Portal de Periódicos da CAPES

Functional Equivalence of Structurally Distinct Ribosomes in the Malaria Parasite, Plasmodium berghei

2001; Elsevier BV; Volume: 276; Issue: 25 Linguagem: Inglês

10.1074/jbc.m101234200

1083-351X

Rosalina M.L. van Spaendonk, Jai Ramesar, Auke van Wigcheren, W. Eling, Annette L. Beetsma, Geert‐Jan van Gemert, Jo Hooghof, Chris J. Janse, Andrew P. Waters,

Invertebrate Immune Response Mechanisms

Unlike most eukaryotes, many apicomplexan parasites contain only a few unlinked copies of ribosomal RNA (rRNA) genes. Based on stage-specific expression of these genes and structural differences among the rRNA molecules it has been suggested thatPlasmodium spp. produce functionally different ribosomes in different developmental stages. This hypothesis was investigated through comparison of the structure of the large subunit rRNA molecules of the rodent malaria parasite,Plasmodium berghei, and by disruption of both of the rRNA gene units that are transcribed exclusively during development of this parasite in the mosquito (S-type rRNA gene units). In contrast to the human parasite, Plasmodium falciparum, we did not find evidence of structural differences in core regions of the distinct large subunit rRNAs which are known to be associated with catalytic activity including the GTPase site that varies in P. falciparum. Knockout P. berghei parasites lacking either of the S-type gene units were able to complete development in both the vertebrate and mosquito hosts. These results formally exclude the hypothesis that two functionally different ribosome types distinct from the predominantly blood stage-expressed A-type ribosomes, are required for development of all Plasmodium species in the mosquito. The maintenance of two functionally equivalent rRNA genes might now be explained as a gene dosage phenomenon.AJ301624AJ298079AJ298080AJ298081AJ298082AJ298083 Unlike most eukaryotes, many apicomplexan parasites contain only a few unlinked copies of ribosomal RNA (rRNA) genes. Based on stage-specific expression of these genes and structural differences among the rRNA molecules it has been suggested thatPlasmodium spp. produce functionally different ribosomes in different developmental stages. This hypothesis was investigated through comparison of the structure of the large subunit rRNA molecules of the rodent malaria parasite,Plasmodium berghei, and by disruption of both of the rRNA gene units that are transcribed exclusively during development of this parasite in the mosquito (S-type rRNA gene units). In contrast to the human parasite, Plasmodium falciparum, we did not find evidence of structural differences in core regions of the distinct large subunit rRNAs which are known to be associated with catalytic activity including the GTPase site that varies in P. falciparum. Knockout P. berghei parasites lacking either of the S-type gene units were able to complete development in both the vertebrate and mosquito hosts. These results formally exclude the hypothesis that two functionally different ribosome types distinct from the predominantly blood stage-expressed A-type ribosomes, are required for development of all Plasmodium species in the mosquito. The maintenance of two functionally equivalent rRNA genes might now be explained as a gene dosage phenomenon.AJ301624AJ298079AJ298080AJ298081AJ298082AJ298083 large subunit small subunit internal transcribed spacer external transcribed spacer knockout polymerase chain reaction kilobase pair(s) base pair(s) PCR amplified fragment wild-type Ribosomes are essential cellular components that play a central role in protein synthesis. It has been demonstrated that the ribosomal RNA (rRNA) has an active role in the assembly, structure, and interaction of the ribosomal subunits (1Noller H.F. Annu. Rev. Biochem. 1991; 60: 191-227Crossref PubMed Scopus (413) Google Scholar, 2Mitchell P. Osswald M. Brimacombe R. Biochemistry. 1992; 31: 3004-3011Crossref PubMed Scopus (89) Google Scholar, 3Holmberg L. Melander Y. Nygard O. Nucleic Acids Res. 1994; 22: 2776-2783Crossref PubMed Scopus (27) Google Scholar) and a direct role in catalysis and accuracy of protein synthesis (4Noller H.F. Moazad D. Stern S. Powers T. Allen P.N. Robertson J.M. Weiser B. Triman K. Hill W.E. Dahlberg A. Garret R.A. Moore P.B. Schlessinger D. Warner J.R. The Ribosome : Structure, Function and Evolution. American Society for Microbiology, Washington, D. C.1990: 73-92Google Scholar, 5Noller H.F. Hoffarth V. Zimniak L. Science. 1992; 256: 1416-1419Crossref PubMed Scopus (574) Google Scholar). The rRNA molecules present in eukaryotic ribosomes are identified by sedimentation properties as 28 S (large subunit (LSU)1), 18 S (small subunit (SSU), 5.8 S, and 5 S. The genes encoding the first three rRNA molecules are expressed from a single rRNA gene unit as one polygenic transcript that is subsequently processed. In most eukaryotes, 100–10,000 identical copies of the rRNA gene unit are present per haploid genome, clustered in tandem arrays. Because the rRNA molecule is the catalytic center of the ribosome (1Noller H.F. Annu. Rev. Biochem. 1991; 60: 191-227Crossref PubMed Scopus (413) Google Scholar, 5Noller H.F. Hoffarth V. Zimniak L. Science. 1992; 256: 1416-1419Crossref PubMed Scopus (574) Google Scholar, 6Dahlberg A.E. Cell. 1989; 57: 525-529Abstract Full Text PDF PubMed Scopus (191) Google Scholar), their sequence conservation presumably reflects functional constraints that are required for optimal translational efficiency. Unicellular apicomplexan parasites have superficially typical rRNA gene units that are comprised of 18 S, 28 S, and 5.8 S genes, separated by the internal transcribed spacer (ITS) regions and flanked by external transcribed spacer (ETS) regions (7Bishop R. Gobright E. Spooner P. Allsopp B. Sohanpal B. Collins N. Gene ( Amst. ). 2000; 257: 299-305Crossref PubMed Scopus (9) Google Scholar, 8Dalrymple B.P. Mol. Biochem. Parasitol. 1990; 43: 117-124Crossref PubMed Scopus (47) Google Scholar, 9Le Blancq S.M. Khramtsov N.V. Zamani F. Upton S.J. Wu T.W. Mol. Biochem. Parasitol. 1997; 90: 463-478Crossref PubMed Scopus (165) Google Scholar, 10Gagnon S. Morency M.J. Bourbeau D. Levesque R.C. Exp. Parasitol. 1996; 83: 346-351Crossref PubMed Scopus (2) Google Scholar, 11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar). However, in contrast to most eukaryotes, numerous, but not all, apicomplexan species contain a characteristically small number (two to seven) of structurally distinct rRNA gene units that are unlinked in the genome (11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar, 12Wellems T.E. Walliker D. Smith C.L. do Rosario V.E. Maloy W.L. Howard R.J. Carter R. McCutchan T.F. Cell. 1987; 49: 633-642Abstract Full Text PDF PubMed Scopus (172) Google Scholar, 13Waters A.P. Adv. Parasitol. 1994; 34: 33-79Crossref PubMed Scopus (49) Google Scholar, 14Waters A.P. van Spaendonk R.M.L. Ramesar J. Vervenne H.A.W. Dirks R.W. Thompson J. Janse C.J. J. Biol. Chem. 1997; 272: 3583-3589Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). This phenomenon has been characterized in the greatest detail inPlasmodium spp. parasites that are responsible for malaria. In Plasmodium, and in contrast to other apicomplexans that possess dispersed genes, these rRNA gene units are transcribed stage-specifically, thereby reducing the total number of gene units that are simultaneously active (15Gunderson J.H. Sogin M.L. Wollett G. Hollingdale M. de la Cruz V.F. Waters A.P. McCutchan T.F. Science. 1987; 238: 933-937Crossref PubMed Scopus (260) Google Scholar, 16McCutchan T.F. de la Cruz V.F. Lal A.A. Gunderson J.H. Elwood H.J. Sogin M.L. Mol. Biochem. Parasitol. 1988; 28: 63-68Crossref PubMed Scopus (144) Google Scholar, 17McCutchan T.F. Li J. McConkey G.A. Rogers M.J. Waters A.P. Parasitol. Today. 1995; 11: 134-138Abstract Full Text PDF PubMed Scopus (81) Google Scholar, 18Rogers M.J. Gutell R.R. Damberger S.H. Li J. McConkey G.A. Waters A.P. McCutchan T.F. RNA. 1996; 2: 134-145PubMed Google Scholar, 19Thompson J. van Spaendonk R.M.L. Choudhuri R. Sinden R.E. Janse C.J. Waters A.P. Mol. Microbiol. 1999; 31: 253-260Crossref PubMed Scopus (27) Google Scholar). Based on the differences in expression pattern and nucleotide sequence of the rRNA gene units the existence of three types of structurally different ribosomes in Plasmodium has been postulated. The A-type ribosomes are present in the liver and blood stages of the parasite, and the O- and S-type ribosomes are the predominant types produced during development in the mosquito (20Li J. Gutell R.R. Damberger S.H. Wirtz R.A. Kissinger J.C. Rogers M.J. Sattabongkot J. McCutchan T.F. J. Mol. Biol. 1997; 269: 203-213Crossref PubMed Scopus (82) Google Scholar). The presence of structural differences among the rRNA molecules has led to the hypothesis that the different ribosome types are also functionally different (15Gunderson J.H. Sogin M.L. Wollett G. Hollingdale M. de la Cruz V.F. Waters A.P. McCutchan T.F. Science. 1987; 238: 933-937Crossref PubMed Scopus (260) Google Scholar, 18Rogers M.J. Gutell R.R. Damberger S.H. Li J. McConkey G.A. Waters A.P. McCutchan T.F. RNA. 1996; 2: 134-145PubMed Google Scholar, 19Thompson J. van Spaendonk R.M.L. Choudhuri R. Sinden R.E. Janse C.J. Waters A.P. Mol. Microbiol. 1999; 31: 253-260Crossref PubMed Scopus (27) Google Scholar). Two observations support this hypothesis. First, the O- and S-type rRNA genes of the human parasite Plasmodium vivaxencode SSU rRNA molecules that differ in core regions that are involved in mRNA decoding and translational termination (20Li J. Gutell R.R. Damberger S.H. Wirtz R.A. Kissinger J.C. Rogers M.J. Sattabongkot J. McCutchan T.F. J. Mol. Biol. 1997; 269: 203-213Crossref PubMed Scopus (82) Google Scholar). Second, in the human malaria Plasmodium falciparum, A-type and S-type LSU rRNA molecules differ in the core regions, and most marked is the distinct GTPase domain in the A- and S-type molecules (18Rogers M.J. Gutell R.R. Damberger S.H. Li J. McConkey G.A. Waters A.P. McCutchan T.F. RNA. 1996; 2: 134-145PubMed Google Scholar, 21Velichutina I.V. Rogers M.J. McCutchan T.F. Liebman S.W. RNA. 1998; 4: 594-602Crossref PubMed Scopus (35) Google Scholar). It is currently a complete mystery why malaria parasites evolved this atypical organization and structure of the rRNA gene units. It has been postulated that these differences reflect the need for the parasite to propagate in two very different environments, the vertebrate host and invertebrate vector (15Gunderson J.H. Sogin M.L. Wollett G. Hollingdale M. de la Cruz V.F. Waters A.P. McCutchan T.F. Science. 1987; 238: 933-937Crossref PubMed Scopus (260) Google Scholar). To investigate the possible existence of functionally different ribosome types we analyzed the rRNA gene units of the rodent parasitePlasmodium berghei, an established model malaria parasite. This parasite contains four distinct copies of the rRNA units (A–D) (22Dame J.B. McCutchan T.F. J. Biol. Chem. 1983; 258: 6984-6990Abstract Full Text PDF PubMed Google Scholar) divided into the blood stage A-type (A- and B-unit) and S-type (C- and D-units), which is transcribed mainly in the proliferative stages in the mosquito (14Waters A.P. van Spaendonk R.M.L. Ramesar J. Vervenne H.A.W. Dirks R.W. Thompson J. Janse C.J. J. Biol. Chem. 1997; 272: 3583-3589Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 15Gunderson J.H. Sogin M.L. Wollett G. Hollingdale M. de la Cruz V.F. Waters A.P. McCutchan T.F. Science. 1987; 238: 933-937Crossref PubMed Scopus (260) Google Scholar). It has been possible to distinguish the two S-type SSU genes (C- and D-SSU) on the basis of sequence differences reminiscent of the S- and O-types of P. vivax (20Li J. Gutell R.R. Damberger S.H. Wirtz R.A. Kissinger J.C. Rogers M.J. Sattabongkot J. McCutchan T.F. J. Mol. Biol. 1997; 269: 203-213Crossref PubMed Scopus (82) Google Scholar). However, we demonstrated that the C-SSU gene is actually a chimera of the A- and D-SSU, and no differences were found in the core regions of the A-, C-, and D-SSU rRNA molecules (23van Spaendonk R.M.L. Ramesar J. Janse C.J. Waters A.P. Mol. Biochem. Parasitol. 2000; 105: 169-174Crossref PubMed Scopus (8) Google Scholar) which might imply functional differences. These results questioned whether two functionally different ribosome types are required for development of P. berghei in the mosquito as has been implied for P. vivax (20Li J. Gutell R.R. Damberger S.H. Wirtz R.A. Kissinger J.C. Rogers M.J. Sattabongkot J. McCutchan T.F. J. Mol. Biol. 1997; 269: 203-213Crossref PubMed Scopus (82) Google Scholar). Here we investigated further the rRNA gene units by comparison of the sequence and structure of the LSU genes of the different units. The sequence information of the LSU and SSU genes allowed us to address possible functional differences between the ribosome types by disruption of the C- and D- (S-type) rRNA gene units. Unexpectedly, neither the structural comparison nor the gene knockout studies revealed evidence for the existence of functionally different ribosome types in P. berghei. Only one copy of the S-type genes, either the C- or the D-gene, is sufficient for complete development of the parasite in the mosquito vector. A previously undescribed presence of the A-type rRNA molecules in maturing oocysts may also account for the continued development of gene knockout (ko) parasites in the mosquito. Given the similar phenotype of the C- and D-ko mutants we suggest that the maintenance and transcription of the additional rRNA units in the mosquito represent a gene dosage phenomenon that ensures efficient progression of parasite multiplication in the relatively short lived mosquito vector. DNA fragments containing the LSU rRNA genes of the A-, C-, and D-units were isolated for sequencing. The 5′-ends of the A- and C-LSU rRNA genes present in clone pPbSL7.8 (22Dame J.B. McCutchan T.F. J. Biol. Chem. 1983; 258: 6984-6990Abstract Full Text PDF PubMed Google Scholar) and clone pPbSL8.8 (24Dame J.B. Sullivan M. McCutchan T.F. Nucleic Acids Res. 1984; 12: 5943-5952Crossref PubMed Scopus (32) Google Scholar) respectively, were subcloned by PCR and sequenced completely. The 5′-end of the D-LSU rRNA gene was isolated from a library of size-selected KpnI/HindIII restriction fragments (range 4–8 kb) derived from genomic DNA (clone 8417 of the ANKA strain) and ligated into the vector pBS/KS. The library was screened by hybridization with oligonucleotide L87R (TableI) specific for a conserved region at the 5′-end of the LSU rRNA genes (position 27–45). The final wash was performed at 42 °C in 3 × SSC, 0.5% SDS. A plasmid (referred to as pPbL4.8), containing the expected 4.8-kbKpnI/HindIII fragment (11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar), was isolated, and the insert was completely sequenced. The fragment contained 1.6 kb of the 3′-end of the ITS2 and 3.2 kb of the 5′-end of the D-LSU rRNA gene. We were not able to clone the 5′-end of the second A-type, the B-LSU rRNA gene. The 3′-end of the B-LSU gene (position 3062–3789), present on a 4.1-kb HindIII fragment (11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar), was ligated into vector pBR322, resulting in the clone pPbL4.1. 2R. M. L. van Spaendonk, A. van Wigcheren, C. J. Janse, and A. P. Waters, unpublished data. This clone was partially sequenced and contained 728 bp of the 3′-end of the B-LSU rRNA gene plus 3.4 kb of downstream sequences. The 3′-ends of the A-, C-, and D-LSU rRNA genes were isolated from a partial Sau3AP. berghei genomic library in phage λzap-SK (Dr. M. Ponzi, Instituto Superiore di Sanità, Roma, Italy). This library was screened with a 653-bp fragment from the B-LSU rRNA gene, derived from clone pPbL4.1 after digestion with HindIII andAvaI. The final wash was performed at 60 °C in 1 × SSC, 0.5% SDS. Six clones positive for the 3′-end of the LSU gene and with different insert sizes were obtained. Comparison of the restriction digestion patterns of these clones with the known restriction maps (11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar) and partial sequence analysis extending into the already sequenced regions of the LSU rRNA genes showed that two clones contained the 3′-end of A-type LSU rRNA genes, three clones the 3′-end of the C-, and one clone the 3′-end of the D-LSU rRNA gene. Subclones made by amplification of the 3′-ends of the A-type, C-, and D-LSU rRNA genes were sequenced completely.Table IOligonucleotides specific for the ETS, SSU, ITS1, ITS2, and LSU regions of the four rRNA units (A/B/C/D) of P. bergheiSpecific forNucleotide sequenceNameETSD-ETSCCACCAACCCAAGCTTATACATTATACATAATAAACCCACACL372RD-ETSATACTGTATAACAGGTAAGCTGTTATTGTGL260RD-ETSAAATAGTCAATTAAAATCCTATGGL392RC-ETSGTGTAGTAACATCAGTTATTGTGTGL270RSSUC/D-SSUCCCGAATTCAACCTGTTGATCTTGCCL78RC/D-SSUCCCGAATTCACCTACGGAAAACC332RC/D-SSUATAAAAGCAGTGACAGAAGTCTM3A/B-SSUCATGAAGATATCGAGGCGGAGTM4ITS1C/D-ITS1CCCAAGCTTCGCGGATCCACCATGATATGCGTACCTTAGL427RC/D-ITS1CCCAAGCTTTAATTTTTTTATATTTCCCTTGAACL412RC/D-ITS1CTTAGTGTTTTGTATTAATGACGATTTGL271RITS2C-ITS2TAACGCATATAATTTTACAGGGGL263RC-ITS2CAATTTGCTCACATTGTATATAGGL264RD-ITS2CATTAAACATATATGTTGTTCTCTCL265RD-ITS2CCCAGGTTCCAGTCGCAATAGL266RLSU-5′C LSU 5′AACCTACTCATGCAAGTAAGGL361RC LSU 5′AAAATAGAAAATGATGAACCCTCL648RD LSU 5′TGCTCTCCCATCATAAGTTATL238RD LSU 5′ACATGACTTGCGCCATGAATAL649RA/B LSU 5′CATAGAAATAAATCCATCTTACL360RA/B LSU 5′GGAAACAGTCCATCTATAATTGL647RA/B/C/D-LSU 5′ATATGCTTAAATTCGGCGGL87RLSU-3′C LSU 3′ATTCCGCCACTTAAAAACCTCL645RD LSU 3′TATTCTACGCTTAAAAATCACACL646RA/B LSU 3′GAACAAATTACTTCATTCATAGCL644RA/B/C/D LSU 3′CGTTAGGAGCATCCCTCATL357R5′ UTR DHFR 1-aUTR, untranslated region; DHFR, dihydrofolate reductase.GGGAAATCAATGTATTAAAAATAATTATATGL393pBS/KS + pUCAGCGGATAACAATTTCACACAGGA307ApBS/KS + pUCTTTTCCCAGTCACGACGT328A1-a UTR, untranslated region; DHFR, dihydrofolate reductase. Open table in a new tab The secondary structure analysis of the P. berghei 5.8 S and LSU rRNA molecules was inferred from comparative sequence analysis. The eukaryotic LSU consensus sequence was calculated from an alignment of 23S-like rRNA sequences of 35 representative eukaryotic species. 3R. R. Gutell, S. Subashchandran, M. Schnare, Y. Du, N. Lin, L. Madabusi, K. Muller, N. Pande, N. Yu, Z. Shang, S. Date, D. Konings, V. Schweiker, B. Weiser, and J. J. Cannone, manuscript in preparation. The alignment was made with the Omiga™ 1.0.1 software (Oxford Molecular Group). P. berghei positions different from the LSU consensus sequence were checked for compensatory base changes by folding the P. berghei rRNA sequence into a three-dimensional structure similar to the secondary structure model for P. falciparum (18Rogers M.J. Gutell R.R. Damberger S.H. Li J. McConkey G.A. Waters A.P. McCutchan T.F. RNA. 1996; 2: 134-145PubMed Google Scholar). The construction of the vectors to disrupt the C- and D-rRNA gene units was as follows. To create vector pMD207 (Fig.1 B), we first PCR amplified a 2038-bp fragment from the 5′-end of the C-SSU rRNA gene from plasmid pPbSL8.8 (24Dame J.B. Sullivan M. McCutchan T.F. Nucleic Acids Res. 1984; 12: 5943-5952Crossref PubMed Scopus (32) Google Scholar), using oligonucleotides L78R and 332R (see Table I; four cycles annealing at 40 °C, 3-min extension followed by 30 cycles annealing at 60 °C, 3-min extension) which introduced uniqueEcoRI sites at either end of the fragment. This fragment was cloned into the unique EcoRI site of vector pMD200 (25van Dijk M.R. Waters A.P. Janse C.J. Science. 1995; 268: 1358-1362Crossref PubMed Scopus (207) Google Scholar), resulting in vector pMD207. pMD200 contains the selectable marker cassette with the pyrimethamine-resistant DHFR/TS gene of P. berghei. Vector pMD207 has been used for disruption of both the C- and D-rRNA gene units after linearization at the unique SpeI restriction site. In pMD207, 21 bp of the C-SSU rRNA gene (nucleotides 2039–2059) are missing, resulting in the introduction of an incomplete copy of the C-SSU rRNA gene after integration of pMD207 in the C- or D-rRNA gene unit (Fig. 1 B). Both vectors 387A and 395A (Fig.1 B) contain two fragments of the D-rRNA gene unit (24Dame J.B. Sullivan M. McCutchan T.F. Nucleic Acids Res. 1984; 12: 5943-5952Crossref PubMed Scopus (32) Google Scholar) on either side of the selectable marker cassette present in vector pDBDTmΔHDB(26Waters A.P. Thomas A.W. van Dijk M.R. Janse C.J. Methods. 1997; 13: 134-147Crossref PubMed Scopus (111) Google Scholar). In both vectors a 723-bp fragment of the D-LSU rRNA gene was cloned downstream of the selection cassette. To obtain this fragment, plasmid pPbL4.8 (see above) containing 1.6 kb of the D-ITS2 and 3.2 kb of the D-LSU rRNA gene was digested with TaqI andHindIII. After size fractionation and purification from gel, the 723-bp TaqI/HindIII fragment was cloned in pBS/KS digested with ClaI and HindIII. The HindIII site was destroyed by religation after filling out the HindIII-digested clone. The resulting clone was digested with KpnI and EcoRI, and the insert containing nucleotides 2569–3292 of the D-LSU rRNA gene was subsequently cloned into plasmid pDBDTmΔHDB digested with KpnI and EcoRI, giving rise to plasmid pDBDTmΔHDB/D-LSU. To create vector 395A, the ITS1 that is 100% identical between the C- and the D-unit, 4R. M. L. van Spaendonk, unpublished data. was PCR amplified from plasmid pPbSL8.8 (24Dame J.B. Sullivan M. McCutchan T.F. Nucleic Acids Res. 1984; 12: 5943-5952Crossref PubMed Scopus (32) Google Scholar) with the oligonucleotides L427R and L412R (Table I; 30 cycles, annealing at 55 °C, 45-s extension), which introduced unique HindIII sites at either end of the ITS1. The cloning of this 522-bp amplification product (probe C/D-ITS1, Fig. 1 A) into the unique HindIII site in plasmid pDBDTmΔHDB/D-LSU resulted in the formation of plasmid 395A. To create vector 387A, plasmid pPbS5.2 (23van Spaendonk R.M.L. Ramesar J. Janse C.J. Waters A.P. Mol. Biochem. Parasitol. 2000; 105: 169-174Crossref PubMed Scopus (8) Google Scholar) containing the entire D-SSU rRNA gene flanked by a 2.9-kb upstream sequence and by 0.2 kb of the ITS1 was digested withNheI and SacII. After size fractionation, an 2048-bp NheI/SacI fragment containing 1480 bp of the upstream sequence and 568 bp of the D-SSU rRNA gene was purified from gel and cloned into pBS/KS digested with SpeI andSacII. From this clone a D-unit-specific 868-bp region of the D-ETS (probe D-ETS, Fig. 1 A), located 612 bp upstream of the D-SSU rRNA gene, was PCR amplified with the oligonucleotides L372R and 307A (Table I). After digestion with HindIII, the amplification product was cloned into pDBDTmΔHDB/D-LSU, giving rise to replacement vector 387A. Transfection of P. berghei and selection of transfected parasites were performed as described previously (26Waters A.P. Thomas A.W. van Dijk M.R. Janse C.J. Methods. 1997; 13: 134-147Crossref PubMed Scopus (111) Google Scholar, 27Menard R. Janse C.J. Methods. 1997; 13: 148-159Crossref PubMed Scopus (106) Google Scholar). Briefly, purified schizonts (108) of P. berghei(ANKA strain, clone 15cy1) were transfected by electroporation with either 40 μg of disruption vector pMD207 (after linearization at theSpeI site) or 40 μg of the replacement vectors 395A or 378A (linearized with BamHI and EcoRI). Transfected parasites were injected back into rats or mice, and transfected parasites were selected by treatment of the animals with pyrimethamine. Transfected pyrimethamine-resistant parasites were cloned by the method of limiting dilution. Infected blood was obtained from mice with a parasitemia between 5 and 40%, and leukocytes were removed using Plasmodipur leukocyte filters (Eurodiagnostica). The parasites were either used for genomic DNA isolation (28Paton M.G. Barker G.C. Matsuoka H. Ramesar J. Janse C.J. Waters A.P. Sinden R.E. Mol. Biochem. Parasitol. 1993; 59: 263-275Crossref PubMed Scopus (143) Google Scholar), chromosome separation by field inversion gel electrophoresis (29Ponzi M. Janse C.J. Dore E. Scotti R. Pace T. Reterink T.J. van der Berg F.M. Mons B. Mol. Biochem. Parasitol. 1990; 41: 73-82Crossref PubMed Scopus (56) Google Scholar), or parasites were used directly for PCR according to a modified method from Snounou et al. (30Snounou G. Viriyakosol S. Zhu X.P. Jarra W. Pinheiro L. do Rosario V.E. Thaithong S. Brown K.N. Mol. Biochem. Parasitol. 1993; 61: 315-320Crossref PubMed Scopus (1189) Google Scholar). 105 parasites (obtained from lysed infected erythrocytes) were washed with 250 μl of 1 × PCR buffer (Life Technologies, Inc.), resuspended in 20 μl of 1 × PCR buffer, overlaid with mineral oil, and incubated for 10 min at 100 °C. In each PCR 2 μl of boiled parasite suspension was used as template. To demonstrate correct integration of the vectors we used the oligonucleotides listed in Table I. Disruption of the C-unit with pMD207 was detected with oligonucleotides L270R and 328A (PCR-amplified fragment (PCRaf) of 3.0 kb); disruption of the D-unit was detected with L260R and 328A (PCRaf of 3.0 kb). Wild-type (wt) C- and wt D-units were detected with L271R in combination with L270R and L260R, respectively (both PCRaf sizes of 3.5 kb). Replacement of the C-unit with vector 395A was detected with L270R and L393 (PCRaf of 3.2 kb); D-unit replacement was shown with L260R and L393 (PCRaf of 3.2 kb). In all of these PCRs 40 cycles, annealing at 55 °C, and 4-min extension were used. Wild-type C-unit was detected with L263R and L264R (35 cycles, annealing at 55 °C, 2-min extension, PCRaf of 2.2 kb). For wt D-unit L265R and L266R (35 cycles, annealing at 55 °C, 2-min extension, PCRaf of 1.2 kb) were used. D-unit replacement with vector 387A was detected with L392R and L393 (35 cycles, annealing at 55 °C, 1-min extension, PCRaf of 1.1 kb). Wild-type C- and wt D-unit were detected with L271R in combination with L270R and L260R, respectively (see above). For Southern analysis of genomic DNA of ko parasites three probes were used. To demonstrate integration of vector pMD207, the C/D-ETS probe, which is specific for the ETS region of the C- and D-units (probe 99S (14Waters A.P. van Spaendonk R.M.L. Ramesar J. Vervenne H.A.W. Dirks R.W. Thompson J. Janse C.J. J. Biol. Chem. 1997; 272: 3583-3589Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar)) was used. The C/D-ITS1 probe (see "Vectors"), which is specific for the ITS1 region of the C- as well as the D-unit, was used to show replacement by vector 395A. To visualize replacement of the D-rRNA gene unit by vector 387A, probe D-ETS (see "Vectors") specific for the 5′-ETS region of the D-unit was used. Hybridizations were performed at 60 °C, and their final wash was at a stringency of 0.1 × SSC, 0.5% SDS, twice for 15 min at 60 °C. The presence of SSU and LSU rRNA transcripts of the different gene units was analyzed by Northern analysis and RNA dot spot hybridizations. For oocyst RNA 15 midguts were dissected from anopheline mosquitos at day 10 after infection and collected in phosphate-buffered saline. For sporozoite RNA, salivary glands were dissected from 50 mosquitos at day 20 after infection and collected in phosphate-buffered saline. Directly after collection of the parasites, RNA was isolated according to standard methods (28Paton M.G. Barker G.C. Matsuoka H. Ramesar J. Janse C.J. Waters A.P. Sinden R.E. Mol. Biochem. Parasitol. 1993; 59: 263-275Crossref PubMed Scopus (143) Google Scholar). For Northern blots, RNA was fractionated in guanidine thiocyanate containing agarose gels and blotted to nylon membrane (Schleicher and Schuell) according to the protocol of Goda and Minton (31Goda S.K. Minton N.P. Nucleic Acids Res. 1995; 23: 3357-3358Crossref PubMed Scopus (112) Google Scholar). For RNA dot spot blots, aliquots of the RNA samples were denaturated and spotted on nylon membrane (Schleicher and Schuell) by a dot slotter apparatus (Bio-Rad). Blots were hybridized with oligonucleotides that are specific for the rRNA genes of the different units (Table I). Hybridizations were performed at 42 °C, and their final wash was at a stringency of 3 × SSC, 0.5% SDS, twice for 10 min at 42 °C. To determine the relative amounts of the different rRNA transcripts, we measured the intensities of hybridization signals using a PhosphorImager (Molecular Dynamics) and the software ImageQuant 3.3 (University of Virginia, ITC-Academic Computing Health Sciences). To correct for differences in specific activity of labeled oligonucleotides, we simultaneously hybridized these probes to plasmids containing the different rRNA genes. The following plasmids were used (Fig. 1 A for the restriction fragments): pl351, containing the 7.8-kb EcoRI fragment of the A/B-unit (pBbSL7.8 (22Dame J.B. McCutchan T.F. J. Biol. Chem. 1983; 258: 6984-6990Abstract Full Text PDF PubMed Google Scholar)); pl316, containing the 8.8-kbEcoRI/HindIII fragment of the C-unit (pBbSL8.8 (11Dame J.B. McCutchan T.F. Mol. Biochem. Parasitol. 1984; 11: 301-307Crossref PubMed Scopus (16) Google Scholar)); pl343, containing the 4.7-kb KpnI/HindIII fragment of the D-unit (pPbS5.2 (23van Spaendonk R.M.L. Ramesar J. Janse C.J. Waters A.P. Mol. Biochem. Parasitol. 2000; 105: 169-174Crossref PubMed Scopus (8) Google Scholar)); pl344, containing the 5.2-kbKpnI/KpnI fragment of the D-unit (SSU to ITS1 region). The phenotypes of the ko parasites were analyzed further using standard technologies for determination of growth and development characteristics of P. berghei (32Janse C.J. Waters A.P. Parasitol. Today. 1995; 11: 138-143Abstract Full Text PDF PubMed Scopus (122) Google Scholar). Asexual blood stage development and gametocyte production were determined in synchronized infections in mice under standardized conditions (33Mons B. Janse C.J. Boorsma E.G. van der Kaay H.J. Parasitology. 1985; 91: 423-430Crossref PubMed Scopus (69) Google Scholar). The gametocyte conversion rate is the percentage of ring forms that develop into gametocytes as determined by counting parasites i