Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

ADAM10, the Rate-limiting Protease of Regulated Intramembrane Proteolysis of Notch and Other Proteins, Is Processed by ADAMS-9, ADAMS-15, and the γ-Secretase

2009; Elsevier BV; Volume: 284; Issue: 17 Linguagem: Inglês

10.1074/jbc.m805894200

ISSN

1083-351X

Autores

Thomas Tousseyn, Amantha Thathiah, Ellen Jorissen, Tim Raemaekers, Uwe Konietzko, Karina Reiß, Elke Maes, An Snellinx, Lutgarde Serneels, Omar Nyabi, Wim Annaert, Paul Säftig, Dieter Hartmann, Bart De Strooper,

Tópico(s)

Wnt/β-catenin signaling in development and cancer

Resumo

ADAM10 is involved in the proteolytic processing and shedding of proteins such as the amyloid precursor protein (APP), cadherins, and the Notch receptors, thereby initiating the regulated intramembrane proteolysis (RIP) of these proteins. Here, we demonstrate that the sheddase ADAM10 is also subject to RIP. We identify ADAM9 and -15 as the proteases responsible for releasing the ADAM10 ectodomain, and Presenilin/γ-Secretase as the protease responsible for the release of the ADAM10 intracellular domain (ICD). This domain then translocates to the nucleus and localizes to nuclear speckles, thought to be involved in gene regulation. Thus, ADAM10 performs a dual role in cells, as a metalloprotease when it is membrane-bound, and as a potential signaling protein once cleaved by ADAM9/15 and the γ-Secretase. ADAM10 is involved in the proteolytic processing and shedding of proteins such as the amyloid precursor protein (APP), cadherins, and the Notch receptors, thereby initiating the regulated intramembrane proteolysis (RIP) of these proteins. Here, we demonstrate that the sheddase ADAM10 is also subject to RIP. We identify ADAM9 and -15 as the proteases responsible for releasing the ADAM10 ectodomain, and Presenilin/γ-Secretase as the protease responsible for the release of the ADAM10 intracellular domain (ICD). This domain then translocates to the nucleus and localizes to nuclear speckles, thought to be involved in gene regulation. Thus, ADAM10 performs a dual role in cells, as a metalloprotease when it is membrane-bound, and as a potential signaling protein once cleaved by ADAM9/15 and the γ-Secretase. ADAMs 8The abbreviations used are: ADAM, A disintegrin and metalloprotease; ICD, intracellular domains; APP, amyloid precursor protein; CTF, C-terminal fragment; PS, presenilin; WT, wild type; PML, promyelocytic leukemia; MEF, mouse embryonic fibroblast; RIP, regulated intramembrane proteolysis. (A disintegrin and metalloprotease) are type 1 transmembrane proteins related to snake venom integrin ligands and metalloproteases. All 38 different family members feature a common modular ectodomain structure (1.Black R.A. White J.M. Curr. Opin. Cell Biol. 1998; 10: 654-659Crossref PubMed Scopus (428) Google Scholar, 2.Moss M.L. Lambert M.H. Essays Biochem. 2002; 38: 141-153Crossref PubMed Scopus (73) Google Scholar, 3.Primakoff P. Myles D.G. Trends Genet. 2000; 16: 83-87Abstract Full Text Full Text PDF PubMed Scopus (514) Google Scholar, 4.Wolfsberg T.G. Primakoff P. Myles D.G. White J.M. J. Cell Biol. 1995; 131: 275-278Crossref PubMed Scopus (441) Google Scholar) (Fig. 1A). In addition to the membrane-bound, full-length prototype, soluble ADAM variants have also been identified, consisting of only the ectodomain or fragments thereof that are released into the intercellular space. Such variants are generated by partial gene duplication (ADAM9) (5.Hotoda N. Koike H. Sasagawa N. Ishiura S. Biochem. Biophys. Res. Commun. 2002; 293: 800-805Crossref PubMed Scopus (79) Google Scholar), alternative splicing (ADAM12) (6.Gilpin B.J. Loechel F. Mattei M.G. Engvall E. Albrechtsen R. Wewer U.M. J. Biol. Chem. 1998; 273: 157-166Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 7.Shi Z. Xu W. Loechel F. Wewer U.M. Murphy L.J. J. Biol. Chem. 2000; 275: 18574-18580Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar), or proteolysis (ADAMs 8, 13, and 19) (8.Gaultier A. Cousin H. Darribere T. Alfandari D. J. Biol. Chem. 2002; 277: 23336-23344Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 9.Kang T. Park H.I. Suh Y. Zhao Y.G. Tschesche H. Sang Q.X. J. Biol. Chem. 2002; 277: 48514-48522Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar, 10.Schlomann U. Wildeboer D. Webster A. Antropova O. Zeuschner D. Knight C.G. Docherty A.J. Lambert M. Skelton L. Jockusch H. Bartsch J.W. J. Biol. Chem. 2002; 277: 48210-48219Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). ADAMs can be grouped either by their tissue distribution and/or functional properties. One major group (ADAMs 2, 3, 5, 6, 16, 18, 20, 21, 24, 25, 26, 29, and 30) is expressed exclusively in the male gonad, with an emerging role in sperm maturation. A second group (ADAMs 2, 7, 11, 18, 22, 23, and 29) is characterized by an inactive protease domain, and they seem to be mainly important for cell adhesion and fusion. A large third group of ADAMs displays a broad expression profile and has demonstrated (ADAMs 8, 9, 10, 12, 17, 19, and 28) or predicted (ADAMs 15, 20, 21, 30, and 33) proteolytic activity. These proteases play a major role in the ectodomain shedding of proteins involved in paracrine signaling, cell adhesion, and intracellular signaling (reviewed in Refs. 11.Blobel C.P. Nat. Rev. 2005; 6: 32-43Crossref Scopus (923) Google Scholar and 12.Tousseyn T. Jorissen E. Reiss K. Hartmann D. Birth Defects Res. C Embryo Today. 2006; 78: 24-46Crossref PubMed Scopus (49) Google Scholar). The site specificity of the cleavage of these substrates is rather relaxed, and apparently different family members can mutually compensate for each other. This has been illustrated particularly well for the amyloid precursor protein (APP) (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 14.Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar, 15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar, 16.Koike H. Tomioka S. Sorimachi H. Saido T.C. Maruyama K. Okuyama A. Fujisawa-Sehara A. Ohno S. Suzuki K. Ishiura S. Biochem. J. 1999; 343: 371-375Crossref PubMed Scopus (232) Google Scholar, 17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar). ADAM10 is one of the proteolytically active ADAM members (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar, 19.Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar, 20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar, 21.Reiss K. Maretzky T. Ludwig A. Tousseyn T. de Strooper B. Hartmann D. Saftig P. EMBO J. 2005; 24: 742-752Crossref PubMed Scopus (398) Google Scholar). The list of ADAM10 substrates is still growing, confirming the central role of ADAM10 in many important biological processes, such as cell migration and axonal navigation (robo receptors and ephrins (22.Janes P.W. Saha N. Barton W.A. Kolev M.V. Wimmer-Kleikamp S.H. Nievergall E. Blobel C.P. Himanen J.P. Lackmann M. Nikolov D.B. Cell. 2005; 123: 291-304Abstract Full Text Full Text PDF PubMed Scopus (365) Google Scholar, 23.Mancia F. Shapiro L. Cell. 2005; 123: 185-187Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar), cell adhesion (cadherins (19.Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar, 21.Reiss K. Maretzky T. Ludwig A. Tousseyn T. de Strooper B. Hartmann D. Saftig P. EMBO J. 2005; 24: 742-752Crossref PubMed Scopus (398) Google Scholar), CD44 and L1 (24.Mechtersheimer S. Gutwein P. Agmon-Levin N. Stoeck A. Oleszewski M. Riedle S. Postina R. Fahrenholz F. Fogel M. Lemmon V. Altevogt P. J. Cell Biol. 2001; 155: 661-673Crossref PubMed Scopus (28) Google Scholar)), and regulation of immune reactions, and control of apoptosis (FasL) (25.Schulte M. Reiss K. Lettau M. Maretzky T. Ludwig A. Hartmann D. de Strooper B. Janssen O. Saftig P. Cell Death & Differ. 2007; 14: 1040-1049Crossref PubMed Scopus (149) Google Scholar). Importantly, genetic ablation of ADAM10 in vertebrates (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar) and invertebrates (26.Lieber T. Kidd S. Young M.W. Genes Dev. 2002; 16: 209-221Crossref PubMed Scopus (191) Google Scholar, 27.Pan D. Rubin G.M. Cell. 1997; 90: 271-280Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 28.Sotillos S. Roch F. Campuzano S. Development (Camb.). 1997; 124: 4769-4779PubMed Google Scholar, 29.Wen C. Metzstein M.M. Greenwald I. Development (Camb.). 1997; 124: 4759-4767PubMed Google Scholar) mainly results in loss of Notch phenotypes, indicating the crucial role for this protease in the Notch signaling pathway (30.Hattori M. Osterfield M. Flanagan J.G. Science. 2000; 289: 1360-1365Crossref PubMed Scopus (462) Google Scholar, 31.Rooke J. Pan D. Xu T. Rubin G.M. Science. 1996; 273: 1227-1231Crossref PubMed Scopus (301) Google Scholar). Finally, ADAM10 is emerging as a major player in human disease. It is up-regulated in several tumors (32.McCulloch D.R. Akl P. Samaratunga H. Herington A.C. Odorico D.M. Clin. Cancer Res. 2004; 10: 314-323Crossref PubMed Scopus (82) Google Scholar), and it is also considered to be protective in Alzheimer disease as it is one of the major α-secretases, cleaving APP within the amyloid-β (Aβ) peptide sequence, which thus precludes amyloid plaque formation (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar, 20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar, 33.Deuss M. Reiss K. Hartmann D. Curr. Alzheimer Res. 2008; 5: 187-201Crossref PubMed Scopus (89) Google Scholar). Interestingly, two other ADAMs (9.Kang T. Park H.I. Suh Y. Zhao Y.G. Tschesche H. Sang Q.X. J. Biol. Chem. 2002; 277: 48514-48522Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar and 17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar) have also demonstrated α-secretase activity in vitro (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 14.Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar, 16.Koike H. Tomioka S. Sorimachi H. Saido T.C. Maruyama K. Okuyama A. Fujisawa-Sehara A. Ohno S. Suzuki K. Ishiura S. Biochem. J. 1999; 343: 371-375Crossref PubMed Scopus (232) Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar). Thus, stimulating α-secretase cleavage is an interesting therapeutic option for Alzheimer disease (20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar). A fascinating aspect of ADAM10-mediated proteolysis is the initiation of regulated intramembrane proteolysis (RIP), which is characterized by two consecutive cleavage steps. First, the ectodomain is shed to generate a soluble ectodomain (11.Blobel C.P. Nat. Rev. 2005; 6: 32-43Crossref Scopus (923) Google Scholar, 34.Sahin U. Weskamp G. Kelly K. Zhou H.M. Higashiyama S. Peschon J. Hartmann D. Saftig P. Blobel C.P. J. Cell Biol. 2004; 164: 769-779Crossref PubMed Scopus (785) Google Scholar). Then, the remaining transmembrane C-terminal fragment (CTFs) becomes a substrate for intramembrane cleaving proteases such as Presenilin/γ-Secretase (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar). The fragments generated by this cleavage are released both externally and internally from the membrane and are, in many instances, involved in cell signaling pathways. Notch signaling has been particularly well investigated and it is well known that the Notch intracellular domain, upon release by Presenilin/γ-Secretase, translocates to the cell nucleus and regulates transcription of a series of Notch target genes in so-called transcription factories (36.Brou C. Logeat F. Gupta N. Bessia C. LeBail O. Doedens J.R. Cumano A. Roux P. Black R.A. Israel A. Mol. Cell. 2000; 5: 207-216Abstract Full Text Full Text PDF PubMed Scopus (895) Google Scholar, 37.De Strooper B. Annaert W. Cupers P. Saftig P. Craessaerts K. Mumm J.S. Schroeter E.H. Schrijvers V. Wolfe M.S. Ray W.J. Goate A. Kopan R. Nature. 1999; 398: 518-522Crossref PubMed Scopus (1800) Google Scholar, 38.Mumm J.S. Schroeter E.H. Saxena M.T. Griesemer A. Tian X. Pan D.J. Ray W.J. Kopan R. Mol. Cell. 2000; 5: 197-206Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar, 39.Struhl G. Greenwald I. Nature. 1999; 398: 522-525Crossref PubMed Scopus (702) Google Scholar, 40.Konietzko, U., Goodger, Z. V., Meyer, M., Kohli, B. M., Bosset, J., Lahiri, D. K., and Nitsch, R. M. (2008) Neurobiol. Aging, in pressGoogle Scholar, 41.Xu M. Cook P.R. J. Cell Biol. 2008; 181: 615-623Crossref PubMed Scopus (114) Google Scholar). Presenilin (PS), an aspartyl protease, is the catalytic subunit of the γ-Secretase complex (42.De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1552) Google Scholar, 43.Wolfe M.S. Xia W. Ostaszewski B.L. Diehl T.S. Kimberly W.T. Selkoe D.J. Nature. 1999; 398: 513-517Crossref PubMed Scopus (1692) Google Scholar). Two different genes encode PS1 and PS2, respectively, which each integrate into different γ-Secretase complexes (44.De Strooper B. Neuron. 2003; 38: 9-12Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar). Although many γ-Secretase substrates have been discovered (reviewed by Kopan (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar)), the extent to which the released intracellular domain fragments are important for signaling is not completely clear as most of the work is based on in vitro experiments. Thus, the possibility exists that, in many cases, the γ-Secretase could act as an “intramembrane proteasome,” removing residual transmembrane protein fragments that were generated by for instance, ectodomain shedding mediated by ADAM members, to avoid creating a bottleneck in the plasma membrane (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar). Here we demonstrate the surprising finding that ADAM10, apart from its central role in protein shedding and the initiation of regulated intramembrane proteolysis of several substrates, is itself subject to a similar proteolytic cascade. This suggests that ADAM10 has, in addition to its important function as a membrane-tethered sheddase, also the potential to be a signal transducing protein itself. Animals, Cell Cultures, and Tissues—Mice and derived cell lines and the technique used for their derivation and maintenance were as published (17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar, 45.Hartmann D. Tournoy J. Saftig P. Annaert W. De Strooper B. J. Mol. Neurosci. 2001; 17: 171-181Crossref PubMed Scopus (64) Google Scholar, 46.Nyabi O. Bentahir M. Horre K. Herreman A. Gottardi-Littell N. Van Broeckhoven C. Merchiers P. Spittaels K. Annaert W. De Strooper B. J. Biol. Chem. 2003; 278: 43430-43436Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Primary murine glial and cortical neuronal cultures were established from brains of embryonic day 14.5 mice, as described previously (47.Cai D. Qiu J. Cao Z. McAtee M. Bregman B.S. Filbin M.T. J. Neurosci. 2001; 21: 4731-4739Crossref PubMed Google Scholar). cDNA Constructs—Full-length murine ADAM9 and ADAM15 as well as ADAM9EA and ADAM15EA catalytically inactive mutant constructs were kind gifts from C. P. Blobel (48.Kratzschmar J. Lum L. Blobel C.P. J. Biol. Chem. 1996; 271: 4593-4596Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 49.Weskamp G. Kratzschmar J. Reid M.S. Blobel C.P. J. Cell Biol. 1996; 132: 717-726Crossref PubMed Scopus (184) Google Scholar). ADAM10 cDNA (complete cds of GenBank™ sequence AF011379) was obtained by PCR from a murine 129/SvJ cDNA library and was recloned into a modified PSG5 expression vector (Stratagene). A VP16-Gal4 sequence (50.Annaert W.G. Esselens C. Baert V. Boeve C. Snellings G. Cupers P. Craessaerts K. De Strooper B. Neuron. 2001; 32: 579-589Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar) was subcloned into mADAM10 cDNA after introduction of an HpaI restriction site in the ADAM10 C terminus via site-directed mutagenesis (Stratagene) at positions G745V,H746N. A mADAM10 construct lacking the ectodomain (containing a signal peptide sequence (amino acids 1-19) joined to amino acids 669-749) was FLAG-tagged (CTTGTCATCGTCGTCCTTGTAGTC) before the stop codon at the C terminus. The PCR product was ligated into a pcDNA3.1 vector (ADAM10ΔE-flag). All constructs were sequenced and contained no errors. For COS and HEK293 cell transfections we used FuGENE 6 (Roche) or Genejuice (Merck Biosciences), according to the manufacturer's protocol. Sample Preparation—Cell extracts were obtained as described before (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). Phenanthroline was added to the protease inhibitor mixture to prevent autocleavage during the extraction procedure, as previously described for TACE (51.Schlondorff J. Becherer J.D. Blobel C.P. Biochem. J. 2000; 347: 131-138Crossref PubMed Scopus (312) Google Scholar). The γ-Secretase inhibitor X (carbamic acid tert-butyl ester L-685,458, Calbiochem) was used at 0.1 μm in medium with 2% fetal calf serum, unless otherwise specified (52.Shearman M.S. Beher D. Clarke E.E. Lewis H.D. Harrison T. Hunt P. Nadin A. Smith A.L. Stevenson G. Castro J.L. Biochemistry. 2000; 39: 8698-8704Crossref PubMed Scopus (367) Google Scholar). Membrane extracts and whole protein extracts were prepared as described previously (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar). Shedding Assay—After 24 h of serum starvation (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar) culture medium was replaced with fresh serum-free medium containing one of the following protease inhibitors (Calbiochem): TAPI-1 (25 μm), TAPI-2 (25 μm), GM6001 (50 μm), or the appropriate vehicle control. Following 24 h incubation cell viability was checked, cell extracts were obtained, and cell culture supernatants were concentrated ×20 by ultrafiltration (Centricon-10/Millipore). α-Secretase Fluorescence Resonance Energy Transfer Assay—Cell extracts and concentrated supernatant of ADAM10-/- and WT MEFs, after overnight conditioning in serum-free medium, were incubated with a fluorogenic substrate peptide mimicking the APP α-secretase cleavage site as indicated by the manufacturer (R&D Systems). Fluorogenic emission was measured by Victor2 (PerkinElmer Life Sciences) at 495 nm. Subcellular Fractionation—Postnuclear supernatants were prepared using a sucrose step gradient protocol (adapted from Fleischer and Kervina (54.Fleischer S. Kervina M. Methods Enzymol. 1974; 31: 6-41Crossref PubMed Scopus (362) Google Scholar)). Pooled cells from five 10-cm culture dishes, after 1.5 h treatment with 20 ng/ml leptomycin B (Sigma) (52.Shearman M.S. Beher D. Clarke E.E. Lewis H.D. Harrison T. Hunt P. Nadin A. Smith A.L. Stevenson G. Castro J.L. Biochemistry. 2000; 39: 8698-8704Crossref PubMed Scopus (367) Google Scholar), were harvested and homogenized in ice-cold buffer (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 0.25 m sucrose with 0.2 m dithiothreitol, protease inhibitors, without EDTA) using a glass Dounce homogenizer (type S). Cell disruption and integrity of nuclei were checked. SHM2.1 (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 2.1 m sucrose) was added to the homogenate to obtain a final sucrose concentration of 1.5 m and after centrifugation at 29,000 × g (TST41), the pellet was resuspended in SHM 0.25 (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 0.25 m sucrose). Fractions were collected and analyzed by Western blotting. SDS-PAGE proteins were separated and transferred as described before (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). Primary antibodies (overnight at 4 °C) and horseradish peroxidase-tagged (Dako) secondary antibodies (1 h at room temperature) were applied. ADAM10 was detected using the polyclonal antiserum (B42.1), generated against the 17 C-terminal amino acid residues (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). N-terminal-specific antibody MAB946 (R&D Systems) only detected ADAM10 when sample buffer contained 1 μm N-ethylmaleimide (Pierce) instead of β-mercaptoethanol (55.Partis M.D. J. Prot. Chem. 1983; 2: 263-277Crossref Scopus (147) Google Scholar). APP fragments, PS1, PS2, and ADAM15 were detected, respectively, using antibodies B63.1, B19.3, B22.4, and SM86-2, as described previously (56.Herreman A. Hartmann D. Annaert W. Saftig P. Craessaerts K. Serneels L. Umans L. Schrijvers V. Checler F. Vanderstichele H. Baekelandt V. Dressel R. Cupers P. Huylebroeck D. Zwijsen A. Van Leuven F. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11872-11877Crossref PubMed Scopus (436) Google Scholar, 57.Horiuchi K. Weskamp G. Lum L. Hammes H.P. Cai H. Brodie T.A. Ludwig T. Chiusaroli R. Baron R. Preissner K.T. Manova K. Blobel C.P. Mol. Cell. Biol. 2003; 23: 5614-5624Crossref PubMed Scopus (154) Google Scholar). ADAM9 and Sp1 (Santa Cruz) and β-actin (Sigma) were detected by commercial antisera. Blots were developed using the ECL Detection System (Amersham Biosciences) or SuperSignal (Pierce). Signal densities were quantified (in the linear range) with Totallab version 2.01 (GE Healthcare). Luciferase Assay—COS cells were transfected with 200 ng of pFRluc plasmid (Promega) DNA and 200 ng of inducer plasmid DNA: ADAM10-VP16-GAL4, APP-C99-GAL4-VP16, GAL-VP16, or empty vector. The GAL4-VP16 construct without a membrane anchor was used as a γ-Secretase independent positive control. After 24 h, cells were incubated with or without inhibitor X, and after 16 h were lysed and assayed (Victor2; PerkinElmer Life Sciences) (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar). Confocal Laser Scanning Microscopy—HEK293 cells transfected with ADAM10ΔE-flag were fixed after 24 h in 1% paraformaldehyde (10 min at room temperature), permeabilized by methanol (-20 °C) or 0.5% Triton X-100/phosphate-buffered saline (5 min), and processed for indirect immunofluorescence (50.Annaert W.G. Esselens C. Baert V. Boeve C. Snellings G. Cupers P. Craessaerts K. De Strooper B. Neuron. 2001; 32: 579-589Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). Primary antibodies (overnight at 4 °C) and Alexa 488- or 568-conjugated (Molecular Probes, Inc) or Cy3-(shown in red) or Cy2-conjugated (shown in green) (Jackson ImmunoResearch) secondary antibodies (1 h at room temperature) were applied and nuclei were counterstained using Hoechst Bisbenzimid H33342 (Sigma) (10 min at room temperature). Monoclonal M2 and polyclonal anti-FLAG antibodies, as well as antibodies detecting PML, coilin, bromodeoxyuridine, and nucleophosmin/B23 were purchased from Sigma. Antibodies against lamin B and sc-35 were purchased from Santa Cruz and BD Transduction Laboratories, respectively. Coverslips were mounted using Mowiol (Calbiochem). After staining, cells were examined using an inverted microscope (Eclipse E800, Nikon; Plan Apo ×60/1.40 oil) connected to a confocal microscope (Radiance 2100; Zeiss or Leica SP2) and images were acquired using LaserSharp 2000 software. Images were processed in Adobe Photoshop CS. Speckled nuclei were defined as cells containing 3 or more large or 5 or more small granular “speckle-like” structures in their nucleus. 100 FLAG-positive cells were counted manually in a blind fashion to quantify the effect of γ-secretase inhibition (overnight at 37 °C). The number of speckled cells (mean of three experiments) is indicated as a percentage of the amount of ADAM10ΔE-flag-transfected cells. Statistical Analysis—Data were subjected to statistical analysis (one-way analysis of variance with a Bonferroni correction) to determine their significance. p values are demonstrated in the figures using asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001). The ADAM10 Ectodomain Is Shed from Fibroblasts in Vitro—In Western blots of whole cell homogenates, ADAM10 appears as a doublet band of ∼85 and 65 kDa, corresponding to the unprocessed pro-form and the mature enzyme, respectively (58.Anders A. Gilbert S. Garten W. Postina R. Fahrenholz F. FASEB J. 2001; 15: 1837-1839Crossref PubMed Scopus (187) Google Scholar). In addition a band at ∼10 kDa is observed that reacts exclusively with C terminus-specific antibodies (ADAM10 CTF, Fig. 1, A and B). It is noteworthy that in some experiments the ADAM10 CTF appears as a doublet band (e.g. Fig. 2B, fourth panel). In the culture supernatant samples of the cells, we also observed a soluble protein at ∼55 kDa that was immunoreactive with antibodies against the ADAM10 N terminus but not C terminus (soluble = sADAM10, Fig. 1B). These bands were undetectable in cell extracts and supernatants from ADAM10-/- MEFs (Fig. 1B). Thus, ADAM10 is apparently processed by an unknown protease generating a membrane-bound C-terminal fragment and a secreted, soluble ectodomain. We checked whether the ADAM10 ectofragment shed in the medium retained its proteolytic activity. The supernatant of wild-type MEFs cleaves a synthetic peptide containing the α-secretase cleavage site of APP in a fluorescence resonance energy transfer assay. This activity is strongly reduced in supernatant of MEFs lacking ADAM10 (Fig. 1C). In separate experiments we could demonstrate that removal of ADAM10 from the supernatant by immunoprecipitation also reduces significantly proteolytic activity (data not shown). ADAM10 CTFs were also observed in cell lysates of cultured neurons and astrocytes (Fig. 1D) and in vivo in brain, liver, lung, heart, and kidney tissue from both embryo (Fig. 1E) and adult mice (data not shown). As shown in Fig. 1E, considerable differences in ADAM10 processing are observed in different tissues. In particular the heart (which is strongly affected by ADAM10 deficiency, see Ref. 15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar) displays an abundant accumulation of the ADAM10 CTF. ADAM10 Shedding Depends on ADAMs 9 and 15—To identify the proteases responsible for ADAM10 shedding, we screened wild-type MEF cultures with a panel of inhibitors against all major classes of proteases, but only the metalloprotease inhibitors GM6001, TAPI1, and TAPI2 reduced ADAM10 CTF and sADAM10 accumulation in MEFs, suggesting that the ADAM10 sheddase(s) belong(s) to the metalloprotease family (Fig. 2A). Members of the ADAM family are known to be important ectodomain shedding metalloproteases. So far, only 12 of the 38 ADAMs have demonstrated (ADAMs 8, 9, 10, 12, 17, 19, and 28) or predicted (ADAMs 15, 20, 21, 30, and 33) active MP domains. Consequently, we investigated ADAM10 shedding in MEF cell lines deficient in expression of ADAMs 9, 15, and 19 and cell lines deficie

Referência(s)