximately 2 × 106cells were treated with PMA and ionomycin or with PMA and anti-CD28 for the indicated time periods. After treatment, cells were harvested, washed once with phosphate-buffered saline, and lysed in ELB buffer (50 mm HEPES, pH 7.9, 250 mm NaCl, 5 mmEDTA, 0.1% Igepal, 10 mm NaF, 50 μmZnCl2, 10 μm β-glycerol phosphate, 0.1 mm Na3VO4, 1 mmdithiothreitol, and 1.0 mm phenylmethylsulfonyl fluoride). Whole cell protein lysates (20 μg) were separated by 10% SDS/polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and subjected to immunoblotting using the indicated antibodies. Approximately 2.5 × 106 cells were transfected with the indicated reporter constructs using the DEAE-dextran protocol (96Holbrook N. Gulino A. Ruscetti F. Virology. 1987; 157: 211-219Crossref PubMed Scopus (39) Google Scholar). At 40 h post-transfection, the recipient cells were divided into three equal volumes that were either left untreated or treated for 8 h with PMA plus ionomycin or PMA plus ionomycin and anti-CD28. After treatment, cell extracts were isolated using a reporter lysis buffer (Promega) at about 200 μl/106 cells. Luciferase activity was detected by mixing 7 μl of extract with 20 μl of luciferase substrate (Promega) and measured in an FB12 luminometer (Zylux, Maryville, TN). The luciferase activity was normalized based on extract protein concentration. Fold induction was calculated by dividing the treated samples by the nontreated control for each reporter construct. SVT35 parental and derivative cell lines were either left untreated or treated for 2 h with the indicated inducers. Nuclear extracts were then prepared (58Schreiber E. Matthias P. Muller M.M. Schaffner W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3918) Google Scholar) and subjected to EMSA analysis (59Ganchi P.A. Sun S.-C. Greene W.C. Ballard D.W. Mol. Biol. Cell. 1992; 3: 1339-1352Crossref PubMed Scopus (204) Google Scholar). Briefly, extracts were incubated with the following32P-labeled oligonucleotide probes: NF-κB, CAACGGCAGGGGAATTCCCTCCTT; NF-AT, GGAGGAAAAACTGTTTCATA; AP-1, TAGTGATGAGTCAGCCG; and Oct1, TGT CGA ATG CAA ATC CTC TCC TT. DNA-protein complexes were resolved on native 4% polyacrylamide gels and visualized by autoradiography. SVT35 parental and derivative cell lines were treated as indicated and harvested for total RNA isolation using TRI reagent (Molecular Research Center, Cincinnati, OH). For RT-PCR analysis, 2.5 μg of RNA was used for first strand RT reaction using the Superscript II Reverse Transcriptase (Life Technologies, Inc.). One-tenth of the resulting cDNAs were subjected to 23 PCR cycles in the presence of 0.1 μCi of [α-32P]dCTP using the following primers: FasL, forward, ATGCAGCAGCCCTTCAATTACC, and reverse, CCAGTAGTGCAGTAGCTCATC; IL-2, forward, ATGTACAGGATGCAACTCCTG, and reverse, CAAGTTAGTGTTGAGATGATGC; and GAPDH, forward, CTCATGACCACAGTCCATGCCATC, and reverse, CTGCTTCACCACCTTCTTGATGTC. 5 μl of the amplified DNA samples were resolved in a 5% polyacrylamide/1× TBE gel, dried, and exposed to autoradiogram. RNase protection assays (RPA) were performed using the RiboQuant Multi-probe RPA System (hAPO-3 template set, PharMingen, San Diego, CA) according to the manufacturer's instructions. Northern blot analysis was performed using a standard protocol. Briefly, 15 μg of total RNA was fractionated on 1% denaturing formaldehyde-agarose gels and then transferred to nitrocellulose membranes. The membranes were prehybridized for 30 min at 68 °C in Express Hyb Hybridization Solution (CLONTECH, Palo Alto, CA) and then hybridized for 18 h at 60 °C to 32P-labeled cDNA probes. Following standard washing steps, the membranes were subjected to autoradiography. Apoptosis was analyzed by annexin staining based on the translocation of phosphatidylserine from the inner side of the plasma membrane to the outer layer during the early stages of apoptosis (60Vermes I. Haanen C. Steffens-Nakken H. Reutelingsperger C. J. Immunol. Methods. 1995; 184: 39-51Crossref PubMed Scopus (4627) Google Scholar). Briefly, 5 × 105 cells were seeded on a 24-well plate and treated for 24 h with the indicated T cell mitogens or 16 h with anti-Fas (100 ng/ml). Cells were then sedimented, washed with phosphate-buffered saline, and resuspended in 100 μl of annexin V binding buffer (10 mm HEPES, pH 7.4, 5 mm CaCl2, 140 mm NaCl) containing FITC-labeled annexin V (annexin V-FITC) and propidium iodide (PI; 50 μg/ml). Cells were incubated in this solution by shaking at room temperature for 15 min. Samples were then diluted in buffer and subjected immediately to fluorescence-activated cell sorter analysis using a FACS Scan II flow cytometer. The early and late stage apoptotic cells are stained with annexin V and annexin V/PI, respectively, whereas the live cells are double negative. 2.5 × 106 cells were treated as indicated, and cell lysates were subjected to ELISA using a FasL ELISA kit (Oncogene Research Products, Boston, MA) according to the manufacturer's instructions. Stimulation of TCR with an agonistic anti-CD3 antibody triggers the protein kinase C and calcium signals (61Weiss A. Paul W.E. 3rd Ed. Fundamental Immunology. 13. Raven Press, Ltd., New York1993: 467-504Google Scholar). These two signals can also be elicited by the mitogen PMA and the calcium ionophore ionomycin, respectively (61Weiss A. Paul W.E. 3rd Ed. Fundamental Immunology. 13. Raven Press, Ltd., New York1993: 467-504Google Scholar). In synergy with the CD28 costimulatory signal, the protein kinase C stimulator PMA potently activates NF-κB through enhanced phosphorylation and degradation of the inhibitors IκBα and IκBβ (62Lai J.-H. Tan T.-H. J. Biol. Chem. 1994; 269: 30077-30080Abstract Full Text PDF PubMed Google Scholar, 63Harhaj E.W. Maggirwar S.B. Good L. Sun S.-C. Mol. Cell. Biol. 1996; 16: 6736-6743Crossref PubMed Google Scholar). By somatic mutagenesis, we have recently isolated a Jurkat T cell line, JM4.5.2, that is defective in PMA/CD28-mediated NF-κB activation (52Harhaj E.W. Good L. Xiao G.-T. Uhlik M. Cvijic M.E. Rivera I. Sun S.-C. Oncogene. 2000; 19: 1386-1391Crossref PubMed Scopus (92) Google Scholar). Initial characterization of this cell line revealed that it lacked expression of the essential NF-κB signaling component IKKγ. As shown in Fig.1, IKKγ was readily detected by immunobloting in the parental Jurkat cells (SVT35, lane 1) but not in the JM4.5.2 cells (lane 2). To confirm that the lack of IKKγ contributed to the NF-κB signaling defect in the mutant cells, an expression vector encoding HA-tagged IKKγ (HA-IKKγ) was stably introduced to the JM4.5.2 cells by retrovirus-mediated gene transfer. As control, the JM4.5.2 cells were transduced with a GFP expression vector. The exogenous HA-IKKγ was readily detected in two individual IKKγ stable cell clones (JM4.5.2-IKKγ #8 and #10, lanes 4 and 5) but not in the GFP-transduced cell clone (JM4.5.2-GFP, lane 3). To examine the effect of exogenous IKKγ on NF-κB signaling, the different cell lines were stimulated with mitogens followed by analysis of the inducible degradation of IκBα and activation of NF-κB. As expected, IκBα was completely degraded when the parental SVT35 cells were stimulated with PMA together with anti-CD28 (Fig.2 A, lane 3). A similar result was obtained by cellular stimulation with PMA plus ionomycin (lane 2). However, these mitogenic stimuli failed to induce IκBα degradation in the mutant JM4.5.2 cells (lanes 4–6). More importantly, the defect in IκBα degradation was largely rescued in the mutant cell clones stably expressing exogenous IKKγ (lanes 10–15). This rescuing effect was specific because it was not detected in the JM4.5.2-GFP cells (lanes 7–9). Parallel EMSA revealed that the IκBα degradation was associated with activation of the DNA binding activity of NF-κB (Fig.2 B). Thus, genetic reconstitution of the IKKγ gene in JM4.5.2 cells is sufficient to restore NF-κB signaling. We next determined whether the signaling defect observed in JM4.5.2 cells affected the activation of other transcription factors known to respond to T cell activation signals. These included NF-AT and AP-1, both known to be critical for cytokine gene induction upon T cell stimulation (3Crabtree G.R. Clipstone N.A. Annu. Rev. Biochem. 1994; 63: 1054-1083Crossref Scopus (627) Google Scholar). Because NF-AT and AP-1 have also been implicated in FasL gene regulation, analysis of these parallel pathways in the IKKγ-deficient cells is important for assessing the role of NF-κB in activation-induced FasL expression. For these studies EMSA was performed to detect the DNA binding activity of NF-AT, AP-1, and NF-κB in the parental, mutant, and IKKγ-reconstituted mutant Jurkat cells (Fig.3 A). As expected, JM4.5.2 cells failed to show inducible NF-κB DNA binding activity, and this defect was rescued in the IKKγ-stable cell clones. In contrast to that seen with NF-κB, induction of n