Isolation and Characterization of a Putative Intestinal Stem Cell Fraction From Mouse Jejunum
2005; Elsevier BV; Volume: 129; Issue: 5 Linguagem: Inglês
10.1053/j.gastro.2005.08.011
ISSN1528-0012
AutoresChristopher M. Dekaney, José María Ros Rodríguez, Małgorzata Graul, Susan Henning,
Tópico(s)Mesenchymal stem cell research
ResumoBackground & Aims: Although there have been many recent advances regarding the biology of intestinal stem cells, the field has been hampered significantly by the lack of a method to isolate these cells. Therefore, the aim of this study was to explore the hypothesis that viable intestinal stem cells can be isolated as a side population (SP) by fluorescence-activated cell sorting after staining with the DNA-binding dye Hoechst 33342. Methods: Preparations of individual cells from either whole mucosa or epithelium of mouse jejunum were stained with Hoechst 33342 and propidium iodide and then sorted using fluorescence-activated cell sorting. Cells were characterized using fluorochrome-labeled antibodies to surface markers, intracellular markers, and annexin V to detect early apoptosis. Total RNA was isolated from sorted fractions and used for quantitative real-time reverse-transcription polymerase chain reaction to evaluate the expression of cell lineage markers and the intestinal stem-cell marker, Musashi-1. Results: Adult and neonatal jejunum contain a viable population of cells that shows the SP phenotype and is sensitive to verapamil. This population of cells (from both mucosal and epithelial preparations) includes a CD45-negative fraction corresponding to nonhematopoietic cells, which shows minimal expression of surface markers typically found on stem cells from other tissues and of intracellular markers found in mesenchymal cells. Additionally, these cells were enriched for Musashi-1 and β1-integrin, were cytokeratin positive, and survived in culture for up to 14 days. Conclusions: The CD45-negative SP fraction, although not pure, represents the successful isolation of a viable population significantly enriched in small intestinal epithelial stem cells. Background & Aims: Although there have been many recent advances regarding the biology of intestinal stem cells, the field has been hampered significantly by the lack of a method to isolate these cells. Therefore, the aim of this study was to explore the hypothesis that viable intestinal stem cells can be isolated as a side population (SP) by fluorescence-activated cell sorting after staining with the DNA-binding dye Hoechst 33342. Methods: Preparations of individual cells from either whole mucosa or epithelium of mouse jejunum were stained with Hoechst 33342 and propidium iodide and then sorted using fluorescence-activated cell sorting. Cells were characterized using fluorochrome-labeled antibodies to surface markers, intracellular markers, and annexin V to detect early apoptosis. Total RNA was isolated from sorted fractions and used for quantitative real-time reverse-transcription polymerase chain reaction to evaluate the expression of cell lineage markers and the intestinal stem-cell marker, Musashi-1. Results: Adult and neonatal jejunum contain a viable population of cells that shows the SP phenotype and is sensitive to verapamil. This population of cells (from both mucosal and epithelial preparations) includes a CD45-negative fraction corresponding to nonhematopoietic cells, which shows minimal expression of surface markers typically found on stem cells from other tissues and of intracellular markers found in mesenchymal cells. Additionally, these cells were enriched for Musashi-1 and β1-integrin, were cytokeratin positive, and survived in culture for up to 14 days. Conclusions: The CD45-negative SP fraction, although not pure, represents the successful isolation of a viable population significantly enriched in small intestinal epithelial stem cells. Among the mammalian tissues that show continuous renewal (bone marrow, skin, and gastrointestinal epithelium), the epithelium of the small intestine has by far the highest rate of turnover. In both rodents and humans, the majority of cells within the epithelium are replaced every 3–4 days.1Lipkin M. Growth and development of gastrointestinal cells.Annu Rev Physiol. 1985; 47: 175-197Crossref PubMed Google Scholar Three principal cell lineages are found on the villi, namely: (1) absorptive cells (also called enterocytes), which are by far the dominant lineage, making up more than 90% of total cells; (2) goblet cells (also called mucus cells), comprising 8%–10% of the villus population; and (3) enteroendocrine cells (a diverse group), comprising approximately 1% of the epithelium.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1177) Google Scholar, 3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (138) Google Scholar A fourth lineage, namely the Paneth cells, arise from downward migration and are found at the very base of the crypts.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1177) Google Scholar, 3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (138) Google Scholar Pioneering studies by Cheng and Leblond2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1177) Google Scholar in the early 1970s suggested that undifferentiated cells (which they called crypt-base columnar cells) located in the intestinal crypts just above the Paneth cells may serve as multipotent stem cells responsible for the generation of all 4 lineages of the small intestinal epithelium. These studies relied on the observation that at early times after administration of 3H-thymidine, cells damaged by the local radiation were phagocytosed only by the crypt-base columnar cells. Subsequently, phagocytic fragments could be detected in cells of all 4 lineages.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1177) Google Scholar Although there has been some debate as to the alternate origin of enteroendocrine cells,3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (138) Google Scholar the Unitarian Hypothesis, as it was called,2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1177) Google Scholar has stood the test of time. As reviewed in detail by Gordon et al,4Gordon J.I. Schmidt G.H. Roth K.A. Studies of intestinal stem cells using normal, chimeric, and transgenic mice.FASEB J. 1992; 6: 3039-3050Crossref PubMed Scopus (135) Google Scholar in the mid-1980s supporting evidence came from studies of mice chimeras in which the parental origin of intestinal epithelial cells could be identified by lectin staining. More recently, unequivocal confirmation of the hypothesis has been forthcoming from studies in which adult mice with intestinal epithelium that normally stains negative for the lectin Dolichos biflorus agglutinin are subjected to mutagenesis.5Bjerknes M. Cheng H. Clonal analysis of mouse intestinal epithelial progenitors.Gastroenterology. 1999; 116: 7-14Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar This leads to the appearance of lectin-positive ribbons of cells, some of which persist for very long periods of time (>150 days) and thus presumably reflect mutagenesis of a crypt stem cell. The lectin-positive ribbons were found to include all 4 lineages, thus showing conclusively that all arise from a common stem cell.5Bjerknes M. Cheng H. Clonal analysis of mouse intestinal epithelial progenitors.Gastroenterology. 1999; 116: 7-14Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar Understanding the biology of these stem cells is central to the development of effective rejuvenative therapies for intestinal failure and short-gut syndrome. Moreover, in situations in which the stem cells themselves are damaged, transplantation of healthy stem cells may afford a novel and effective therapy. A critical issue in the study of intestinal epithelial stem cells has been the lack of markers for these cells. Numerous genes are expressed in the crypt compartment but not in the villus6Olsen L. Hansen M. Ekstrom C.T. Troelsen J.T. Olsen J. CVD the intestinal crypt/villus in situ hybridization database.Bioinformatics. 2004; 20: 1327-1328Crossref PubMed Scopus (11) Google Scholar and some, such as EphB2,7Batlle E. Henderson J.T. Beghtel H. van den Born M.M. Sancho E. Huls G. Meeldijk J. Robertson J. van de W.M. Pawson T. Clevers H. Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB.Cell. 2002; 111: 251-263Abstract Full Text Full Text PDF PubMed Scopus (963) Google Scholar CD44,8Wielenga V.J. Smits R. Korinek V. Smit L. Kielman M. Fodde R. Clevers H. Pals S.T. Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway.Am J Pathol. 1999; 154: 515-523Abstract Full Text Full Text PDF PubMed Scopus (446) Google Scholar and Hes1,9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar display a gradient of increased expression toward the stem-cell zone. However, until very recently, no protein or messenger RNA (mRNA) had been observed to be expressed exclusively in intestinal epithelial stem cells. Although gene expression profiling by microarray analysis, as reported by Stappenbeck et al,10Stappenbeck T.S. Mills J.C. Gordon J.I. Molecular features of adult mouse small intestinal epithelial progenitors.Proc Natl Acad Sci U S A. 2003; 100: 1004-1009Crossref PubMed Scopus (124) Google Scholar provides a promising approach, to date a definitive stem-cell marker has not emerged from these studies. Others have used a candidate gene approach and in early 2003 this proved very fruitful with simultaneous publications by Kayahara et al9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar and Potten et al.11Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (426) Google Scholar These groups reported, by immunohistochemistry and in situ hybridization, that expression of the RNA-binding protein Musashi-1 (Msi-1) is confined to the stem-cell zone of the intestinal epithelium.9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar, 11Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (426) Google Scholar This protein, which is known to play a key role in asymmetric cell division by neural stem cells,12Sakakibara S. Imai T. Hamaguchi K. Okabe M. Aruga J. Nakajima K. Yasutomi D. Nagata T. Kurihara Y. Uesugi S. Miyata T. Ogawa M. Mikoshiba K. Okano H. Mouse-Musashi-1, a neural RNA-binding protein highly enriched in the mammalian CNS stem cell.Dev Biol. 1996; 176: 230-242Crossref PubMed Scopus (483) Google Scholar thus has become a marker for intestinal epithelial stem cells. More recent studies have shown that within the murine intestine members of the BMP and Wnt signaling pathways, phospho-PTEN and phosphor-AKT, also localize to intestinal stem cells.13He X.C. Zhang J. Tong W.G. Tawfik O. Ross J. Scoville D.H. Tian Q. Zeng X. He X. Wiedemann L.M. Mishina Y. Li L. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling.Nat Genet. 2004; 36: 1117-1121Crossref PubMed Scopus (887) Google Scholar, 14Tian Q. Feetham M.C. Tao W.A. He X.C. Li L. Aebersold R. Hood L. Proteomic analysis identifies that 14-3-3zeta interacts with beta-catenin and facilitates its activation by Akt.Proc Natl Acad Sci U S A. 2004; 101: 15370-15375Crossref PubMed Scopus (129) Google Scholar These findings represent significant advances in the understanding of intestinal stem-cell biology. Unfortunately, because of the nature of these proteins, they are of limited use for identifying isolated intestinal stem cells. Despite extensive studies on the kinetics of intestinal epithelial stem cells, in both physiologic and pathologic states, efforts to isolate these cells have met with little success. For the colonic epithelium, fluorescence-activated cell sorting (FACS) based on expression of β1-integrin yields a viable population but affords only 3-fold enrichment of clonogenic activity over unsorted cells.15Fujimoto K. Beauchamp R.D. Whitehead R.H. Identification and isolation of candidate human colonic clonogenic cells based on cell surface integrin expression.Gastroenterology. 2002; 123: 1941-1948Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 16Whitehead R.H. Demmler K. Rockman S.P. Watson N.K. Clonogenic growth of epithelial cells from normal colonic mucosa from both mice and humans.Gastroenterology. 1999; 117: 858-865Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar Although a combination of surface markers is likely to be more effective, as is the case with bone marrow stem cells,17Spangrude G.J. Smith L. Uchida N. Ikuta K. Heimfeld S. Friedman J. Weissman I.L. Mouse hematopoietic stem cells.Blood. 1991; 78: 1395-1402PubMed Google Scholar to date the lack of identification of an appropriate set of such markers has hindered this classic cell-sorting approach. Thus, we chose to explore an alternate method based on recent studies that have shown that stem cells from bone marrow18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2519) Google Scholar and other various tissues can be isolated as a side population (SP) by FACS after staining with the DNA-binding dye Hoechst 33342.19Alvi A.J. Clayton H. Joshi C. Enver T. Ashworth A. Vivanco M.M. Dale T.C. Smalley M.J. Functional and molecular characterisation of mammary side population cells.Breast Cancer Res. 2003; 5: R1-R8Crossref PubMed Scopus (3) Google Scholar, 20Shimano K. Satake M. Okaya A. Kitanaka J. Kitanaka N. Takemura M. Sakagami M. Terada N. Tsujimura T. Hepatic oval cells have the side population phenotype defined by expression of ATP-binding cassette transporter ABCG2/BCRP1.Am J Pathol. 2003; 163: 3-9Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 21Oh H. Bradfute S.B. Gallardo T.D. Nakamura T. Gaussin V. Mishina Y. Pocius J. Michael L.H. Behringer R.R. Garry D.J. Entman M.L. Schneider M.D. Cardiac progenitor cells from adult myocardium homing, differentiation, and fusion after infarction.Proc Natl Acad Sci U S A. 2003; 100: 12313-12318Crossref PubMed Scopus (1533) Google Scholar, 22Wulf G.G. Luo K.L. Jackson K.A. Brenner M.K. Goodell M.A. Cells of the hepatic side population contribute to liver regeneration and can be replenished with bone marrow stem cells.Haematologica. 2003; 88: 368-378PubMed Google Scholar, 23Welm B.E. Tepera S.B. Venezia T. Graubert T.A. Rosen J.M. Goodell M.A. Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population.Dev Biol. 2002; 245: 42-56Crossref PubMed Scopus (460) Google Scholar, 24Asakura A. Seale P. Girgis-Gabardo A. Rudnicki M.A. Myogenic specification of side population cells in skeletal muscle.J Cell Biol. 2002; 159: 123-134Crossref PubMed Scopus (588) Google Scholar, 25Oyama K. Nakagawa H. Harada H. Andl C. Takaoka M. Rustgi A.K. Murine oral-epithelial cells have a subpopulation of potential stem cells.Gastroenterology. 2003; 124: A-457Abstract Full Text PDF Google Scholar By using this technique, we identified mouse intestinal SP cells and showed that these cells are distinct from hematopoietic stem cells and their progeny based on the absence of surface markers for CD45, c-kit, and CD34. Moreover, RNA prepared from CD45-negative intestinal SP cells was found to be enriched for Msi-1, leading us to conclude that the cells of this fraction are putative intestinal stem cells (PISCs). All mice were housed in our animal facility under a 12-hour light/dark cycle and were allowed unlimited access to rodent Lab Chow #5001 (PMI Nutrition International, Brentwood, MO) and acidified tap water. Experimental procedures were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine. Mucosal cells were prepared from jejunum of adult male and neonatal (postnatal days 7–14) C57Bl/6J mice by a modification of the protocol outlined by Evans et al.26Evans G.S. Flint N. Somers A.S. Eyden B. Potten C.S. The development of a method for the preparation of rat intestinal epithelial cell primary cultures.J Cell Sci. 1992; 101: 219-231Crossref PubMed Google Scholar Briefly, jejunum was removed and flushed with Hank's buffered saline solution (HBSS) and split open lengthwise. The jejunum then was cut into pieces approximately 3 mm in length and washed 6 times on an orbital shaker in 20 mL of HBSS (80 rpm). Next, the pieces were cut into 1-mm pieces and shaken (80 rpm) in HBSS containing 15 U/mL type III collagenase (Sigma, St. Louis, MO) and 0.3 U/mL dispase (Invitrogen, Carlsbad, CA) at room temperature for 1 hour. The digested tissue was pipetted up and down for 15 minutes and transferred to a conical tube, after which fetal bovine serum (FBS) was added to 5% to inhibit collagenase/dispase activity. The dissociated tissue was allowed to sediment under gravity for 1 minute and then the supernatant was removed into a new tube and sedimentation was repeated twice. The resulting supernatant was centrifuged at 300 rpm for 3 minutes and the pellet was collected. This was repeated once. The cell pellets were combined in HBSS containing 5% FBS and passed through a 70-μm filter. This method is not specific for the epithelium, but rather digests both the epithelium and some of the underlying stromal tissue (but not muscle layers). Thus, throughout the text we refer to these digests as mucosal preparations. Intestinal epithelial cells were prepared from jejunum of adult male C57Bl/6J mice by a modification of the protocol outlined by Bjerknes and Cheng.27Bjerknes M. Cheng H. Methods for the isolation of intact epithelium from the mouse intestine.Anat Rec. 1981; 199: 565-574Crossref PubMed Scopus (160) Google Scholar Briefly, jejunum was removed, flushed with phosphate buffered saline, and everted on a glass rod. The glass rod was immersed and vibrated in Ca2+/Mg2+-free phosphate-buffered saline containing 30 mmol/L ethylenediaminetetraacetic acid (EDTA) for 20–25 minutes to yield individual crypts and villi. These were pelleted at 500 rpm for 5 minutes. The pellet was resuspended in HBSS containing 0.3 U/mL dispase to digest the epithelium into individual cells and incubated at 37°C for 10 minutes, after which FBS was added to the final concentration of 5% to inhibit dispase activity. The cells then were passed through a 70-μm filter. FACS was performed using the Hoechst 33342 staining method outlined by Goodell et al.18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2519) Google Scholar Preliminary experiments using 5, 6, 7, or 8 μg/mL Hoechst 33342 (Sigma) showed that the higher concentrations resulted in reduced cellular viability with minimal changes in the SP staining pattern. Therefore, isolated intestinal mucosal or epithelial cells were suspended routinely at 106 cells/mL in HBSS containing 2% FBS and 5 μg/mL Hoechst 33342. After incubation at 37°C for 90 minutes, cells were centrifuged at 700 rpm for 5 minutes at 4°C and resuspended in cold HBSS containing 2% FBS to a concentration of 106 cells/100 μL. Next, cells were incubated with fluorescein isothiocyanate (FITC)-labeled anti-CD45 antibody (BD Pharmingen, San Diego, CA) at a 1:100 dilution on ice for 10 minutes. After washing, cells were resuspended in cold HBSS containing 2 μg/mL propidium iodide (PI) to exclude dead cells, and kept at 4°C until sorting. A 350-nm argon laser was used to excite Hoechst 33342 and PI. Analysis was performed on a triple-laser MoFlow instrument (DakoCytomation, Inc., Fort Collins, CO) at 405/30 (Hoechst blue) and 670/30 nm (Hoechst red), as described previously.18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2519) Google Scholar A second argon laser, tuned to 488-mm emission, excited FITC. The CD45-positive fraction was sorted and eliminated. Simultaneously, the SP was identified and selected by gating on the characteristic emission fluorescence profile of SP cells. Sorted cell populations were recovered in HBSS with 10% fetal calf serum and pelleted for RNA isolation or cytospun onto coated slides for histology and immunocytochemistry. Jejunal tissue from before and after EDTA epithelial isolation was fixed overnight in 10% normal buffered formalin and embedded in paraffin. Sections were cut, and along with cytospun CD45-negative SP cells, were stained by routine H&E. Slides of cytospun CD45-negative SP cells also were used to determine the expression of cytokeratins and α-smooth muscle actin by immunocytochemistry. Briefly, cells were fixed and permeabilized using the Intrastain Kit (DakoCytomation, Carpinteria, CA) according to the manufacturer's directions and cytospun to plus-coated slides. Next, slides were quenched in sodium borohydride (0.01 g/mL) for 30 minutes at room temperature, blocked in phosphate-buffered saline/1% normal goat serum for 30 minutes at room temperature, and then incubated with a monoclonal anti-pan cytokeratin-FITC (clone C-11; Sigma) or a monoclonal anti–α-smooth muscle actin-FITC (clone 1A4; Sigma) at 1:50 dilutions and 1 hour and 30 minutes, respectively. Slides were coverslipped using Vectashield mounting medium with DAPI (Vector Labs, Burlingame, CA) and sealed. Slides were evaluated using an Olympus 1X71 inverted microscope (Melville, NY) and processed with DeltaVision deconvolution (Applied Precision, Issaquah, WA). To characterize the intestinal SP, we analyzed it by FACS for the presence of hematopoietic stem-cell markers including sca-1, c-kit, Thy-1.2, and CD34 and for the epithelial stem cell marker β1-integrin. After staining with Hoechst 33342, aliquots of cells were labeled with CD45 (FITC or phycoerythrin [PE] conjugated) antibody in combination with either Sca-1–PE, c-kit-allophycocyanin (APC), Thy-1.2-PE, CD34-biotin, or β1-integrin-FITC antibodies. Biotinylated antibodies were detected with streptavidin APC. Cells were incubated for 15 minutes at 4°C. Cells then were centrifuged at 1000 × g for 5 minutes at 4°C, and the pellet was resuspended in cold HBSS containing 2 μg/mL PI to exclude dead cells, and kept at 4°C until sorting. The activities of the antibodies against hematopoietic stem-cell markers were verified by analogous FACS of murine bone marrow (data not shown). To determine the percentage of CD45-negative SP cells that were in the early stages of apoptosis, we used the Annexin V Apoptosis Detection Kit (CalBiochem, San Diego, CA) according to the manufacturer's directions. Briefly, mucosal cells isolated as outlined earlier were resuspended in HBSS/5% FBS to a concentration of 106 cells/mL and stained with Hoechst 33342 as described earlier. Annexin V–FITC and anti-CD45–PE were added simultaneously to the cell suspension at 1:400 and 1:100 dilutions, respectively. Cells were incubated for 15 minutes at 4°C. Cells then were centrifuged at 1000 × g for 5 minutes at 4°C and the pellet was resuspended in cold HBSS containing 2 μg/mL PI to exclude dead cells and kept at 4°C until sorting. Jejunal tissue from 2 adult C57Bl/6J mice was pooled for digestion, staining, and FACS as described earlier. Cells were collected from the CD45-negative SP and non-SP fractions. The experiment was repeated twice, giving n = 3 for the number of RNA samples, representing 6 mice in all. Total RNA was extracted from all fractions using RNAqueous-Micro Kit (Ambion, Inc., Austin, TX) according to the manufacturer's directions and treated with DNase I. The concentration of isolated total RNA was calculated from the absorbance at 260 nm obtained using a NanoDrop 1000 spectrophotometer (NanoDrop Technologies, Inc., Rockland, DE). Real-time reverse-transcription polymerase chain reaction was performed using an Applied Biosystems 7700 sequence detector on 1 ng of RNA using the Taqman One-step reverse-transcription polymerase chain reaction Master Mix Reagents Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Primer and probe sets were generated from the following sources: Musashi-111Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (426) Google Scholar, 18S ribosomal RNA, β-actin, nuclear fragile X interacting protein, lysozyme (Assay-on-Demand; Applied Biosystems), collagen IV, sucrase–isomaltase, and intestinal trefoil factor 3 (sequences shown in Table 1). For each probe the reporter dye was 6-FAM and the quenching dye was TAMRA. Data were analyzed using the ΔΔCt method28ABI PRISM 7700 sequence detection system.User bulletin #2. PE Applied Biosystems, Foster City, CA2001Google Scholar, 29Schmittgen T.D. Zakrajsek B.A. Mills A.G. Gorn V. Singer M.J. Reed M.W. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay comparison of endpoint and real-time methods.Anal Biochem. 2000; 285: 194-204Crossref PubMed Scopus (874) Google Scholar with 18S ribosomal RNA or β-actin mRNA as the constitutive marker. Pooled RNA from intact jejunums of 6 adult C57Bl/6J mice was used as the reference.Table 1Sequences of Custom-Made Primers and Probes for Quantitative Reverse-Transcription Polymerase Chain ReactionGeneAccession no.PrimerSequenceCollagenX04647FCCAGGAATATTTGGCTTGCAAIVRCAGAGCTCCCCTCATCTCCTTPACCACCTGGGCCAAACGCACTTCSucrase–isomaltaseXM_143332FTTCAAGAAATCACAACATTCAATTTACTAGRCTAAAACTTTCTTTGACATTTGAGCAAPAGTTTCATTCCAGGAAACAGGATCTTGCCTTFF3BC011042FTTGCTGGGTCCTCTGGGATARGCCGGCACCATACATTGGPCTGCAGATTACGTTGGCCTGTCTCCAANOTE. F, R, and P denote forward primer, reverse primer, and probe, respectively. Open table in a new tab NOTE. F, R, and P denote forward primer, reverse primer, and probe, respectively. Collected CD45-negative SP cells were plated in 24-well Primaria plates (BD Biosciences, San Jose, CA) at a density of 30,000 cells/well. The cells were cultured in high-glucose Dulbecco's modified Eagle medium supplemented with 10% FBS, 10 μg/mL insulin, 2 mmol/L glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin and maintained in a humidified 37°C incubator in an atmosphere of 95% air/5% CO2. Cells were cultured for a minimum of 14 days and remained unattached to the culture dish for that entire culture time. For assay of viability, aliquots of cells at 0, 7, and 14 days of culture were removed, added to an equal volume of Trypan blue (0.4%), and counted in a hemocytometer. Both mincing and digesting of intact jejunum with collagenase/dispase (mucosal preparation) and stripping of epithelium by EDTA (epithelial preparation) followed by dispase dissociation yielded mucus-free suspensions of individual cells suitable for FACS. The cell suspensions were stained with Hoechst 33342 and costained with both FITC-labeled anti-CD45 to eliminate cells of hematopoietic origin and PI to identify dead cells. Typical results of dual-wavelength FACS of viable cells based on the Hoechst fluorescence are shown in Figure 1. As can be seen in Figure 1 (top panel), a distinct SP was present with both whole mucosal preparations (Figure 1A) and epithelial preparations (Figure 1B). The use of antibodies to the pan leukocyte surface marker
Referência(s)