Portal de Periódicos da CAPES

Characterization of a Phenobarbital-responsive Enhancer Module in Mouse P450 Cyp2b10 Gene

1997; Elsevier BV; Volume: 272; Issue: 23 Linguagem: Inglês

10.1074/jbc.272.23.14943

1083-351X

Paavo Honkakoski, Masahiko Negishi,

Computational Drug Discovery Methods

Induction of drug- and carcinogen-metabolizing cytochrome P450s by xenobiotic chemicals is a common cellular defense mechanism, usually leading to increased detoxification of xenobiotics but sometimes, paradoxically, to formation of more toxic and carcinogenic metabolites. Phenobarbital (PB) is an archetypal representative for chemicals including industrial solvents, pesticides, plant products, and clinically used drugs that induce several genes within CYP subfamilies 2B, 2A, 2C, and 3A in rodents and humans. Although the transcription of these CYP genes is activated by PB, the associated molecular mechanisms have not yet been elucidated. Here we have analyzed, in detail, enhancer activity of a far upstream region of mouse Cyp2b10 gene and report a 132-base pair PB-responsiveenhancer module (PBREM) with a 33-base pair core element containing binding sites for nuclear factor I- and nuclear receptor-like factors. Mutations of these binding sites abolish the ability of PBREM to respond to inducers in mouse primary hepatocytes. Induction of drug- and carcinogen-metabolizing cytochrome P450s by xenobiotic chemicals is a common cellular defense mechanism, usually leading to increased detoxification of xenobiotics but sometimes, paradoxically, to formation of more toxic and carcinogenic metabolites. Phenobarbital (PB) is an archetypal representative for chemicals including industrial solvents, pesticides, plant products, and clinically used drugs that induce several genes within CYP subfamilies 2B, 2A, 2C, and 3A in rodents and humans. Although the transcription of these CYP genes is activated by PB, the associated molecular mechanisms have not yet been elucidated. Here we have analyzed, in detail, enhancer activity of a far upstream region of mouse Cyp2b10 gene and report a 132-base pair PB-responsiveenhancer module (PBREM) with a 33-base pair core element containing binding sites for nuclear factor I- and nuclear receptor-like factors. Mutations of these binding sites abolish the ability of PBREM to respond to inducers in mouse primary hepatocytes. The cytochrome P450s (CYPs) 1The abbreviations used are: CYP, cytochrome P450; CAT, chloramphenicol acetyltransferase; 3,3′-DCP, 1,4-bis[2-(3-chloropyridyloxy)]benzene; NFI, nuclear factor I; NR, nuclear receptor; PB, phenobarbital; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene; tk, thymidine kinase; PBREM, PB-responsive enhancer module; bp, base pair; kbp, kilobase pair. 1The abbreviations used are: CYP, cytochrome P450; CAT, chloramphenicol acetyltransferase; 3,3′-DCP, 1,4-bis[2-(3-chloropyridyloxy)]benzene; NFI, nuclear factor I; NR, nuclear receptor; PB, phenobarbital; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene; tk, thymidine kinase; PBREM, PB-responsive enhancer module; bp, base pair; kbp, kilobase pair. comprise a superfamily of heme-thiolate proteins (1Nebert D.W. Gonzalez F.J. Annu. Rev. Biochem. 1987; 56: 945-993Google Scholar) with diverse functions from the synthesis and degradation of steroid hormones and fatty acid derivatives to metabolism of xenobiotic chemicals such as drugs, industrial chemicals, environmental pollutants, and carcinogens (2Waterman M. John M.E. Simpson E.R. Ortiz de Montellano P.R. Cytochrome P450: Structure, Mechanism, and Biochemistry.Plenum Press. 1986; : 345-386Google Scholar, 3Escalente B. Erlij D. Falck J.R. McGiff J.C. Science. 1991; 251: 799-802Google Scholar, 4Guengerich F.P. Cancer Res. 1988; 48: 2946-2954Google Scholar, 5Conney A.H. Pharmacol. Rev. 1967; 19: 317-366Google Scholar). Induction of P450s by xenobiotic chemicals is a common phenomenon, conserved throughout the vertebrate kingdom, insects, and bacteria. Xenobiotic inducers can be sorted into distinct classes based on the subsets of P450s induced (6Snyder R. Remmer H. Pharmacol. & Ther. 1979; 7: 203-244Google Scholar, 7Whitlock J.P. Annu. Rev. Pharmacol. Toxicol. 1986; 26: 333-369Google Scholar); for instance, polycyclic aromatic hydrocarbons and peroxisome proliferators are known to activateCYP1A and CYP4A genes through ligand-dependent aryl hydrocarbon and peroxisome proliferator-activated receptors, respectively (7Whitlock J.P. Annu. Rev. Pharmacol. Toxicol. 1986; 26: 333-369Google Scholar, 8Palmer C.N.A. Hsu M.-H. Muerhoff A.S. Griffin K.J. Johnson E.F. J. Biol. Chem. 1994; 269: 18083-18089Google Scholar). For many otherCYP genes and the majority of xenobiotics, however, the molecular basis of induction is virtually unknown (1Nebert D.W. Gonzalez F.J. Annu. Rev. Biochem. 1987; 56: 945-993Google Scholar, 7Whitlock J.P. Annu. Rev. Pharmacol. Toxicol. 1986; 26: 333-369Google Scholar, 9Porter T.D. Coon M.J. J. Biol. Chem. 1991; 266: 13469-13472Google Scholar). Phenobarbital (PB) represents a large number of structurally unrelated chemicals that induce the same set of CYP genes including members within subfamilies 2A, 2B, 2C, and 3A, with CYP2Bforms being activated most effectively (for review, see Ref. 10Waxman D.J. Azaroff L. Biochem. J. 1992; 281: 577-582Google Scholar). PB also induces various transferases and enzymes of heme metabolism and affects processes of cell growth and cell-cell communication (10Waxman D.J. Azaroff L. Biochem. J. 1992; 281: 577-582Google Scholar). The signaling pathways through which PB acts to regulate the induction process of CYP genes are mostly unknown due to the loss of PB response in hepatoma cells and the lack of other reliable in vitro assays. Also, the findings on PB-responsive DNA regulatory elements of these CYP genes have been quite inconsistent (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar, 12Ramsden R. Sommer K. Omiecinski C.J. J. Biol. Chem. 1993; 268: 21722-21726Google Scholar, 13Fournier T. Medjoubi N. Lapoumaroulie C. Hamelin J. Elion J. Durand G. Porquet D. J. Biol. Chem. 1994; 269: 27175-27178Google Scholar, 14He J.-S. Fulco A.J. J. Biol. Chem. 1991; 266: 7864-7869Google Scholar, 15Shephard E.A. Forrest L.A. Shervington A. Fernandez L.M. Ciaramella G. Phillips I.R. DNA Cell Biol. 1994; 13: 793-804Google Scholar, 16Prabhu L. Upadhya P. Ram N. Nirodi C.S. Sultana S. Vatsala P.G. Mani S.A. Rangarajan P.N. Surolia A. Padmanaban G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9628-9632Google Scholar). We have addressed the above problems by developing a primary hepatocyte culture in which both endogenous and transfectedCyp2b10 genes remain transcriptionally inducible by PB-like chemicals (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Using this culture system, we now identify and dissect a PB-responsive enhancer module PBREM from the mouse Cyp2b10gene and show that binding sites for both nuclear factor I- and nuclear receptor-like factors are involved in induction. The 177-bp Cyp2b10 DNA fragment (−2426/−2250 bp) from plasmid BglPst4 (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) was amplified using primers 2B10-S (5′ cagggatccTGTCTGGATCAGGACACA) and 2B10-AS (5′ cagggatccTCAGTGCCAGATCAACCA). Cyp2b9 gene DNA fragment (−898/−765 bp) (18Lakso M. Masaki R. Noshiro M. Negishi M. Eur. J. Biochem. 1991; 195: 477-486Google Scholar) was amplified from BamHI-digested CD-1 mouse genomic DNA (2 μg) with primers 2B9-S (5′ cttggatccATTAAAATCTGGTTACCAAGGAGGAAGAAAAGA) and 2B9-AS (5′ cttggatccCCAGCTTTGCAGGAGCAAAATCCTGGTGTCATT). The amplified DNAs were digested with BamHI and ligated into BamHI site of pBLCAT2 (tkCAT) plasmid (19Luckow B. Schütz G. Nucleic Acids Res. 1987; 15: 5490Google Scholar). Various deletions ofCyp2b10 177-bp fragment (depicted in Fig. 3) were done using appropriate 20–24-mer primers harboring a BamHI site at 5′-ends for cloning as above. Internal deletions of elements pB′ and pC were generated using primers 2B10-S, 2B10-AS, and 20-mer primers with a 5′-end EcoRI site annealing to elements pB, pB′, pC, and pD. In wild-type Cyp2b10 fragment, this resulted in a 3-bp mutation (−2336 GTACTT to GaAtTc) without any change in the spacing between elements pB′ and pC. All mutations from the wild-type sequence shown hereafter are indicated by underlined, lowercase characters. To expedite the mutation of pC, the spacer region between pC and pD was first changed to an XbaI site (−2298 GCCTGA to tCtaGA), and pC was then mutated by changing six nucleotides from Cyp2b10 sequence to those in corresponding Cyp2b9 position by primer MUT-pC (−799 ctgtctagaAAGTcctTGaTGGCACTGTGtCAAGaTCAGGAAA). Mutagenesis of the minimal enhancer construct pB′-C (−2364/−2297) were done using primers B′-mut1 (−2364 ctgggatccAAACATGGTacagTCGGGCACA), B′-mut2 (−2364 ctgggatccAAACATGGTGATTTCGGtactAGAATCTGT), pC-NFIm (−2297 ctgggatccGCAAGTTGATGcatagACTGTGCCAA), and pC-NRm (−2297 ctgggatccGCAAGTTGATGGTGGCACTGTGCCAAccagAAGAAAGTAC). Plasmids −4300CAT, −1404CAT, and −566CAT were described previously (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Plasmid −2397CAT was constructed by amplifying theCyp2b10 region between −2397 and −1404 bp using proof-reading PfuDNA polymerase and primers containingHindIII sites. The amplified DNA was inserted intoHindIII-digested −4300CAT plasmid. Plasmid −1850CAT was generated from −4300CAT by partial PvuII digestion and self-ligation. Appropriate recombinant plasmid DNAs produced inEscherichia coli TG-1 cells were purified twice on CsCl gradients and verified by DNA sequencing over the amplified regions. The quality and supercoiling of plasmid DNAs were checked by agarose gel electrophoresis. Two-month-old C57BL/6 males were purchased from Jackson Laboratory (Bar Harbor, MA). About 25 × 106mouse hepatocytes were electroporated with 30 μg each of individual enhancer/tkCAT reporter plasmids including 10 μg of pSVβgal control plasmid (Promega) to normalize results between different plasmid DNAs as described previously (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Equal aliquots from a transfected cell pool were dispensed into four 60-mm dishes to assure identical transfection efficiencies among treatments (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar), unattached cells were removed after 30 min, and dishes (about 3 × 106cells) were incubated with or without inducers for 24 h in Williams' E-based medium (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) with supplemental 30 mmpyruvate. Cell extracts (20Pothier F. Ouellet M. Julien J.P. Guerin S.L. DNA Cell Biol. 1992; 11: 83-90Google Scholar) were assayed for protein (21Bradford M.M. Anal. Biochem. 1976; 72: 248-254Google Scholar) and β-galactosidase (22Alam J. Cook J.L. Anal. Biochem. 1990; 188: 245-254Google Scholar), heat-treated for 20 min and assayed for CAT activity (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar), and quantitated by radioisotope imager (Molecular Dynamics). Generally, cell aliquots from the same batch of isolation gave very similar transfection efficiencies as determined from pilot experiments with pSVCAT and pSVβgal control plasmids, as also found by other investigators using electroporation (23LeCam A. Pantescu V. Paquereau L. Legraverend C. Fauconnier G. Asins G. J. Biol. Chem. 1994; 269: 21532-21539Google Scholar). For mRNA analyses, cells were lysed using Trizol reagent (Life Technologies, Inc.) after 8 h of treatment, and total RNA samples (10 μg) were subjected to Northern blot analysis with 32P-labeled 360-bp CYP2B10 and 180-bp mouse albumin cDNA probes (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Crude nuclear extracts (24Hattori M. Tugores A. Veloz L. Karin M. Brenner D.A. DNA Cell Biol. 1990; 9: 777-781Google Scholar) from control and PB-treated mouse livers were enriched through heparin-agarose columns to remove endogenous DNase activity (25Yoshioka H. Lang M.A. Wong G. Negishi M. J. Biol. Chem. 1990; 265: 14612-14617Google Scholar). DNase I protection assays were performed with 32P-end-labeled 177-bpCyp2b10 DNA fragments or pB′-C variants (5 × 104 cpm/lane), enriched nuclear extracts (up to 10 μg) and DNase I (0.5 units) adjusted to equal total protein with bovine serum albumin, incubated at room temperature for 20 min, and processed as before (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Gel shift assays were performed using 3 μg of crude nuclear extract in 10 μl of 10 mm Hepes, pH 7.6, 0.5 mm dithiothreitol, 15% glycerol, 2 μg poly(dI-dC), 0.05% Nonidet P-40, 50 mmNaCl, and about 30,000 cpm of 32P-end-labeled oligonucleotide probe. The free and protein-bound probes were separated on 5% acrylamide gels in 0.5 × Tris-Borate-EDTA buffer prior to autoradiography. The top strands of the probes used were: PBRE, 5′ TTAGCAAGAGGGAAGGTCAGAGAAC; PBRE NRm, 5′ TTAGCAAGAGGGAAccTCAGAGAAC; pC wt, 5′ TACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTG; pC NFIm, 5′ TACTTTCCTGACCTTGGCACAGTctatgCATCAACTTG; pC NRm, 5′ TACTTTCCTGAggTTGGCACAGTGCCACCATCAACTTG; and pC dm, 5′ TACTTTCCTGAggTTGGCACAGTctatgCATCAACTTG. Our previous reporter gene assays using various deletion constructs of the Cyp2b10 gene indicated that induction of CAT activity was 2–3-fold when using either −4300CAT or −1404CAT plasmids. The inducibility was lost and the basal CAT activity increased more than 10-fold when sequences downstream of −775 bp were included (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). These results were confirmed by the experiments depicted in Fig. 1. −4300CAT gave 3.1-fold induction, close to previously observed values (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Notably, the CAT activity from −2397CAT plasmid was induced even further, by 7.6-fold in three different experiments with mouse primary hepatocytes. Removal of the −2397/−1850-bp or the −1850/−1404-bp DNA fragments attenuated the induction to 2.8- and 2.3-fold, respectively. The −566CAT plasmid produced high basal, non-inducible CAT activity as found before (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). These findings indicate that Cyp2b10 gene may contain two regions involved in PB induction, the previously described −1404/−971-bp region (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) and the stronger −2397/−1850-bp region. Trottier et al. (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar) showed that a 163-bpSau3AI-Sau3AI fragment within the −2.3-kb region of the rat CYP2B2 gene conferred a 3.5–6.6-fold PB inducibility to a tkCAT reporter in rat hepatocytes, but no further analysis of this enhancer or its associated factors was reported (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar). Since we found that the −2397/−1850-bp Cyp2b10 DNA fragment mediated PB induction and contains sequences overlapping with the rat 163-bp fragment, we cloned the DNA homologous to the rat 163-bp sequence from the mouse Cyp2b10 gene and found that its identity to CYP2B2 163-bp fragment is 91%, which is higher than the overall 83% identity in 5′-flanking region (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). The corresponding fragment from non-inducible mouse Cyp2b9 gene exhibited a lower 70% identity (Fig. 2 A). We then performed DNase I protection assays with the 177-bpCyp2b10 DNA and identified three weakly protected (pA, pB, and pB′) and three strongly protected (pC, pD, and pE) nuclear protein binding regions (Fig. 2 B; also see Fig. 2 A,bracketed areas). None of these six regions displayed any noticeable differences in binding patterns between control and PB-treated mouse nuclear extracts in gel shift assays (Fig.2 C) or in footprint assays (not shown). These findings suggest that pre-existing DNA-binding factors are being modified in response to PB or that if distinct DNA-binding species activated by PB really exist, they are not detectable by the DNA and oligonucleotide probes used here. We then examined whether this Cyp2b10 DNA had any PB-inducible enhancer activity in mouse primary hepatocytes. Fig.3 A, top panel, shows that the endogenous CYP2B10 mRNA was strongly increased by PB (lane 2) and TCPOBOP (lane 4) but not by 3,3′-DCP (lane 3), which is an inactive TCPOBOP derivative (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar, 26Kende A.S. Ebetino F.H. Drendel W.B. Sundaralingam M. Glover E. Poland A. Mol. Pharmacol. 1985; 28: 445-453Google Scholar). The mouse albumin mRNA, used as a control, did not respond to the inducers. The same pattern of induction by PB and TCPOBOP (≥ 11-fold) was conferred to the tk promoter by the insertion of 177-bpCyp2b10 DNA (Fig. 3 A, middle panel), whereas the tk promoter alone was not activated by any of the compounds (Fig. 3 A, bottom panel). It is notable that the extent of induction was at least as high as with the −2397CAT construct in Fig. 1. Furthermore, the dose responses of the 177-bpCyp2b10 DNA-driven CAT activity paralleled that of endogenous CYP2B10 mRNA (Fig. 3 B). The maximal levels of CYP2B10 mRNA were achieved with 50 nm TCPOBOP and 0.3 mm PB, which induced CAT activity 6.0- and 8.6-fold, respectively. These results indicate that the mouse 177-bp DNA sequence acts as a PB-responsive enhancer with the same chemical specificity and dose-responsiveness as the endogenous Cyp2b10 gene. These data strongly suggest that the 177-bp DNA element mediates PB inductionin vivo. Since there were at least six DNA regions capable of nuclear protein binding within the 177-bp DNA sequence, we next determined their functional role for PB inducibility. Primary hepatocytes were transfected with various DNA deletions linked to tkCAT reporter plasmid (Fig.4). The deletion of pA had only slight effects on the basal activity or inducibility (compare lanes 1and2, and 5 and 7). Depending on the presence of other elements, the deletion of pE tended to decrease the inducibility by elevating the basal activity about 2-fold at most (compare lanes 1 and 4, and 2 and6). Due to high basal activity of construct −2364/−2250 (lane 3), deletion of pE in this case actually increased the -fold inducibility (compare lanes 3 and 8). The simultaneous removal of pA and pE decreased the inducibility only by 25% (compare lanes 1 and 7). These results suggest that the elements pA and pE do not have a major role in the function of the 177-bp Cyp2b10 enhancer. The removal of pB attenuated the induction response by 40–60%, mostly due to increases in the basal CAT activity (e.g. compare lanes 2and 3, and 7 and 9). The deletion of pD also attenuated the induction response by 25–50% due to decreases in induced CAT activity but without affecting the basal levels (compare lanes 4 and 5, 6 and7, and 8 and 9). Finally, the construct −2364/−2297 reproducibly displayed about 3-fold induction indicating that regions pB′ plus pC harbored the inducer-dependent DNA segment (lane 9). However, neither pB′ nor pC alone could confer any significant inducibility to the tk promoter (Fig. 4, lanes 10 and11), suggesting that sequences within both regions are required for induction response. When multimerized DNA fragments were inserted in front of the tk promoter, CAT activity was induced about 2-fold with pC but less with pB′ (lanes 12and13). Although the extent of induction was too low to draw a definite conclusion, pC appeared to have a more central role than pB′ in the observed enhancer activity of the pB′-C construct. Consistent with this notion, the most dramatic loss of inducibility (from 6.8- to 1.4-fold) was observed when pC was deleted from the 177-bpCyp2b10 DNA (lanes 14 and 16). The importance of pB′ for enhancer activity was also confirmed by the fact that deletion of pB′ attenuated the induction to 2.1-fold (lane 15). In addition to these results, we found that the 177-bpCyp2b10 DNA conferred PB inducibility also to SV40 and proximal Cyp2b10 (−64CAT) (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) promoters, regardless of its orientation or distance from promoter (data not shown), indicating that the 177-bp Cyp2b10 DNA is a functional enhancer. In summary, our data suggest that pC and pB′ have a major role in determining the inducibility while pB and pD also contribute to the full enhancer activity by modulating the basal and PB-induced activity levels, respectively. Because of this multifactorial nature, we designate the 132-bp Cyp2b10 fragment (−2397/−2265 bp) as thePhenobarbital ResponsiveEnhancer Module (PBREM). The mouse Cyp2b9 gene encodes the female-specific steroid 16α-hydroxylase (18Lakso M. Masaki R. Noshiro M. Negishi M. Eur. J. Biochem. 1991; 195: 477-486Google Scholar), which is related to Cyp2b10 but not induced by PB (27Honkakoski P. Kojo A. Lang M.A. Biochem. J. 1992; 285: 979-983Google Scholar). The DNA sequence most similar to PBREM was amplified from the Cyp2b9 gene, linked into tkCAT plasmid, and transfected into mouse hepatocytes. As compared with theCyp2b10 PBREM, the Cyp2b9-derived DNA sequence could not confer any inducibility to the tk promoter-driven CAT activity, indicating that Cyp2b10 PBREM displays the predicted genetic specificity of induction (compare PBREM andCyp2b9 in Fig. 5, A andB). Additionally, the Cyp2b9-driven CAT activity was not increased more than 1.4-fold by TCPOBOP, 3,3′-DCP, or PB (data not shown). Considering these findings and the key role of pC in PBREM function, the sequence of pC was mutated by converting six nucleotides to those in the Cyp2b9 gene while keeping the protected elements pB, pB′, and pD in the Cyp2b10 gene intact. For easier cloning, this was done by first changing the spacer region between pC and pD into an XbaI site, which did not affect the inducibility (PBREM-Xba in Fig. 5, A and B). The subsequent replacement of six nucleotides in Cyp2b10 pC element by corresponding nucleotides in Cyp2b9 gene resulted in the loss of induction of CAT activity (PBREM-mut pC in Fig. 5,A and B), underscoring the importance of pC as the core inducible element within PBREM. The nucleotide sequence of the 33-bp pC fragment contained a perfect nuclear factor I (NFI) binding site (TGGN7CCA) and a putative nuclear receptor (NR) binding motif (AGGTCA). Intriguingly, both binding sites are mutated in the noninducible Cyp2b9 gene, the 5′ NFI motif TGG to TGa, and the NR motif AGGTCA to AGaTCA (Fig.2 A). We mutated the NFI and NR binding sites within the minimal inducible fragment pB′-C (−2364/−2297) and examined how these mutations affected binding of nuclear proteins and inducibility of CAT reporter activity. Fig. 6, A and B indicate that nucleotides including NFI and NR motifs between −2326 and −2300 on top strand (upper panel) and between −2333 and −2304 on bottom strand (lower panel) were protected from DNase I digestion in the wild-type pB′-C DNA. Binding to NFI site was dramatically decreased in pC NFI mutant (−2312 GCCAC toctatg) so that now only NR motif and seven adjoining nucleotides were protected. In addition, a DNase I hypersensitive site appeared at −2310/−2313, just downstream from the NR site (Fig. 6,A and B, solid arrows). Mutation of the NR site (AGGTCA to AccagA) did not affect NFI binding but somewhat reduced the extent of protection at 5′ end of pC at −2332, −2329, and −2326 (Fig. 6, A and B). Thus, the patterns of nuclear protein binding to pC were altered by NFI and NR mutations, whereas a mutation at pB′ had no effect on protection of pC. The altered binding patterns were also confirmed in gel shift assays. Previously, we identified a 25-bp DNA element (−1219/−1195) highly similar to a portion of the 163-bp CYP2B2 fragment identified by Trottier et al. (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar, 17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). This 25-bp probe, here termed PBRE, formed two complexes with liver nuclear extracts (Fig.6 C, lane 1), which could be competed by 50-fold excess of either PBRE or pC oligonucleotides (lanes 2 and4) but not by oligonucleotides containing mutations at NR motifs (lanes 3 and 5). In line with the DNase I protection assay, mutation of NFI motif considerably reduced binding to pC, and the major remaining complex now comigrated with the top PBRE complex (compare lanes 6 and 8). When both NFI and NR motifs were mutated from the pC probe, this major complex disappeared (compare lanes 6and 7). In competition experiments, 50-fold excess of PBRE competed for the formation of faster-migrating complexes of pC which were also abolished by mutation of NR motif in pC (lanes 9–11). Finally, the binding to pC NFI mutant harboring an intact NR site could be competed relatively efficiently by PBRE (lanes 12–14). These results indicate that pC and PBRE appear to bind similar factors, that pC can bind both NFI-like and NR-like factors, and the binding of NR-like factors are dependent on the integrity of the AGGTCA motif. The same mutated DNA fragments used for DNase I protection were used in CAT reporter gene assays (Fig. 7). In five independent transfections, the mutation of NFI binding site reduced the basal CAT activity to 63% and abolished the induction (pC NFIm). The mutation of the NR site increased the basal activity to 221%, but the inducibility was again lost (pC NRm). Mutations of a putative D-binding protein site within pB′ reduced the basal activity but had smaller effects on the induction response (pB′mut1, pB′mut2), confirming the principal role of pC as the core enhancer element. These results are consistent with pC being occupied by at least two factors, NFI- and NR-like proteins. Although both sites are needed to confer inducibility to the minimal pB′-C construct, they appear functionally different, with NFI-like protein acting as an activator and NR-like protein as a repressor, respectively. The barbiturate-regulated induction mechanism of bacterialCYP102 gene is well characterized, with a 17-bp so called Barbie box sequence as the cis-acting element (14He J.-S. Fulco A.J. J. Biol. Chem. 1991; 266: 7864-7869Google Scholar, 28Liang Q. Fulco A.J. J. Biol. Chem. 1995; 270: 18606-18614Google Scholar). The nature of PB-dependent regulatory elements of mammalianCYP genes, on the other hand, has been very controversial. Some studies indicated that Barbie box-like sequences are present in PB-inducible mammalian gene promoters (at −136/−127 bp in rat α1-acid glycoprotein gene and at −89/−73 bp inCYP2B2 gene) and that they bind nuclear proteins in a PB-dependent manner (13Fournier T. Medjoubi N. Lapoumaroulie C. Hamelin J. Elion J. Durand G. Porquet D. J. Biol. Chem. 1994; 269: 27175-27178Google Scholar, 14He J.-S. Fulco A.J. J. Biol. Chem. 1991; 266: 7864-7869Google Scholar). Similar results were reported with CYP2B2 sequences (−98/−68 bp) overlapping the Barbie box (29Upadhya P. Rao M.V. Rangarajan P.N. Padmanaban G. Nucleic Acids Res. 1992; 20: 557-562Google Scholar). Another group found that the CYP2B2 Barbie box was not protected, and two elements at −199/−183 bp and at −72/−31 bp formed nuclear protein complexes that were more abundant after PB administration (15Shephard E.A. Forrest L.A. Shervington A. Fernandez L.M. Ciaramella G. Phillips I.R. DNA Cell Biol. 1994; 13: 793-804Google Scholar). However, these studies have relied mainly onin vitro protein binding or in vitrotranscription experiments. Only one report showed that mutation of the Barbie box eliminated the 1.6-fold induction by PB of rat α1-acid glycoprotein promoter-driven reporter gene in primary hepatocytes (13Fournier T. Medjoubi N. Lapoumaroulie C. Hamelin J. Elion J. Durand G. Porquet D. J. Biol. Chem. 1994; 269: 27175-27178Google Scholar). Several groups have documented that nuclear proteins do not bind to Barbie box-like sequences in α1-acid glycoprotein (30Lee Y.-M. Tsai W.-H. Lai M.-Y. Chen D.-S. Lee S.C. Mol. Cell. Biol. 1993; 13: 432-442Google Scholar,31Ratajczak T. Williams P.M. DiLorenzo D. Ringold G.M. J. Biol. Chem. 1992; 267: 11111-11119Google Scholar) or in mouse (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) and rat CYP2B genes (15Shephard E.A. Forrest L.A. Shervington A. Fernandez L.M. Ciaramella G. Phillips I.R. DNA Cell Biol. 1994; 13: 793-804Google Scholar, 32Luc P.-V.T. Adesnik M. Ganguly S. Shaw P.M. Biochem. Pharmacol. 1996; 51: 345-356Google Scholar, 33Park Y. Kemper B. DNA Cell Biol. 1996; 15: 693-701Google Scholar). Consistent with the absence of any significant protein binding, we found, using DNA transfection assays in primary hepatocytes, that Barbie box-like sequences did not have a major role in basal or PB-induced Cyp2b10 gene transcription (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Later on, it was shown that mutation of a Barbie box-like sequence in the proximalCYP2B2 promoter did not affect PB-inducibility of reporter gene DNA by in situ injection into rat liver (34Park Y. Li H. Kemper B. J. Biol. Chem. 1996; 271: 23725-23728Google Scholar). In contrast to somewhat variable results reported on the proximal regions of CYP2B genes (13Fournier T. Medjoubi N. Lapoumaroulie C. Hamelin J. Elion J. Durand G. Porquet D. J. Biol. Chem. 1994; 269: 27175-27178Google Scholar, 15Shephard E.A. Forrest L.A. Shervington A. Fernandez L.M. Ciaramella G. Phillips I.R. DNA Cell Biol. 1994; 13: 793-804Google Scholar, 16Prabhu L. Upadhya P. Ram N. Nirodi C.S. Sultana S. Vatsala P.G. Mani S.A. Rangarajan P.N. Surolia A. Padmanaban G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9628-9632Google Scholar), recent studies on transgenic mouse lines carrying either 19 or 0.8 kbp of CYP2B25′-flanking sequences (12Ramsden R. Sommer K. Omiecinski C.J. J. Biol. Chem. 1993; 268: 21722-21726Google Scholar) and on transient transfections withCyp2b10 (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar) or CYP2B2 genes (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar, 34Park Y. Li H. Kemper B. J. Biol. Chem. 1996; 271: 23725-23728Google Scholar) suggest that PB responsiveness resides in the distal part of CYP2Bgenes. Transient transfections carried out with the Cyp2b10gene in the present study and functional studies utilizing different methodologies with the rat CYP2B2 gene (11Trottier E. Belzil A. Stoltz C. Anderson A. Gene. 1995; 158: 263-268Google Scholar, 34Park Y. Li H. Kemper B. J. Biol. Chem. 1996; 271: 23725-23728Google Scholar) converge well together, indicating that a PB-responsive element is located around −2.3 kbp region of CYP2B genes. Notably, this region does not contain any Barbie box-like sequences. We have now identified, for the first time, the core PB-inducible element that appears to be a classical enhancer and provided some evidence for associated factors. Interestingly, we did not detect any differences in protein binding to PBREM between the control and PB-treated liver nuclear extracts. This implies that PB might act by modifying pre-existing DNA-binding factors, which is consistent with the insensitivity of CYP2B10 mRNA induction to inhibition of protein synthesis by cycloheximide in this hepatocyte system (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Alternatively, PB might modify the function, affinity, and/or amount of factors associated with the pre-existing DNA-binding proteins. More importantly, we found that the core inducible element is capable of binding NFI- and NR-like factors, both necessary for induction response. We found that NFI and C/EBPα could bind to32P-labeled pC element in gel shift assays since antibodies raised against these transcription factors were able to supershift some of the pC complexes (data not shown). Our previous studies indicated that another PB-responsive element was located in the −1.4/−1.0-kbp region of Cyp2b10 gene although it could not confer PB-inducibility to heterologous promoters in primary hepatocytes (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). We found, however, that this element contained a 25-bp sequence (PBRE), which was very similar to a portion in the rat 163-bp CYP2B2gene fragment and contained an AGGTCA motif. We therefore proposed that a NR-like protein may have a role in PB induction of CYP2Bgenes (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). The PBRE also bears similarity to sequences within the present PBREM. It can be aligned with pB (at −2386/−2362 on top strand) but also with pC (at −2333/−2309 on bottom strand). According to our gel shift assays, factors binding to PBRE appear be related to those occupying the NR site within pC, the DNA region most important for PBREM function. The PB signal, activating the Cyp2b10 gene, may primarily target the NR-binding (repressor) factor rather than the NFI-like (activator) protein for several reasons. First, NFI isoforms are ubiquitous and present in many tissues and cell lines (35Faisst S. Meyer S. Nucleic Acids Res. 1992; 20: 3-26Google Scholar), whereas theCyp2b10 gene induction is liver-specific (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar). Second, NFI binding sites are present, e.g. in mouse albumin (36Izban M.G. Papaconstantinou J. J. Biol. Chem. 1989; 264: 9171-9179Google Scholar), rat tyrosine aminotransferase (37Oddos J. Grange T. Carr K.D. Matthews B. Roux J. Richard-Foy H. Pictet R. Nucleic Acids Res. 1989; 17: 8877-8878Google Scholar), rat CYP2A2 (38Matsunaga T. Nomoto M. Kozak C.A. Gonzalez F.J. Biochemistry. 1990; 29: 1329-1341Google Scholar), and mouseCyp2d9 (39Wong G. Itakura T. Kawajiri K. Skow L. Negishi M. J. Biol. Chem. 1989; 264: 2920-2927Google Scholar) gene promoters, and none of these genes is PB-inducible (17Honkakoski P. Moore R. Gynther J. Negishi M. J. Biol. Chem. 1996; 271: 9746-9753Google Scholar, 40Sidhu J.S. Omiecinski C.J. J. Biol. Chem. 1995; 270: 12762-12773Google Scholar, 38Matsunaga T. Nomoto M. Kozak C.A. Gonzalez F.J. Biochemistry. 1990; 29: 1329-1341Google Scholar, 27Honkakoski P. Kojo A. Lang M.A. Biochem. J. 1992; 285: 979-983Google Scholar). Third, in our unpublished experiments, 2P. Honkakoski and M. Negishi, unpublished results. the PBREM-driven CAT activity was found to be quite high and non-inducible in several continuous cell lines. It may be speculated that the NR-like repressor protein, critical for induction, is missing or inactive in these cell lines. However, as our transfection assays indicate, both NFI-like and NR-like factors are important for the function of PBREM and identification of both factors in further studies is required to elucidate their respective roles in PB-induced gene expression. While the sequence and function of PBREM are well conserved between the rat and mouse CYP2B genes, we did not find identical or highly similar sequences in the reported sequences of PB-inducible genes within families CYP2A, CYP2C, andCYP3A. This may be related to the fact that CYP2Bforms are also the most efficiently induced by PB (7Whitlock J.P. Annu. Rev. Pharmacol. Toxicol. 1986; 26: 333-369Google Scholar, 10Waxman D.J. Azaroff L. Biochem. J. 1992; 281: 577-582Google Scholar). Presuming a key role for a NR-like protein in PB induction, it is possible that divergence of DNA elements such as PBREM in CYP2B genes has resulted in substitution of the NFI site by other CCAAT-like sequences such as C/EBP, CP2, or CP1 sites (35Faisst S. Meyer S. Nucleic Acids Res. 1992; 20: 3-26Google Scholar) or by other transcription factor sites, leading to different organization and perhaps to different efficiency of these DNA elements in other PB-responsive CYPgenes. In this view, we found elements composed of NR- and CCAAT-like binding sites at −2.7/−2.6 and −1.0/−0.9 kbp in CYP2A1gene (38Matsunaga T. Nomoto M. Kozak C.A. Gonzalez F.J. Biochemistry. 1990; 29: 1329-1341Google Scholar); at −2.25/−2.1 kbp, close to a DNase I hypersensitive site in CYP2C1 gene (41Kim J. Kemper B. Biochemistry. 1991; 30: 10287-10294Google Scholar); at −2.2 kbp in CYP2C8 gene (42Ged C. Beaune P. Biochim. Biophys. Acta. 1991; 1088: 433-435Google Scholar), and at −0.65 and −0.15 kbp in CYP3A genes (43Telhada M.B. Pereira T.M. Lechner M.C. Arch. Biochem. Biophys. 1992; 298: 715-725Google Scholar, 44Huss J.M. Wang S.I. Astrom A. McQuiddy P. Kasper C.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4666-4670Google Scholar). The functional role of these elements, reminiscent of PBREM in these PB-inducible genes, remains to be tested. As a pleiotropic inducer, PB may alter gene functions through different pathways and regulatory mechanisms. In this respect, and given the sequence divergence discussed above, it is noteworthy that the extent and kinetics of induction among the PB-responsive genes have been reported to differ (45Kocarek T.A. Schuetz E.G. Guzelian P.S. Mol. Pharmacol. 1990; 38: 440-444Google Scholar, 46Honkakoski P. Auriola S. Lang M.A. Biochem. Pharmacol. 1992; 42: 2121-2128Google Scholar). In conclusion, we have characterized and dissected a multifactorial PB-responsive enhancer at −2.3 kbp in mouse Cyp2b10 gene in primary hepatocytes. In transient transfection assays, the enhancer responds to inducers with identical chemical specificity as the endogenous Cyp2b10 gene. The inducibility of the enhancer is lost by introduction of naturally occurring mutations from the non-inducible Cyp2b9 gene. The function of the enhancer is dependent on the integrity of both nuclear factor I- and nuclear receptor-like sites within a 33-bp core element. Further analysis of PBREM and its binding proteins will provide a central framework that may apply to many other PB-inducible genes. We thank Dr. Cary Weinberger and Dr. Gordon Ibeanu for comments on the manuscript and Mr. Rick Moore for help with liver perfusions and DNA sequencing.