Production of large numbers of plasmacytoid dendritic cells with functional activities from CD34+ hematopoietic progenitor cells: Use of interleukin-3
2012; Elsevier BV; Volume: 40; Issue: 4 Linguagem: Inglês
10.1016/j.exphem.2012.01.002
ISSN1873-2399
AutoresStéphanie Demoulin, Patrick Roncarati, Philippe Delvenne, Pascale Hubert,
Tópico(s)Toxin Mechanisms and Immunotoxins
ResumoPlasmacytoid dendritic cells (pDC), a subset of dendritic cells characterized by a rapid and massive type-I interferon secretion through the Toll-like receptor pathway in response to viral infection, play important roles in the pathogenesis of several diseases, such as chronic viral infections (e.g., hepatitis C virus, human immunodeficiency virus), autoimmunity (e.g., psoriasis, systemic lupus erythematosus), and cancer. As pDC represent a rare cell type in the peripheral blood, the goal of this study was to develop a new method to efficiently generate large numbers of cells from a limited number of CD34+ cord blood progenitors to provide a tool to resolve important questions about how pDC mediate tolerance, autoimmunity, and cancer. Human CD34+ hematopoietic progenitor cells isolated from cord blood were cultured with a combination of Flt3-ligand (Flt3L), thrombopoietin (TPO), and one of the following cytokine: interleukin (IL)-3, interferon-β(IFN-β), or prostaglandin E2(PGE2). Cells obtained in the different culture conditions were analyzed for their phenotype and functional characteristics. The addition of IL-3 cooperates with Flt3L and TPO in the induction of pDC from CD34+ hematopoietic progenitor cells. Indeed, Flt3L/TPO alone or supplemented with prostaglandin E2 or interferon-β produced smaller amounts of pDC from hematopoietic progenitor cells. In addition, pDC generated in Flt3L/TPO/IL-3 cultures exhibited morphological, immunohistochemical, and functional features of peripheral blood pDC. We showed that IL-3, in association with Flt3L and TPO, provides an advantageous tool for large-scale generation of pDC. This culture condition generated, starting from 2 × 105 CD34+ cells, up to 2.6 × 106 pDC presenting features of blood pDC. Plasmacytoid dendritic cells (pDC), a subset of dendritic cells characterized by a rapid and massive type-I interferon secretion through the Toll-like receptor pathway in response to viral infection, play important roles in the pathogenesis of several diseases, such as chronic viral infections (e.g., hepatitis C virus, human immunodeficiency virus), autoimmunity (e.g., psoriasis, systemic lupus erythematosus), and cancer. As pDC represent a rare cell type in the peripheral blood, the goal of this study was to develop a new method to efficiently generate large numbers of cells from a limited number of CD34+ cord blood progenitors to provide a tool to resolve important questions about how pDC mediate tolerance, autoimmunity, and cancer. Human CD34+ hematopoietic progenitor cells isolated from cord blood were cultured with a combination of Flt3-ligand (Flt3L), thrombopoietin (TPO), and one of the following cytokine: interleukin (IL)-3, interferon-β(IFN-β), or prostaglandin E2(PGE2). Cells obtained in the different culture conditions were analyzed for their phenotype and functional characteristics. The addition of IL-3 cooperates with Flt3L and TPO in the induction of pDC from CD34+ hematopoietic progenitor cells. Indeed, Flt3L/TPO alone or supplemented with prostaglandin E2 or interferon-β produced smaller amounts of pDC from hematopoietic progenitor cells. In addition, pDC generated in Flt3L/TPO/IL-3 cultures exhibited morphological, immunohistochemical, and functional features of peripheral blood pDC. We showed that IL-3, in association with Flt3L and TPO, provides an advantageous tool for large-scale generation of pDC. This culture condition generated, starting from 2 × 105 CD34+ cells, up to 2.6 × 106 pDC presenting features of blood pDC. Dendritic cells (DC) represent a major class of professional antigen-presenting cells characterized by their capacity to prime naïve T cells and to initiate primary immune responses [1Banchereau J. Briere F. Caux C. et al.Immunobiology of dendritic cells.Annu Rev Immunol. 2000; 18: 767-811Crossref PubMed Scopus (5533) Google Scholar]. In humans, two major lineages of DC can be distinguished based on differential developmental origins, phenotypes, and anatomical locations: myeloid DC (mDC) and plasmacytoid DC (pDC). Human pDC represent a rare peripheral cell blood population (0.2−0.8%), which can be distinguished from other blood cells based on selective expression of surface antigens BDCA-2 [2Dzionek A. Sohma Y. Nagafune J. et al.BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction.J Exp Med. 2001; 194: 1823-1834Crossref PubMed Scopus (609) Google Scholar, 3Dzionek A. Fuchs A. Schmidt P. et al.BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood.J Immunol. 2000; 165: 6037-6046PubMed Google Scholar] and ILT7 [4Rissoan M.C. Duhen T. Bridon J.M. et al.Subtractive hybridization reveals the expression of immunoglobulin-like transcript 7, Eph-B1, granzyme B, and 3 novel transcripts in human plasmacytoid dendritic cells.Blood. 2002; 100: 3295-3303Crossref PubMed Scopus (190) Google Scholar, 5Cho M. Ishida K. Chen J. et al.SAGE library screening reveals ILT7 as a specific plasmacytoid dendritic cell marker that regulates type I IFN production.Int Immunol. 2008; 20: 155-164Crossref PubMed Scopus (27) Google Scholar]. Immature pDC also express CD4, CD45RA, CD123, and BDCA-4, but lack expression of the lineage markers CD3, CD19, CD14, CD16, and DC marker CD11c. pDC represent key effectors in innate and adaptive immune responses. They selectively express two microbial pattern-recognition receptors (i.e., Toll-like receptor [TLR] 7 and TLR9) and play a major role in antiviral immunity by rapidly producing massive amounts of type-1 interferon (IFN-α/β) after viral stimulation through induction of the TLR pathway [6Reizis B. Bunin A. Ghosh H.S. Lewis K.L. Sisirak V. Plasmacytoid dendritic cells: recent progress and open questions.Annu Rev Immunol. 2011; 29: 163-183Crossref PubMed Scopus (448) Google Scholar, 7Liu Y.J. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.Annu Rev Immunol. 2005; 23: 275-306Crossref PubMed Scopus (1299) Google Scholar]. Other consequences of pDC activation include secretion of cytokines, such as tumor necrosis factor-α and interleukin (IL)-6, and acquisition of antigen presentation ability contributing to the recruitment/activation of other cell types, such as DC, natural killer cells, and T cells [8Swiecki M. Colonna M. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.Immunol Rev. 2010; 234: 142-162Crossref PubMed Scopus (312) Google Scholar, 9Zhang Z. Wang F.S. Plasmacytoid dendritic cells act as the most competent cell type in linking antiviral innate and adaptive immune responses.Cell Mol Immunol. 2005; 2: 411-417PubMed Google Scholar, 10Gilliet M. Cao W. Liu Y.J. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases.Nat Rev Immunol. 2008; 8: 594-606Crossref PubMed Scopus (915) Google Scholar]. pDC fully develop in the bone marrow and migrate into T-cell−rich areas of lymphoid organs through high endothelial venules under steady-state conditions. However, under pathological conditions, pDC are recruited from lymphoid organs to peripheral tissues through the action of different chemokines and adhesion molecules [6Reizis B. Bunin A. Ghosh H.S. Lewis K.L. Sisirak V. Plasmacytoid dendritic cells: recent progress and open questions.Annu Rev Immunol. 2011; 29: 163-183Crossref PubMed Scopus (448) Google Scholar, 11Colonna M. Trinchieri G. Liu Y.J. Plasmacytoid dendritic cells in immunity.Nat Immunol. 2004; 5: 1219-1226Crossref PubMed Scopus (1329) Google Scholar, 12McKenna K. Beignon A.S. Bhardwaj N. Plasmacytoid dendritic cells: linking innate and adaptive immunity.J Virol. 2005; 79: 17-27Crossref PubMed Scopus (294) Google Scholar, 13Sozzani S. Vermi W. Del Prete A. Facchetti F. Trafficking properties of plasmacytoid dendritic cells in health and disease.Trends Immunol. 2010; 31: 270-277Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar]. pDC have attracted a growing interest in recent years and fundamental questions remain concerning their regulation and activities, especially in tolerance, autoimmunity, and cancer. The obtention of pDC in large numbers has proven to be difficult, limiting progress in the understanding of their functions. Here, we describe a simple method for the large-scale generation of pDC exhibiting morphological, immunohistochemical, and functional features of pDC present in the peripheral blood from a limited number of CD34+ cord blood progenitors. Several cytokines, such as IL-3, PGE2, and IFN-β have been shown to be implicated in pDC development, proliferation, and/or survival. IL-3 induces the proliferation of pDC, inhibits their apoptosis [14Encabo A. Solves P. Mateu E. Sepulveda P. Carbonell-Uberos F. Minana M.D. Selective generation of different dendritic cell precursors from CD34+ cells by interleukin-6 and interleukin-3.Stem Cells. 2004; 22: 725-740Crossref PubMed Scopus (25) Google Scholar, 15Grouard G. Rissoan M.C. Filgueira L. Durand I. Banchereau J. Liu Y.J. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand.J Exp Med. 1997; 185: 1101-1111Crossref PubMed Scopus (966) Google Scholar], and has a proliferative effect on CD34+ progenitor cells [16Saeland S. Caux C. Favre C. et al.Combined and sequential effects of human IL-3 and GM-CSF on the proliferation of CD34+ hematopoietic cells from cord blood.Blood. 1989; 73: 1195-1201PubMed Google Scholar, 17Kawano Y. Takaue Y. Hirao A. et al.Synergistic effect of recombinant interferon-gamma and interleukin-3 on the growth of immature human hematopoietic progenitors.Blood. 1991; 77: 2118-2121PubMed Google Scholar, 18Astori G. Malangone W. Adami V. et al.A novel protocol that allows short-term stem cell expansion of both committed and pluripotent hematopoietic progenitor cells suitable for clinical use.Blood Cells Mol Dis. 2001; 27 (discussion 725−717): 715-724Crossref PubMed Scopus (11) Google Scholar]. CD34+ cells cultured with mesenchymal stem cells or their conditioned medium have been shown to increase the number of cells generated and the percentage of pDC in culture through PGE2 production [19Chen L. Zhang W. Yue H. et al.Effects of human mesenchymal stem cells on the differentiation of dendritic cells from CD34+ cells.Stem Cells Dev. 2007; 16: 719-731Crossref PubMed Scopus (82) Google Scholar]. Buelens et al. showed that monocytes cultured in IL-3 and IFN-β give rise to a population of DC showing several characteristics of pDC. Those cells express high levels of CD123 and secreted high levels of IL-6 and tumor necrosis factor−α [20Buelens C. Bartholome E.J. Amraoui Z. et al.Interleukin-3 and interferon beta cooperate to induce differentiation of monocytes into dendritic cells with potent helper T-cell stimulatory properties.Blood. 2002; 99: 993-998Crossref PubMed Scopus (74) Google Scholar]. To determine the best method to generate high amounts of pDC in vitro, we added one of those cytokines (i.e., IL-3, IFN-β, or PGE2) to Flt3 ligand (Flt3L)/thrombopoietin (TPO) CD34+ hematopoietic progenitor cells (HPC) culture as previous studies showed that TPO acts in synergy with Flt3L for the differentiation and the expansion of HPC [21Chen W. Antonenko S. Sederstrom J.M. et al.Thrombopoietin cooperates with FLT3-ligand in the generation of plasmacytoid dendritic cell precursors from human hematopoietic progenitors.Blood. 2004; 103: 2547-2553Crossref PubMed Scopus (100) Google Scholar]. We showed that the conditions Flt3L/TPO, Flt3L/TPO/PGE2, and Flt3L/TPO/IFN-β induced generation of low numbers of pDC. In contrast, TPO, Flt3L, and IL-3 synergistically induce generation of >2.6 × 106 pDC presenting characteristics of peripheral blood pDC from a small initial number of precursor cells (2 × 105 HPC) after 21 days in culture. These findings suggest that, unlike IFN-β and PGE2, IL-3 might represent a key factor in controlling pDC development. Peripheral blood mononuclear cells (PBMC) were isolated from leukocyte-enriched Buffy-coats by centrifugation on Ficoll-Hypaque (Lymphoprep, Axis-Shield, Oslo, Norway). After washing PBMC at low centrifugation speed to discard a maximum of platelets, pDC were sorted by using a negative cell sorting kit following manufacturer’s instructions (Human Plasmacytoid DC Enrichment kit; StemCell Technologies, Vancouver, Canada). CD34+ HPC were isolated from human umbilical cord blood obtained during normal full-term deliveries. This study was approved by the Ethics Committee of the University Hospital of Liege and informed consent was obtained from donors. CD34+ HPC were recovered by Ficoll-Hypaque density-gradient centrifugation (Lymphoprep; Axis-Shield). CD34+ cells were isolated from other mononucleated cells using the MACS Direct CD34 Progenitor Cell Isolation Kit (Miltenyi Biotec GmBH, Bergisch Gladbach, Germany) and MiniMacs separation columns (Miltenyi Biotec), according to manufacturer’s protocol. CD34+ cells were cultured in 24-well plates (Nunc, Roskilde, Denmark) at 2 × 105 cells/mL in RPMI medium supplemented with 10% fetal calf serum, 50 μM β-mercaptoethanol and 1% penicillin-streptomycin, sodium pyruvate, and nonessential amino acid (all purchased from Invitrogen, Merelbeke, Belgium). To obtain pDC differentiation, TPO (50 ng/mL), Flt3L (100 ng/mL), and one of the following recombinant human cytokines: IL-3 (20 ng/mL), IFN-β (1000 U/mL), or PGE2 (15 ng/mL), were added to the medium. All cytokines were purchased from Peprotech (Rocky Hill, NJ, USA) except for PGE2 (Cayman Chemicals, Ann Arbor, MI, USA). Cell cultures were refreshed every 3 days with RPMI medium containing designated cytokines. pDC were isolated by using the Human Plasmacytoid DC Enrichment kit (StemCell Technologies). In some experiments, pDC were stimulated during 24 hours with a CpG oligodeoxynucleotide (ODN) at 12 μg/mL (CpG ODN 2216: 5′-ggGGGACGATCGTCgggggg-3′; Eurogentec, Seraing, Belgium). Flow cytometry studies were performed by using procedures published previously [22Hubert P. Greimers R. Franzen-Detrooz E. et al.In vitro propagated dendritic cells from patients with human-papilloma virus-associated preneoplastic lesions of the uterine cervix: use of Flt3 ligand.Cancer Immunol Immunother. 1998; 47: 81-89Crossref PubMed Scopus (21) Google Scholar] with the following antibodies: CD123-FITC (clone AC145; Miltenyi Biotec), CD11c-allophycocyanin (APC) (clone B-ly6; BD Pharmingen, Franklin Lakes, NJ, USA), BDCA-4-phycoerythrin (PE) (clone AD5-17F6; Miltenyi Biotec), CD40-PE (clone 5C3; BD Pharmingen), CD83-PE (clone HB15e; BD Pharmingen), CD86-PE (clone c2331 (FUN-1); BD Pharmingen), CCR7-PE (clone 150503, R&D Systems, Minneapolis, MN, USA), and HLA-DR-PE (clone AB3; DAKO, Glostrup, Denmark). Fluorescence intensity and positive cell percentages were measured on a FACSCanto (Becton Dickinson, NJ, USA) and data were analyzed using FACSDiva software V 6.1.2 (Becton Dickinson) and FlowJo software (TreeStar, Ashland, OR, USA). One microgram of total RNA extracted from cell cultures (RNeasy mini kit; Qiagen, Valencia, CA, USA) was reverse-transcribed using Superscript II reverse transcriptase (Invitrogen) according to manufacturer’s instructions. Reverse transcription polymerase chain reaction (RT-PCR) were performed using the following primer sequences: TLR9 F: ACTGGAGGTGGCCCCGGG; TLR9 R: CAGGGGTTGGGAGCGTGG; HPRT F: GTTGGATATAGGCCAGACTTTGTTG; and HPRT R: CAGATGTTTCCAAACTCAACTTGAA (Eurogentec). The housekeeping gene HPRT was used as an internal control. Culture supernatants collected from pDC cultures were assessed for IFN-α levels by using an enzyme-linked immunosorbent assay kit according to manufacturer’s instructions (PBL InterferonSource, Piscataway, NJ, USA). pDC migration was evaluated using a chemotaxis microchamber technique (48-well Boyden microchamber; Neuroprobe, Cabin John, MD, USA) [23Herfs M. Herman L. Hubert P. et al.High expression of PGE2 enzymatic pathways in cervical (pre)neoplastic lesions and functional consequences for antigen-presenting cells.Cancer Immunol Immunother. 2009; 58: 603-614Crossref PubMed Scopus (53) Google Scholar]. Human recombinant chemerin (10 pM, 100 pM, 10 nM, or 100 nM; R&D Systems) was added to the lower wells of the chamber. A nonconditioned medium was used as control for random migration. Conditioned medium of human fibroblasts was used as positive control. A polyvinylpyrollidone-free polycarbonate membrane 5-μ gelatin-coated pore filter (Poretics Corp., Livermore, CA, USA) was placed in the microchamber. After cell sorting, 55 μL pDC suspension (2 × 106 cells/mL) was applied into the upper wells of the chamber. The chamber was incubated for 5 hours at 37°C. Cells having migrated to the underside of the filter were fixed and stained with Diff Quick Stain set (Baxter Diagnostics AG, Düdingen, Switzerland). The upperside of the filter was scraped to remove residual nonmigrating cells. One random field was counted per well using an eyepiece with a calibrated grid to evaluate the number of fully migrated cells. The stimulator population consisted of pDC sorted from peripheral blood or Flt3L/TPO/IL-3 culture. Those cells were irradiated at 5000 rads and placed in RPMI 5% human pooled AB serum. Varying numbers of stimulator cells (312−40,000 cells per well) were added to round-bottomed 96-well Nunclon plates containing 2 × 105 allogeneic PBMC per well. A proliferative response was measured after 5 days of culture by adding 1 μCi 3H-thymidine to each well. Cells were harvested 18 hours later using an automated sample harvester (Packard, Canberra, Tilburg, The Netherlands) and counted using a liquid scintillation counter (Top Count, Packard). DCs obtained by culturing adherent fraction of PBMC with IL-4 and granulocyte-macrophage colony-stimulating factor, as described previously [22Hubert P. Greimers R. Franzen-Detrooz E. et al.In vitro propagated dendritic cells from patients with human-papilloma virus-associated preneoplastic lesions of the uterine cervix: use of Flt3 ligand.Cancer Immunol Immunother. 1998; 47: 81-89Crossref PubMed Scopus (21) Google Scholar, 24Sallusto F. Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.J Exp Med. 1994; 179: 1109-1118Crossref PubMed Scopus (4468) Google Scholar], were used as positive control. Cytospins of pDC sorted from peripheral blood or Flt3L/TPO/IL-3 cultures were prepared by spinning (200 rpm, 3 minutes) 1 × 105 cells onto methanol-treated slides. May−Grünwald Giemsa staining was performed using standard procedures and slides were examined using a FSX100 microscope (Olympus, Aartselaar, Belgium). Statistical evaluation of the results was performed using unpaired Student’s t test. Comparisons of means were studied by analysis of variance (ANOVA), followed by a Newman−Keuls multiple comparison test (one-way ANOVA) or a Bonferroni post-test (two-way ANOVA). ANOVA tests were performed on log-transformed data. Differences were considered as statistically significant when p < 0.05. Statistical tests were performed using the GraphPad Prism 5 software (Graph-Pad Software, La Jolla, CA, USA). Previous works showed that TPO cooperates with Flt3L in the generation of pDC from CD34+ HPC [21Chen W. Antonenko S. Sederstrom J.M. et al.Thrombopoietin cooperates with FLT3-ligand in the generation of plasmacytoid dendritic cell precursors from human hematopoietic progenitors.Blood. 2004; 103: 2547-2553Crossref PubMed Scopus (100) Google Scholar]. In this study, we tested the combination of Flt3L (100 ng/mL) and TPO (50 ng/mL) with other growth factors that have been shown to be implicated in pDC development, proliferation, and/or survival, such as IL-3 (20 ng/mL), IFN-β (1000 U/mL), and PGE2 (15 ng/mL) [14Encabo A. Solves P. Mateu E. Sepulveda P. Carbonell-Uberos F. Minana M.D. Selective generation of different dendritic cell precursors from CD34+ cells by interleukin-6 and interleukin-3.Stem Cells. 2004; 22: 725-740Crossref PubMed Scopus (25) Google Scholar, 16Saeland S. Caux C. Favre C. et al.Combined and sequential effects of human IL-3 and GM-CSF on the proliferation of CD34+ hematopoietic cells from cord blood.Blood. 1989; 73: 1195-1201PubMed Google Scholar, 17Kawano Y. Takaue Y. Hirao A. et al.Synergistic effect of recombinant interferon-gamma and interleukin-3 on the growth of immature human hematopoietic progenitors.Blood. 1991; 77: 2118-2121PubMed Google Scholar, 19Chen L. Zhang W. Yue H. et al.Effects of human mesenchymal stem cells on the differentiation of dendritic cells from CD34+ cells.Stem Cells Dev. 2007; 16: 719-731Crossref PubMed Scopus (82) Google Scholar, 25Huang Y.M. Hussien Y. Yarilin D. Xiao B.G. Liu Y.J. Link H. Interferon-beta induces the development of type 2 dendritic cells.Cytokine. 2001; 13: 264-271Crossref PubMed Scopus (43) Google Scholar]. In six different experiments, 2 × 105 CD34+ HPC were incubated in media containing Flt3L/TPO alone or with IL-3, IFN-β, or PGE2 for 28 days. Total numbers of generated cells were determined at periodic intervals between days 14 and 28. Interestingly, IL-3 together with Flt3L and TPO induced a massive expansion of cultured cell numbers from 1.6 × 107 ± 2.4 × 107 cells at day 14, to 7.2 × 107 ± 4.5 × 107 cells at day 21 (Fig. 1). ANOVA tests showed that the number of cells generated in Flt3L/TPO/IL-3 condition was significantly higher at day 21 (p < 0.001) and 28 (p < 0.05) compared with the number of cells generated at day 14 in that condition. In addition, statistical test also showed that, after 21 days of culture, the number of cells generated in Flt3L/TPO/IL-3 condition was significantly higher compared with all the other culture conditions tested (Flt3L/TPO, p < 0.01; Flt3L/TPO/PGE2, p < 0.05; and Flt3L/TPO/IFN-β, p < 0.001). After 28 days of culture, numbers of cells generated in Flt3L/TPO/IL-3 condition was only significantly higher than the Flt3L/TPO/IFN-β (p < 0.05) condition. In three independent experiments, we also analyzed the percentages of hematopoietic cell types present in our culture conditions. Cells were examined for their expression of markers related to pDC (BDCA-4+/CD123+/CD11c−), mDC (CD1a+/CD11c+), T cells (CD3+), natural killer cells (CD3−/CD16+), B cells (CD19+), granulocytes (CD3−/CD11a+/CD14+ and CD3−/CD11a+/CD14−) and monocytes (CD3−/CD11a−/CD14+) by flow cytometry. We showed that mDC, T cells, and granulocytes were the main cell types produced in the different culture conditions (Fig. 2). By using an anti-CD34 antibody we also showed that only a small number of CD34+ HPC remained in the culture medium after 21 days of culture, as in Flt3L/TPO, Flt3L/TPO/IL-3, Flt3L/TPO/PGE2, and Flt3L/TPO/IFN-β conditions, only up to 6.2%, 0.8%, 2%, and 1.3% of cells were CD34+ HPC, respectively (data not shown). At day 14, the maximum yield of pDC was observed using IL-3 in the culture medium. With this condition, 4% ± 1.9% of cells showed a phenotype of fully differentiated pDC (BDCA-4+/CD123+/CD11c−). The range of increase compared with pDC obtained at day 14 in other culture conditions was from >170% to 500%. After long-term cultures (28 days), the percentage of pDC increased and remained the highest in Flt3L/TPO/IL-3 culture (Fig. 2A). Next, we determined the number of immature pDC based on their percentages in culture and showed that the combination of Flt3L, TPO, and IL-3 induced an enhancement in pDC generation. At 14, 21, and 28 days of culture, the number of pDC was higher in Flt3L/TPO/IL-3 condition compared with the other culture conditions (Fig. 3). The highest number of pDC was detected at day 21 in Flt3L/TPO/IL-3 culture (2.6 × 106 ± 1.2 × 106) and the number of pDC was significantly higher in Flt3L/TPO/IL-3 compared with Flt3L/TPO (p < 0.05), Flt3L/TPO/PGE2 (p < 0.05), and Flt3L/TPO/IFN-β (p < 0.01) cultures. These results are concordant with apoptotic tests showing that the Flt3L/TPO/IL-3 condition presents the highest percentages of living cells in culture. Proliferation tests also showed that at day 14, 21, and 28 of culture, cell proliferation was higher in Flt3L/TPO/IL-3 condition than in the other conditions tested. Flt3L/TPO/PGE2 condition was characterized by low percentages of proliferating cells. In addition, IFN-β strongly blocked pDC generation from HPC in Flt3L/TPO culture, as this culture condition was characterized by low percentages of proliferating cells and high numbers of apoptotic cells (data not shown). We showed that Flt3L/TPO/IL-3 condition was responsible for the generation of the highest amount of pDC in vitro. We therefore decided to study more extensively cells obtained only with this condition. In addition, as pDC numbers were the highest at day 21 in Flt3L/TPO/IL-3 culture, subsequent studies were performed on pDC obtained after 21 days of culture. We performed a phenotypic analysis on pDC sorted from Flt3L/TPO/IL-3 culture at day 21. After pDC isolation, we showed that a majority of cells were CD11c−. Only 2% of cells were CD11c+. BDCA-4+/CD123+ pDC represented 25.7% of CD11c− cells. Interestingly, 11.2% of CD11c+ cells expressed the pDC markers BDCA-4+ and CD123+ (Fig. 4A ). Sorted-pDC were then cultured 24 hours with IL-3 to assure their survival and with CpG ODN (a pDC stimulus recognized by their TLR9) to induce their maturation. Phenotype analysis of sorted cells cultured in medium complemented with IL-3 alone showed that the number of CD11c− and CD11c+ cells expressing the markers BDCA-4 and CD123 is increased in the presence of IL-3 from 25.7% to 53.4% and from 11.2% to 33.4%, respectively (Fig. 4B). Sorted cells cultured for 24 hours with IL-3 and CpG ODN showed a higher increase of BDCA-4+/CD123+/CD11c− (from 25.7% to 91.5%) and BDCA-4+/CD123+/CD11c+ (from 11.2% to 77.5%) cells compared with sorted cells cultured with IL-3 alone (Fig. 4C). These results demonstrated that BDCA-4+ CD123+ CD11c− cells are immature pDC that differentiate into mature pDC expressing CD11c when cultured with IL-3, with or without CpG ODN. However, the combination of IL-3 and CpG ODN induced a higher number of mature pDC than IL-3 alone. We were also interested in determining whether nonsorted pDC exposed to Flt3L, TPO, and IL-3 were capable of maturation with CpG ODN. Nonsorted pDC generated in Flt3L/TPO/IL-3 condition were assessed for their expression of maturation markers (CD40, CD83, CD86, HLA-DR, CCR7, and CD11c) in the presence or absence of CpG ODN. After 24 hours of activation by CpG ODN, we showed that pDC stimulated with CpG ODN were matured. The fluorescence intensity of all maturation markers was increased in stimulated-pDC compared to nonstimulated pDC (Fig. 5). In order to determine whether pDC generated in Flt3L/TPO/IL-3 culture display characteristics of peripheral blood pDC, we sorted pDC from Flt3L/TPO/IL-3 cultures and from peripheral blood by magnetic bead isolation. Sorted-pDC from Flt3L/TPO/IL-3 cultures (Fig. 6Aa) exhibited typical peripheral blood pDC plasma cell morphology (Fig. 6Ab) with a high nucleus−cytoplasm ratio on a May−Grünwald Giemsa−stained cytospin. By using a mixed lymphocyte reaction, we showed that pDC generated in Flt3L/TPO/IL-3 culture as well as peripheral blood pDC have the capacity to provide accessory signals for an efficient proliferation of allogeneic T lymphocytes (Fig. 6B ). pDC generated in culture or sorted from peripheral blood did not differ in their ability to stimulate an allogeneic response when the stimulator/responder ratio was the lowest (1:40 and 1:20), but the response was significantly more important for the population of pDC generated in culture when the stimulator/responder ratio was higher (1:10 and 1:5) (p < 0.05). In addition, as it has already been shown [21Chen W. Antonenko S. Sederstrom J.M. et al.Thrombopoietin cooperates with FLT3-ligand in the generation of plasmacytoid dendritic cell precursors from human hematopoietic progenitors.Blood. 2004; 103: 2547-2553Crossref PubMed Scopus (100) Google Scholar, 26Kohrgruber N. Halanek N. Groger M. et al.Survival, maturation, and function of CD11c- and CD11c+ peripheral blood dendritic cells are differentially regulated by cytokines.J Immunol. 1999; 163: 3250-3259PubMed Google Scholar], the stimulatory capacity of pDC was significantly less important (p < 0.01) than that of the mDC population used as control in the assay (Fig. 6B). pDC function is associated with the expression of TLR different from that expressed by mDC [27Hornung V. Rothenfusser S. Britsch S. et al.Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides.J Immunol. 2002; 168: 4531-4537PubMed Google Scholar]. We confirmed by quantitative real-time PCR that, unlike mDC, peripheral blood pDC and pDC produced in our culture system, express high levels of TLR9 messenger RNA (Fig. 6C). This messenger RNA expression was correlated to the TLR9 protein level detected in pDC by intracellular staining (Fig. 6D). We also showed that in pDC sorted from the Flt3L/TPO/IL-3 culture, TLR9 stimulation by CpG ODN induces the secretion of high amounts of IFN-α (Fig. 6E) compared with unstimulated pDC. As pDC migrate in response to chemerin due to their expression of CMKLR1 [28Zabel B.A. Silverio A.M. Butcher E.C. Chemokine-like receptor 1 expression and chemerin-directed chemotaxis distinguish plasmacytoid from myeloid dendritic cells in human blood.J Immunol. 2005; 174: 244-251PubMed Google Scholar, 29Vermi W. Riboldi E. Wittamer V. et al.Role of ChemR23 in directing the migration of myeloid and plasmacytoid dendritic cells to lymphoid organs and inflamed skin.J Exp Me
Referência(s)