Regulation of a TRPM7-like Current in Rat Brain Microglia
2003; Elsevier BV; Volume: 278; Issue: 44 Linguagem: Inglês
10.1074/jbc.m304487200
ISSN1083-351X
AutoresXinpo Jiang, Evan W. Newell, Lyanne C. Schlichter,
Tópico(s)Trace Elements in Health
ResumoNon-excitable cells use Ca2+ influx for essential functions but usually lack voltage-gated Ca2+ channels. The main routes of Ca2+ entry appear to be store-operated channels or Ca2+-permeable non-selective cation channels, of which the magnesium-inhibited cation (or magnesium-nucleotide-regulated metal cation) current has received considerable recent attention. This current appears to be produced by one of the recently cloned transient receptor potential (TRP) channels, TRPM7. In this study of rat microglia, we identified TRPM7 transcripts and a prevalent current with the hallmark biophysical and pharmacological features of TRPM7. This is the first identification of a TRPM7-like current in the brain. There is little known about how members of the TRPM sub-family normally become activated. Using whole-cell patch clamp recordings from rat microglia, we found that the TRPM7-like current activates spontaneously after break-in and that the current and its activation are inhibited by elevated intracellular Mg2+ but not affected by cell swelling or a wide range of intracellular Ca2+ concentrations. The TRPM7-like current in microglia appears to depend on tyrosine phosphorylation. It was inhibited by several tyrosine kinase inhibitors, including a peptide (Src 40–58) that was shown previously to inhibit Src actions, but not by inactive drugs or peptide analogues. The current did not depend on the cell activation state; i.e. it was the same in microglia recently removed from the brain or when cultured under a wide range of conditions that favor the resting or activated state. Because TRPM7 channels are permeable to Ca2+, this current may be important for microglia functions that depend on elevations in intracellular Ca2+. Non-excitable cells use Ca2+ influx for essential functions but usually lack voltage-gated Ca2+ channels. The main routes of Ca2+ entry appear to be store-operated channels or Ca2+-permeable non-selective cation channels, of which the magnesium-inhibited cation (or magnesium-nucleotide-regulated metal cation) current has received considerable recent attention. This current appears to be produced by one of the recently cloned transient receptor potential (TRP) channels, TRPM7. In this study of rat microglia, we identified TRPM7 transcripts and a prevalent current with the hallmark biophysical and pharmacological features of TRPM7. This is the first identification of a TRPM7-like current in the brain. There is little known about how members of the TRPM sub-family normally become activated. Using whole-cell patch clamp recordings from rat microglia, we found that the TRPM7-like current activates spontaneously after break-in and that the current and its activation are inhibited by elevated intracellular Mg2+ but not affected by cell swelling or a wide range of intracellular Ca2+ concentrations. The TRPM7-like current in microglia appears to depend on tyrosine phosphorylation. It was inhibited by several tyrosine kinase inhibitors, including a peptide (Src 40–58) that was shown previously to inhibit Src actions, but not by inactive drugs or peptide analogues. The current did not depend on the cell activation state; i.e. it was the same in microglia recently removed from the brain or when cultured under a wide range of conditions that favor the resting or activated state. Because TRPM7 channels are permeable to Ca2+, this current may be important for microglia functions that depend on elevations in intracellular Ca2+. Non-excitable cells use trans-membrane Ca2+ influxes for essential cell functions, including proliferation, apoptosis, secretion, volume regulation, and ion homeostasis. Immune cells were among the first and remain among the most intensively studied, with focus on general and more specific roles of Ca2+ signaling, such as mitogenic activation, secretion of lymphokines, cytokines, cytotoxic molecules, and antibodies, and on phagocytosis, respiratory burst, and migration. In parallel, there have been an increasing number of studies on the pathways of Ca2+ entry into these cells. In almost all cases, the role of membrane potential in Ca2+ influx in non-excitable cells is fundamentally different from excitable cells. Voltage-gated Ca2+ channels are rare in immune cells, and many cell types appear to be devoid of them. In these cells, although Ca2+ influx is electrogenic and tends to depolarize the cell, the main effect of depolarization is to reduce the driving force for Ca2+ influx. Because hyperpolarization favors Ca2+ entry, the focus has been on store-operated Ca2+ channels, including the Ca2+-release-activated Ca2+ (CRAC) 1The abbreviations used are: CRAC, Ca2+-release-activated Ca2+; ACM, astrocyte conditioned medium; 2-APB, 2-aminoethyldiphenyl borate; K4BAPTA, K41,2-bis(2-aminophenoxy) ethane N,N,N′,N′-tetraacetic acid; MEM, minimal essential medium; nMDG, n-methyl d-glucamine; NPPB, 5-nitro-2-(3-phenylpropylamino)benzoic acid; TRP, transient receptor potential; PLC, phospholipase C.1The abbreviations used are: CRAC, Ca2+-release-activated Ca2+; ACM, astrocyte conditioned medium; 2-APB, 2-aminoethyldiphenyl borate; K4BAPTA, K41,2-bis(2-aminophenoxy) ethane N,N,N′,N′-tetraacetic acid; MEM, minimal essential medium; nMDG, n-methyl d-glucamine; NPPB, 5-nitro-2-(3-phenylpropylamino)benzoic acid; TRP, transient receptor potential; PLC, phospholipase C. channel, and on Ca2+-permeable non-selective cation channels. The CRAC current is widely expressed in immune cells, where it is one of the best characterized store-operated channels (1Parekh A.B. Penner R. Physiol. Rev. 1997; 77: 901-930Crossref PubMed Scopus (1287) Google Scholar, 2Lewis R.S. Adv. Second Messenger Phosphoprotein Res. 1999; 33: 279-307Crossref PubMed Scopus (83) Google Scholar). However, two Ca2+-permeable channel types often co-exist. Recent studies on the Jurkat T cell line and rat basophilic leukemia cells were the first to distinguish between co-existing CRAC currents and a Mg2+-inhibited cation current (also called magnesium nucleotide-regulated metal cation current) (3Hermosura M.C. Monteilh-Zoller M.K. Scharenberg A.M. Penner R. Fleig A. J. Physiol. 2002; 539: 445-458Crossref PubMed Scopus (165) Google Scholar, 4Kozak J.A. Kerschbaum H.H. Cahalan M.D. J. Gen. Physiol. 2002; 120: 221-235Crossref PubMed Scopus (169) Google Scholar, 5Prakriya M. Lewis R.S. J. Gen. Physiol. 2002; 119: 487-507Crossref PubMed Scopus (265) Google Scholar). The latter current is nearly identical to one of the recently cloned transient receptor potential (TRP) channels, TRPM7. The TRP family comprises >20 channels, all with six transmembrane domains and cytoplasmic N and C termini, and recently divided into three sub-families: TRPC, TRPV, and TRPM (for reviews see Refs. 6Clapham D.E. Runnels L.W. Strubing C. Nat. Rev. Neurosci. 2001; 2: 387-396Crossref PubMed Scopus (950) Google Scholar, 7Montell C. Birnbaumer L. Flockerzi V. Cell. 2002; 108: 595-598Abstract Full Text Full Text PDF PubMed Scopus (721) Google Scholar, 8Montell C. Birnbaumer L. Flockerzi V. Bindels R.J. Bruford E.A. Caterina M.J. Clapham D.E. Harteneck C. Heller S. Julius D. Kojima I. Mori Y. Penner R. Prawitt D. Scharenberg A.M. Schultz G. Shimizu N. Zhu M.X. Mol. Cell. 2002; 9: 229-231Abstract Full Text Full Text PDF PubMed Scopus (556) Google Scholar). Many of these channels are widely distributed in mammalian tissues, and following their cloning and heterologous expression, properties of some have made them excellent candidates for the Ca2+ entry pathways of non-excitable cells. Most members of the TRPC sub-family are store-operated and Ca2+ permeable, one of the TRPV members (TRPV4) is activated by changes in cell volume, and some members of the TRPM sub-family (TRPM7, TRPM8) are permeable to divalent cations, including Ca2+ (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar, 10Monteilh-Zoller M.K. Hermosura M.C. Nadler M.J. Scharenberg A.M. Penner R. Fleig A. J. Gen. Physiol. 2003; 121: 49-60Crossref PubMed Scopus (429) Google Scholar). TRP channels are not voltage-gated and thus are open over a wide range of voltages once activated. Those that are Ca2+-permeable produce Ca2+ influxes that increase with the driving force; i.e. with hyperpolarizing membrane potentials, the common feature of Ca2+ entry into immune cells and many other non-excitable cells. Indeed, the properties of TRPM7 (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar, 11Nadler M.J. Hermosura M.C. Inabe K. Perraud A.L. Zhu Q. Stokes A.J. Kurosaki T. Kinet J.P. Penner R. Scharenberg A.M. Fleig A. Nature. 2001; 411: 590-595Crossref PubMed Scopus (797) Google Scholar) make it the best candidate for the non-store-operated Ca2+ pathway for Ca2+ entry in many immune cells. Expression of TRPM7 is widespread, with transcripts in brain, spleen, lung, kidney, heart, and liver (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar, 11Nadler M.J. Hermosura M.C. Inabe K. Perraud A.L. Zhu Q. Stokes A.J. Kurosaki T. Kinet J.P. Penner R. Scharenberg A.M. Fleig A. Nature. 2001; 411: 590-595Crossref PubMed Scopus (797) Google Scholar). Within the brain, it is not known which cell types express this channel or what role it might play in normal or pathological brain function. We have been studying ion-channel expression and roles in the immune cell of the central nervous system, the microglia. These cells express several types of K+ channels, and some are involved in key microglia functions; e.g. proliferation and the respiratory burst (12Kotecha S.A. Schlichter L.C. J. Neurosci. 1999; 19: 10680-10693Crossref PubMed Google Scholar, 13Khanna R. Roy L. Zhu X. Schlichter L.C. Am. J. Physiol. Cell Physiol. 2001; 280: C796-C806Crossref PubMed Google Scholar), reviewed in Ref. 14Schlichter L.C. Khanna R. Rouzaire-Dubois B. Benoit E. Dubrois J.M. Potassium Channels and Proliferation of Neuroimmune Cells. Research Signpost, Trivandrum, Kerala, India2002Google Scholar. Although the precise roles of the K+ channels are not yet known, they may act by maintaining a hyperpolarized membrane potential and facilitating Ca2+ entry, as in lymphocytes (for reviews see Refs. 14Schlichter L.C. Khanna R. Rouzaire-Dubois B. Benoit E. Dubrois J.M. Potassium Channels and Proliferation of Neuroimmune Cells. Research Signpost, Trivandrum, Kerala, India2002Google Scholar and 15Lewis R.S. Annu. Rev. Immunol. 2001; 19: 497-521Crossref PubMed Scopus (700) Google Scholar). The routes of Ca2+ entry in microglia are poorly understood. Microglia have ionotropic purinergic receptors that are permeable to Ca2+ and monovalent cations (16Illes P. Norenberg W. Gebicke-Haerter P.J. Neurochem. Int. 1996; 29: 13-24Crossref PubMed Scopus (78) Google Scholar) and a current reported to be CRAC (17Hahn J. Jung W. Kim N. Uhm D.Y. Chung S. Glia. 2000; 31: 118-124Crossref PubMed Scopus (27) Google Scholar), both of which should produce Ca2+ influxes that increase with hyperpolarization. The functional expression of voltage-gated Ca2+ channels (18Colton C.A. Jia M. Li M.X. Gilbert D.L. Am. J. Physiol. 1994; 266: C1650-C1655Crossref PubMed Google Scholar) is somewhat controversial, but if present they should produce a depolarization-activated Ca2+ influx. The presence of other Ca2+-permeable channels in microglia has not been reported. In the present study, we have identified transcripts for TRPM7 and characterized a prevalent current in rat brain microglia that has the hallmark features of expressed TRPM7 channels. The same current was expressed in ex vivo microglia, studied within 2 days of removal from the brain, as well as in microglia cultured under a wide range of conditions that favor either the resting or activated cell state. There is little known about how members of the TRPM sub-family normally become activated. For instance, TRPM7 contains an active protein kinase domain (atypical α-kinase), it can phosphorylate itself, and mutations in the ATP-binding motif reduce the current (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar). But it appears that effects of changing ATP may be entirely because of inhibition of TRPM7 channel activation by intracellular free Mg2+ (10Monteilh-Zoller M.K. Hermosura M.C. Nadler M.J. Scharenberg A.M. Penner R. Fleig A. J. Gen. Physiol. 2003; 121: 49-60Crossref PubMed Scopus (429) Google Scholar, 11Nadler M.J. Hermosura M.C. Inabe K. Perraud A.L. Zhu Q. Stokes A.J. Kurosaki T. Kinet J.P. Penner R. Scharenberg A.M. Fleig A. Nature. 2001; 411: 590-595Crossref PubMed Scopus (797) Google Scholar), which is also a distinguishing feature of native Mg2+-inhibited cation or magnesium nucleotide-regulated metal cation currents (3Hermosura M.C. Monteilh-Zoller M.K. Scharenberg A.M. Penner R. Fleig A. J. Physiol. 2002; 539: 445-458Crossref PubMed Scopus (165) Google Scholar, 4Kozak J.A. Kerschbaum H.H. Cahalan M.D. J. Gen. Physiol. 2002; 120: 221-235Crossref PubMed Scopus (169) Google Scholar, 5Prakriya M. Lewis R.S. J. Gen. Physiol. 2002; 119: 487-507Crossref PubMed Scopus (265) Google Scholar; 19Kozak J.A. Cahalan M.D. Biophys. J. 2003; 84: 922-927Abstract Full Text Full Text PDF PubMed Google Scholar). We addressed this question in the present study, using whole-cell and perforated patch clamp recordings on rat microglia. We found that the TRPM7-like current activates spontaneously after break-in, but much less current develops in perforated-patch recordings. The current, like TRPM7, was inhibited by millimolar total intracellular Mg2+ concentrations. It was not affected by cell swelling or a wide range of intracellular Ca2+ concentrations. Activation of the current was inhibited by several tyrosine kinase inhibitors and by a peptide that interferes with actions of Src kinase but not by the appropriate inactive drug analogues or a scrambled peptide. Because TRPM7 channels are permeable to Ca2+, this current may be important for microglia functions that depend on elevations in intracellular Ca2+. Microglia—Cultures of highly purified microglia were prepared from neopallia of 2-day-old Wistar rat pups (Charles River, Quebec) as described previously (20Schlichter L.C. Sakellaropoulos G. Ballyk B. Pennefather P.S. Phipps D.J. Glia. 1996; 17: 225-236Crossref PubMed Scopus (129) Google Scholar). In brief, finely minced neopallial tissue was pelleted and resuspended in minimal essential medium (MEM; University Health Network, Sera and Media Services, Toronto). The tissue was filtered through a 40-μm cell strainer and re-suspended in MEM that was supplemented with 5% horse serum, 5% fetal bovine serum, and 0.05 mg/ml gentamycin (all from Invitrogen). The cells were then seeded into 75-cm2 flasks and re-fed 2 days after isolation. After 10–12 days in culture without feeding, the flasks were shaken (180 rpm, 8–12 h), and the floating cells (>95% pure microglia) were harvested. For electrophysiology, microglia were plated on 15-mm sterile glass coverslips and cultured in either serum-free medium (i.e. MEM with 2% B27 supplement (Invitrogen), 2 mm l-glutamine, and 0.05 mg/ml gentamycin) or astrocyte-conditioned medium (ACM), collected as the supernatant from rat astrocyte cultures grown in MEM with 2% fetal bovine serum (21Eder C. Schilling T. Heinemann U. Haas D. Hailer N. Nitsch R. Eur. J. Neurosci. 1999; 11: 4251-4261Crossref PubMed Scopus (54) Google Scholar). ACM was collected twice a week, frozen at –70 °C, and used within one month. Where indicated, microglia were treated with 100 ng/ml lipopolysaccharide or 100 nm phorbol myristate acetate overnight before patch clamping. For ex vivo cells, freshly prepared suspensions of neopallial tissue were plated onto 15-mm sterile glass coverslips, fed with ACM, and patch-clamped 2 days after isolation. Reverse Transcriptase-PCR—Reverse transcriptase-PCR was performed as described previously (22Khanna R. Chang M.C. Joiner W.J. Kaczmarek L.K. Schlichter L.C. J. Biol. Chem. 1999; 274: 14838-14849Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Briefly, total RNA was isolated using TRIZOL reagent (Invitrogen) from cultures that were >98% pure microglia. To eliminate genomic contamination, the cell suspension was digested with DNase I (Amersham Biosciences) at 0.1 units/ml, for 15 min at 37 °C. First strand cDNA was synthesized using an oligo(dT) primer (Amersham Biosciences) and used as a template for PCR reactions with a gene-specific primer (from ACGT, Toronto, ON) for ChaK (GenBank™ accession number NM_053705) (forward primer CTGAAGAGGAATGACTACAC; reverse primer ACAGGGAAAAAGAGAGGGAG). As a control, oligo mouse actin (M12481) was amplified (forward primer CTACAATGAGCTGCGTGTGG; reverse primer TAGCTCTTCTCCAGGGAGGA). The PCR reaction was conducted with 1.5 mm MgCl2, 0.5 μm forward and reverse primers, 10% of the cDNA reaction mixture, and 1.25 μm of Taq DNA polymerase, using a GeneAmp PCR 2400 system (PerkinElmer Life Sciences). The mixture was preheated to 95 °C for 5 min and then subjected to 25 cycles of a denaturing phase at 94 °C, a 30-s annealing phase at 55 °C, and a 30-s extension phase at 72 °C. The amplified products were resolved in 2% agarose gels containing 0.5 mg/ml ethidium bromide. The identities of products of the predicted sizes were confirmed by restriction endonuclease digestion. Patch Clamp Recordings—We made whole-cell or perforated-patch configurations at room temperature with an Axopatch 200A or Axopatch 1B amplifier (Axon Instruments, Union City, CA) and 5–10-megohm resistance pipettes pulled from thick-walled borosilicate glass capillaries (WPI, Sarasota, FL). Capacitance and series resistance (but not leak current) were compensated online, and recordings were filtered at 5 kHz before acquiring data. pCLAMP v6.0 or 8.0 (Axon Instruments) was used for generating voltage commands, recording current, and collecting data, which were analyzed offline with Origin v6.0 (Northampton, MA). Liquid junction potentials were measured between each bath and pipette solution with a 3 m KCl electrode, subtracted offline, and used to correct all voltages and current versus voltage relations. Several combinations of bath and pipette solutions (indicated in each figure legend) were used to isolate the current and to characterize its selectivity and ion dependence. The standard bath solution contained (in mm) 125 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2 and 10 HEPES, and standard pipette solution contained 40 KCl, 100 potassium aspartate, 1 MgCl2, 1 CaCl2, 10 HEPES, 2 K2ATP, and 10 EGTA. To minimize contributions of the swelling-activated Cl– current (20Schlichter L.C. Sakellaropoulos G. Ballyk B. Pennefather P.S. Phipps D.J. Glia. 1996; 17: 225-236Crossref PubMed Scopus (129) Google Scholar) many experiments were performed with low Cl– solutions made by substituting NaCl and KCl with 125 mm NaMeSO4 and 5 mm KMeSO4 (bath) and 130 mm KMeSO4 or potassium aspartate (pipette). Sucrose was added when necessary to adjust the osmolarity of all solutions to 300 milliosmolar, measured with a freezing point-depression osmometer (Advanced Instruments, Norwood, MA). For ion-selectivity studies, low Cl– solutions were used, with one of the following substitutions: 130 mm nMDG MeSO4 (pipette), K+-free bath, or pipette solutions were made by replacing KMeSO4 with CsMeSO4, or a divalent-free bath solution was prepared by replacing MgCl2 and CaCl2 with 4 mm NaCl and adding 10 mm HEDTA. To assess the dependence of the current on internal Ca2+, the pipette calcium solutions contained 1 mm K41,2-bis(2-aminophenoxy) ethane N,N,N′,N′-tetraacetic acid (K4BAPTA) instead of EGTA, with free Ca2+ adjusted by adding CaCl2, according to the CaBuffer program (from J. Kleinschmidt, formerly of New York University). The effect of changing the internal Mg2+ concentration was tested by adding MgCl2 to the low Cl– pipette solution while keeping the ATP concentration fixed at 2 mm. For perforated-patch recordings, the pipette was back-filled with intracellular solution containing 20 μg/ml amphotericin B (Sigma) diluted from a freshly prepared 1 mg/ml stock solution in Me2SO (23Rae J. Cooper K. Gates P. Watsky M. J. Neurosci. Methods. 1991; 37: 15-26Crossref PubMed Scopus (808) Google Scholar). All bath solutions were pH 7.4 (adjusted with NaOH), and pipette solutions were pH 7.2 (adjusted with KOH or CsOH). To initially assess regulation of the current by tyrosine kinases, a broad-spectrum tyrosine kinase inhibitor, genistein (or its inactive analogue, daidzein, both at 50 μm), or the more Src-selective inhibitor, herbimycin A (2 μm) (24Fujishima H. Nakano S. Tatsumoto T. Masumoto N. Niho Y. Int. J. Cancer. 1998; 76: 423-429Crossref PubMed Scopus (8) Google Scholar) (all from Sigma), was added to the bath. A specific role for Src tyrosine kinase was further examined using pipette solutions containing the Src peptide, Src40–58, or the scrambled inactive peptide, Src40–58s (0.1 mg/ml), as we described previously (25Cayabyab F.S. Khanna R. Jones O.T. Schlichter L.C. Eur. J. Neurosci. 2000; 12: 1949-1960Crossref PubMed Scopus (64) Google Scholar, 26Cayabyab F.S. Schlichter L.C. J. Biol. Chem. 2002; 277: 13673-13681Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). The peptides were synthesized at the Hospital for Sick Children (Toronto). Spermine was purchased from Calbiochem, and unless indicated, the remaining chemicals were purchased from Sigma and were the highest purity available. Statistics—Where appropriate, data are presented as mean ± S.E., with n indicating the number of cells studied under each condition. Differences between means were analyzed by using either paired or unpaired Student's t tests as appropriate. An Outward-rectifying Cation Current—Unless otherwise indicated, all recordings were from microglia that were cultured in serum-free medium or astrocyte-conditioned medium, conditions that reduce microglia activation (21Eder C. Schilling T. Heinemann U. Haas D. Hailer N. Nitsch R. Eur. J. Neurosci. 1999; 11: 4251-4261Crossref PubMed Scopus (54) Google Scholar). We patch-clamped microglia that were unipolar or bipolar with elongated cell bodies, as in one of our earlier studies (12Kotecha S.A. Schlichter L.C. J. Neurosci. 1999; 19: 10680-10693Crossref PubMed Google Scholar). Throughout this study, the holding potential was –5 mV to inactivate the voltage-gated K+ currents that have been well characterized in microglia: Kv1.3-like (12Kotecha S.A. Schlichter L.C. J. Neurosci. 1999; 19: 10680-10693Crossref PubMed Google Scholar, 25Cayabyab F.S. Khanna R. Jones O.T. Schlichter L.C. Eur. J. Neurosci. 2000; 12: 1949-1960Crossref PubMed Scopus (64) Google Scholar, 27Schilling T. Quandt F.N. Cherny V.V. Zhou W. Heinemann U. DeCoursey T.E. Eder C. Am. J. Physiol. Cell Physiol. 2000; 279: C1123-C1134Crossref PubMed Google Scholar) and Kv1.5-like currents (12Kotecha S.A. Schlichter L.C. J. Neurosci. 1999; 19: 10680-10693Crossref PubMed Google Scholar). Voltage-clamp steps and ramps were applied between –85 and +115 mV, avoiding more negative potentials that activate the well characterized inward rectifier (Kir2.1-like) current (20Schlichter L.C. Sakellaropoulos G. Ballyk B. Pennefather P.S. Phipps D.J. Glia. 1996; 17: 225-236Crossref PubMed Scopus (129) Google Scholar, 27Schilling T. Quandt F.N. Cherny V.V. Zhou W. Heinemann U. DeCoursey T.E. Eder C. Am. J. Physiol. Cell Physiol. 2000; 279: C1123-C1134Crossref PubMed Google Scholar). Except where noted, we observed an outward rectifying current that lacked time-dependent activation or inactivation during voltage-clamp steps. Fig. 1, A and B shows examples of the current; similar currents were seen in >200 microglia and, as shown in subsequent figures, under a wide range of conditions. Responses to voltage steps and ramps illustrate some hallmarks of this current; that is, lack of detectable time-dependent gating and strong outward rectification with a reversal potential of about –15 mV with standard bath and pipette solutions (circles in Fig. 1C). These features are very similar to the recently cloned TRPM7 channel (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar, 11Nadler M.J. Hermosura M.C. Inabe K. Perraud A.L. Zhu Q. Stokes A.J. Kurosaki T. Kinet J.P. Penner R. Scharenberg A.M. Fleig A. Nature. 2001; 411: 590-595Crossref PubMed Scopus (797) Google Scholar). Most reports on transfected TRPM7 channels (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar, 11Nadler M.J. Hermosura M.C. Inabe K. Perraud A.L. Zhu Q. Stokes A.J. Kurosaki T. Kinet J.P. Penner R. Scharenberg A.M. Fleig A. Nature. 2001; 411: 590-595Crossref PubMed Scopus (797) Google Scholar) have not shown or mentioned the tail currents, and many have shown currents only in response to voltage-ramp protocols. We found very small tail currents upon return to the holding potential of –5 mV (Fig. 1, A and E), which was close to the reversal potential. When steps to more negative potentials followed strong depolarizing steps, the tail currents were immediately small (not shown), without the relaxations that occur when voltage-gated channels close with hyperpolarization. A similar lack of time dependence is expected for TRPM7 channels, because the inward current is rapidly blocked by external divalent cations. The outward current is carried by efflux of monovalent cations. That is, replacing intracellular K+ with nMDG+ nearly eliminated the outward current (Fig. 1C), demonstrating that the monovalent cation, K+, is highly permeant, but the bulky cation, nMDG+, is not. In contrast, replacing external Cl– with methanesulfonate (MeSO4) (Fig. 1D) did not affect the current amplitude or rectification, and similar results were seen with external aspartate (n = 3 cells, not shown). Thus, the outward current is not because of anion influx. K+ appears to be more permeant than Cs+, because the outward current was significantly reduced by replacing internal K+ with Cs+ (Fig. 1C). Although a selectivity sequence of K+>Cs+>nMDG+ is characteristic of K+ channels, the reversal potential of –10 to –15 mV with internal K+ or Cs+ rules out a K+-selective channel; E K is –85 mV with the normal K+-containing bath and pipette solutions used in Fig. 1, A–C. However, these features are typical of the TRPM7 channel, which passes monovalent cations (not anions) with a permeability sequence K+∼Cs+∼Na+>Ca2+ (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar). Possible contributions of ionotropic purinergic receptors, which produce a non-selective cation current in microglia (see "Discussion"), were ruled out by several observations. First, to eliminate the possibility that ATP leaking from the pipette during seal formation activated the cation current, some experiments were done without ATP; the current activated normally (n = 4, not shown). Second, the outward-rectifying current took several minutes to fully activate (see Fig. 7) whereas purinergic currents activate rapidly in the presence of ATP. Third, purinergic-receptor-mediated currents in microglia have nearly linear I-V relations, with substantial inward current. In the absence of external divalent cations, a large inward current was revealed during voltage-clamp steps (Fig. 1E) or ramps (Fig. 1F). As before, there was no time-dependent gating evident, thus the step-elicited currents were superimposed on the ramp currents. As shown here and in Fig. 8C (open circles), in divalent-free solution there was a dramatic decrease in current rectification; e.g. the ratio of current density at +115 mV versus –85 mV decreased from 8.6 ± 2.3 in standard bath solution to 1.8 ± 0.3 (n = 7) in divalent-free bath solution. In divalent-free bath solution, the current reversed at –11 ± 1 mV (n = 7), which expected for a non-selective cation channel through which Na+ (predominant in the bath) and K+ (predominant in the pipette) permeate well. That is, the K+ Nernst potential is about –85, and the Na+ Nernst potential is about +60 mV; thus, if the TRPM7 channel is equally permeable to K+ and Na+ (9Runnels L.W. Yue L. Clapham D.E. Science. 2001; 291: 1043-1047Crossref PubMed Scopus (621) Google Scholar) the reversal potential should be ∼–12 mV. Inhibition by Intracellular Mg2 + but Not by Intracellular Ca2 + —With the standard 1 mm Mg2+ and 2 mm K2ATP in the pipette, the outward-rectifying current increased over the first several minutes of whole-cell recording (Fig. 2A; for average time course see Fig. 7D). The current was not sensitive to internal Ca2+ (Fig. 2B); i.e. there were no changes in current density, degree of outward-rectification, or reversal potential over a wide range of free Ca2+ concentrations. Thus, the microglia channel is not Ca2+-activated, like some cation non-selective channels (28Colquhoun D. Neher E. Reuter H. Stevens C.F. Nature. 1981; 294: 752-754Crossref PubMed Scopus (430) Google Scholar, 29Petersen O.H. Biol. Res. 2002; 35: 177-182Crossref PubMed Scopus (58) Google Scholar), or subject to Ca2+-dependent slow deactivation, as is the CRAC current (30Zweifach A. Lewis R.S. J. Gen. Physiol. 1995; 105: 209-226Crossref PubMed Scopus (333) Google Scholar). Consistent with our results, buffering internal Ca2+ to ∼100 nm had no effect on cloned TRPM7 channels (31Runnels L.W. Yue L. Clapham D.E. Nat. Cell Biol. 2002; 4: 329-336Crossref PubMed Scopus (455) Google Scholar). However, there was a dose-dependent inhibition of current by internal Mg2+. The current density at both early ( 20 min; see Fig. 2C, part ii) reached significantly larger values when internal Mg2+ was omitted. In contrast, the normal time-dependent build up of current was
Referência(s)