Portal de Periódicos da CAPES

Novel Sp Family-like Transcription Factors Are Present in Adult Insect Cells and Are Involved in Transcription from the Polyhedrin Gene Initiator Promoter

2001; Elsevier BV; Volume: 276; Issue: 26 Linguagem: Inglês

10.1074/jbc.m101537200

1083-351X

Aruna Ramachandran, Anjali Jain, Puneeta Arora, Murali Dharan Bashyam, Udayan Chatterjee, Sudip Ghosh, Veena K. Parnaik, Seyed E. Hasnain,

Plant Virus Research Studies

We earlier documented the involvement of a cellular factor, polyhedrin (polh) promoter-binding protein, in transcription from the Autographa californica nuclear polyhedrosis virus polh gene promoter. Sequences upstream of the polh promoter were found to influence polh promoter-driven transcription. Analysis of one such region, which could partially compensate for the mutated polh promoter and also activate transcription from the wild-type promoter, revealed a sequence (AcSp) containing a CACCC motif and a loose GC box resembling the binding motifs of the transcription factor Sp1. AcSp and the consensus Sp1 sequence (cSp) specifically bound factor(s) in HeLa and Spodoptera frugiperda(Sf9) insect cell nuclear extracts to generate identical binding patterns, indicating the similar nature of the factor(s) interacting with these sequences. The AcSp and cSp oligonucleotides enhanced in vivo expression of a polh promoter-driven luciferase gene. In vivo mopping of these factor(s) significantly reduced transcription from the polh promoter. Recombinant viruses carrying deletions in the upstream AcSp sequence confirmed the requirement of these factor(s) in polh promoter-driven transcription in the viral context. We demonstrate for the first time DNA-protein interactions involving novel members of the Sp family of proteins in adult insect cells and their involvement in transcription from the polh promoter. We earlier documented the involvement of a cellular factor, polyhedrin (polh) promoter-binding protein, in transcription from the Autographa californica nuclear polyhedrosis virus polh gene promoter. Sequences upstream of the polh promoter were found to influence polh promoter-driven transcription. Analysis of one such region, which could partially compensate for the mutated polh promoter and also activate transcription from the wild-type promoter, revealed a sequence (AcSp) containing a CACCC motif and a loose GC box resembling the binding motifs of the transcription factor Sp1. AcSp and the consensus Sp1 sequence (cSp) specifically bound factor(s) in HeLa and Spodoptera frugiperda(Sf9) insect cell nuclear extracts to generate identical binding patterns, indicating the similar nature of the factor(s) interacting with these sequences. The AcSp and cSp oligonucleotides enhanced in vivo expression of a polh promoter-driven luciferase gene. In vivo mopping of these factor(s) significantly reduced transcription from the polh promoter. Recombinant viruses carrying deletions in the upstream AcSp sequence confirmed the requirement of these factor(s) in polh promoter-driven transcription in the viral context. We demonstrate for the first time DNA-protein interactions involving novel members of the Sp family of proteins in adult insect cells and their involvement in transcription from the polh promoter. polyhedrin Autographa californica nuclear polyhedrosis virus base pair(s) polh promoter-binding protein electrophoretic mobility shift assay kilobase pair(s) polymerase chain reaction open reading frame 1,10-o-phenanthroline The temporally regulated and hyperactivated polyhedrin (polh)1 gene promoter of theAutographa californica nuclear polyhedrosis virus (AcNPV) belongs to the class of initiator promoters (1Smale S.T. Baltimore D. Cell. 1989; 57: 103-113Abstract Full Text PDF PubMed Scopus (1148) Google Scholar). The primary determinant of polh promoter function is the 8-bp sequence TAAGTATT, which encompasses the transcriptional start point and is absolutely necessary for transcription initiation (2Ooi B.G. Rankin C. Miller L.K. J. Mol. Biol. 1989; 210: 721-736Crossref PubMed Scopus (110) Google Scholar, 3Rankin C. Ooi B.G. Miller L.K. Gene ( Amst. ). 1988; 70: 39-50Crossref PubMed Scopus (125) Google Scholar). The minimal polh promoter with all of the essential cis-acting elements is defined as an 18-nucleotide region encompassing the initiator sequence (4Morris T.D. Miller L.K. Gene ( Amst. ). 1994; 140: 147-153Crossref PubMed Scopus (70) Google Scholar). A hexanucleotide sequence motif AATAAA, present within the minimal promoter immediately 5′ to the octanucleotide motif TAAGTATT, has been demonstrated, along with the octamotif, to be the target for binding of an unusual 30-kDa cellular transcription factor, the polh promoter-binding protein (PPBP) (5Burma S. Mukherjee B. Jain A. Habib S. Hasnain S.E. J. Biol. Chem. 1994; 269: 2750-2757Abstract Full Text PDF PubMed Google Scholar). PPBP is a phosphoprotein that binds with very high affinity and specificity and plays an important role in transcription from this promoter (6Ghosh S. Jain A. Mukherjee B. Habib S. Hasnain S.E. J. Virol. 1998; 72: 7484-7493Crossref PubMed Google Scholar), probably acting as an initiator binding protein involved in the recruitment of the transcription machinery (7Ptashne M. Gann A. Nature. 1997; 386: 569-577Crossref PubMed Scopus (940) Google Scholar). PPBP can also specifically bind to the coding strand of the promoter (8Mukherjee B. Burma S. Hasnain S.E. J. Biol. Chem. 1995; 270: 4405-4411Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) with increased affinity, compared with the duplex promoter, thus maintaining the promoter at the initiation point in a “melted” state allowing for increased rounds of transcription. Several AcNPV genes have been identified on the basis of their trans-regulatory activity in transient expression assays (9Todd J.W. Passarelli A.L. Miller L.K. J. Virol. 1995; 69: 968-974Crossref PubMed Google Scholar). Many of these, including a late gene that encodes a putative protein with motifs conserved in RNA polymerases (10Passarelli A.L. Todd J.W. Miller L.K. J. Virol. 1994; 68: 4673-4678Crossref PubMed Google Scholar), have been demonstrated to be activators of late and very late viral gene expression by virtue of their effects on early events in the viral infection cascade (9Todd J.W. Passarelli A.L. Miller L.K. J. Virol. 1995; 69: 968-974Crossref PubMed Google Scholar, 11McLachlin J.R. Miller L.K. J. Virol. 1994; 68: 7746-7756Crossref PubMed Google Scholar). A virus-encoded four-component RNA polymerase has been recently isolated from baculovirus-infected cells (12Guarino L.A. Xu B. Jin J. Dong W. J. Virol. 1998; 72: 7985-7991Crossref PubMed Google Scholar). However, reconstitution of polymerase activity has not been demonstrated in a cell-free system using the individually purified proteins. A viral factor, VLF-1, has been shown to transactivate the polh and p10 promoters, supposedly by interacting with the 3′-untranslated (“burst”) sequences of these two very late promoters (13Yang S. Miller L.K. J. Virol. 1999; 73: 3404-3409Crossref PubMed Google Scholar). Thus far, except for the host factor PPBP, no other protein that binds to the very late polh promoter and is directly involved in transcription has been identified (6Ghosh S. Jain A. Mukherjee B. Habib S. Hasnain S.E. J. Virol. 1998; 72: 7484-7493Crossref PubMed Google Scholar). Sp1 was first discovered in mammalian (HeLa) cells as an activator of transcription from the SV40 early promoter (14Dynan W.S. Tjian R.T. Cell. 1983; 35: 79-87Abstract Full Text PDF PubMed Scopus (911) Google Scholar). Sp1 is part of a larger Sp superfamily along with other members, sharing structural and (sometimes) functional homology (reviewed in Refs. 15Turner J. Crossley M. Trends Biochem. Sci. 1999; 24: 236-241Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar and 16Philipsen S. Suske G. Nucleic Acids Res. 1999; 27: 2991-3000Crossref PubMed Scopus (533) Google Scholar). Sp family members bind to GC and GT box sequence motifs present in a variety of cellular and viral promoters (17Benoist C. Chambon P. Nature. 1981; 290: 304-310Crossref PubMed Scopus (539) Google Scholar, 18Jackson S.P. MacDonald J.J. Lees-Miller S. Tjian R. Cell. 1990; 63: 155-165Abstract Full Text PDF PubMed Scopus (517) Google Scholar, 19Kadonaga J.T. Carner K.R. Masiarz F.R. Tjian R. Cell. 1987; 51: 1079-1090Abstract Full Text PDF PubMed Scopus (1250) Google Scholar) via three highly conserved C2H2 zinc finger motifs present in the C-terminal region of the protein (19Kadonaga J.T. Carner K.R. Masiarz F.R. Tjian R. Cell. 1987; 51: 1079-1090Abstract Full Text PDF PubMed Scopus (1250) Google Scholar). The N-terminal glutamine-rich domains of Sp1, which are more divergent among the family members, are essential for transcriptional activation function (20Pascal E. Tjian R. Genes Dev. 1991; 5: 1646-1656Crossref PubMed Scopus (355) Google Scholar, 21Su W. Jackson S. Tjian R. Echols H. Genes Dev. 1991; 5: 820-826Crossref PubMed Scopus (259) Google Scholar). Interaction between the glutamine-rich activation domains of Sp1 and TATA-binding protein-associated cofactors plays an essential role in the activation of TATA-less promoters (22Smale S.T. Schmidt M.C. Berk A.J. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4509-4513Crossref PubMed Scopus (353) Google Scholar). The polyhedrin promoter also being a TATA-less initiator promoter prompted us to investigate the requirement of Sp-like factors in transcription from this promoter. In this report, we present the analyses of DNA sequences upstream of the polh gene promoter and of the factors binding to identified elements within these regions vis-à-vis their effect on transcription from the polh promoter in Spodoptera frugiperda (Sf9) cells. Two regions that influence transcription from the polh promoter were identified. One of these regions has Sp1-binding motifs, can bind to probable Sp family-like factors from Sf9 cells, and can complement the lack of initiator promoter-based transcription. Sequestering in vivoof the Sp family-like factor(s), which is distinct from PPBP, significantly reduced transcription from the polh promoter, confirming its involvement in polh promoter-driven transcription. Recombinant viruses with deletions in the polh promoter upstream sequences underscored the importance of these factor(s) in the viral context as well and indicated that the enhancement of reporter gene expression was not merely due to an enhancement of viral replication. Sf9 cells were cultured in TNMFH (Life Technologies, Inc.) medium supplemented with 10% fetal calf serum as described (23O'Reilly D.R. Miller L.K. Luckow V.A. Baculovirus Expression Vectors: A Laboratory Manual. W. H. Freeman and Co., New York1992Google Scholar). Wild-type AcNPV strain C6 was used for cell infection in transient expression assays. Recombinant viruses were constructed by first cloning the polh-driven luciferase gene with intact upstream sequences (pBacMAluc), an 800-bp upstream deletion (pBacΔluc), or a deletion substituted by the AcSp sequence (pBacAcSpluc) into the pBacPAK8 baculovirus transfer vector (CLONTECH Laboratories Inc., Palo Alto, CA). Each plasmid was then transfected into Sf9 cells along with BacPAK6 viral DNA (Bsu36I digest), and recombinant viruses were constructed, purified, and titrated as per the manufacturer's instructions (CLONTECH). Viral infection was carried out with a multiplicity of infection of 10 of each virus. To ascertain that equal amounts of viral DNA from the different recombinants had entered the insect cells, equal amounts of the reaction mixtures were fixed by dot-blot onto a nylon membrane after the luciferase assay, followed by probing with theluc cDNA and densitometric scanning. Crude nuclear protein extracts from Sf9 cells were prepared as described (24Hasnain S.E. Habib S. Jain A. Burma S. Mukherjee B. Methods Enzymol. 1996; 274: 20-32Crossref PubMed Scopus (11) Google Scholar). The consensus Sp1-binding oligonucleotide (cSp, TATTCGATCGGGGCGGGGCGAGCC) was obtained commercially from Promega Inc., and the AcSp oligonucleotide (TAATGGGGTGTATAGTACCGCTGCGCATAGTC) was chemically synthesized (Rama Biotechnology, Hyderabad, India). Complementary synthetic oligonucleotides were annealed and labeled with T4 polynucleotide kinase using [γ-32P]ATP. The binding reaction consisted of ∼5 μg of nuclear extract and 1 ng of labeled annealed oligonucleotide (∼104 cpm). For EMSAs, the crude nuclear extract was incubated in the presence of the binding buffer (10 mmTris-HCl, pH 7.5, 0.7 mm Hepes-KOH, pH 7.7, 30 mm KCl, 1 mm EDTA, 50 mm EGTA, 0.8 mm MgCl2, 7 mm dithiothreitol, 1 mg/ml bovine serum albumin, 0.05% Nonidet P-40, 10% glycerol) and 1 μg of poly(dI-dC) for 10 min at 25 °C followed by incubation of32P-labeled oligonucleotide for 20 min. The DNA-protein complexes were resolved at 4 °C in an 8% (75:1 acrylamide/bisacrylamide) nondenaturing polyacrylamide gel in 0.5× TBE buffer (0.045 m Tris borate, 0.001 m EDTA) at 200 V for 3 h. The gel was dried, covered with plastic wrap, and exposed overnight to Hyperfilm MP (Amersham Pharmacia Biotech) at −70 °C. For competition analyses, a 400-fold excess of the appropriate unlabeled, double-stranded DNA was added along with the labeled DNA in the binding reaction. Radiolabeled oligonucleotide used as a probe is marked by an asterisk in all EMSA figures. For EMSAs using the pure Sp1 protein (Promega Inc.), 1 footprinting unit of Sp1 (∼25 ng of protein) was used in the binding reaction without the addition of poly(dI-dC). The remaining conditions were identical with all other EMSAs. All DNA manipulations were carried out as described (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). For the construction of pAJpolluc (Fig.1) harboring the wild-type polh promoter, the 92-bp EcoRV-BamHI promoter fragment was obtained from the transfer vector pVL1393 (26Hasnain S.E. Nakhai B. Gene ( Amst. ). 1990; 91: 135-138Crossref PubMed Scopus (28) Google Scholar) and cloned at theHincII-BamHI site of plasmid pAJluc (a derivative of pUC18 carrying the 1892-bp luc gene (26Hasnain S.E. Nakhai B. Gene ( Amst. ). 1990; 91: 135-138Crossref PubMed Scopus (28) Google Scholar) ligated at theBamHI site), placing it upstream from the luciferase reporter gene. pAJmHluc (Fig. 2) carried a synthetic 65-mer polh promoter with the mutated hexanucleotide motif (CCGCCC instead of AATAAA) cloned at theHindIII-SalI site of pAJluc driving theluc gene. pKNluc (Fig. 1) was constructed by cloning theluc gene at the BamHI site downstream of the polh promoter within the transfer vector pVL1393. A 2.77-kbSalI-HindIII fragment from pKNluc was ligated at the SalI-HindIII sites of pUC18 to obtain the construct pKN603luc (Fig. 1).Figure 2The upstream ORF603 region partially compensates for the mutated polyhedrin promoter. Schematic representation of the plasmid constructs pAJpBS603-luc with the unmutated hexamotif AATAAA, pAJpBS603mH-luc carrying the mutated hexamotif CCCCCC in place of AATAAA, and pAJmHluc carrying the mutated promoter with no upstream sequences, along with their respective luciferase activity values.View Large Image Figure ViewerDownload Hi-res image Download (PPT) pAcSp·pol·luc and pcSp·pol·luc vectors were constructed by cloning the AcSp oligonucleotide and the cSp oligonucleotide, respectively, at the PstI-HindIII site in pAJpolluc and confirmed by dideoxy sequencing. pAR1 and pAR2 vectors used for the in vivo mopping experiments were constructed by cloning the AcSp and cSp oligonucleotides, respectively, at the PstI-HindIII site in pUC19. pBacMAluc was constructed by cloning the luc gene at theBamHI site of the pBacPAK8 transfer vector. pAcSp·pol·luc and pAJpolluc were digested with PvuII andSacI to release the promoter-luciferase cassette with and without the AcSp oligonucleotide, respectively, and end-filled using the Klenow fragment of Escherichia coli DNA polymerase I (New England BioLabs, Beverly, MA). The AcSp-containing fragment was cloned into the MluI-XhoI sites of pBacPAK8 (after end-filling the digested vector fragment first), whereas the other PvuII-SacI fragment was cloned into theMluI-SmaI site of pBacPAK8. The clones so obtained were called pBacAcSpluc and pBacΔluc, respectively. For site-directed mutagenesis experiments, the 2.77-kb SalI-HindIII fragment from pKNluc was cloned within the polylinker region of the 3.0-kb phagemid pBS+ to generate the construct, pAJpBS603-luc (Fig. 2). The plasmid construct pAJpBS603-luc was transformed into competent TG1 cells and infected with the phage M13KO7, and single-stranded template DNA was isolated and used for site-directed mutagenesis using standard protocols (25Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The quality of the template was checked by sequencing with a T7 primer. Five picomoles of a 24-mer oligonucleotide (CATCTCGCACCCCCCTAAGTATTT), spanning the region to be mutated and harboring the mutated version of the hexamotif (underlined), was phosphorylated with 5 mm ATP for 30 min at 37 °C. It was annealed to the single-stranded DNA template followed by extension and ligation reactions in the presence of Klenow and T4 DNA ligase enzymes. The reaction mixture was transformed into competent TG1 cells to generate pAJpBS603mH-luc (Fig. 2), and the mutant clones were identified by colony hybridization using the 24-mer oligonucleotide as a probe. The mutation was confirmed by dideoxy sequencing. The expression of luciferase in Sf9 cells transfected with the reporter plasmids was carried out as described (27Habib S. Pandey S. Chatterji U. Burma S. Ahmad R. Jain A. Hasnain S.E. DNA Cell Biol. 1996; 15: 737-747Crossref PubMed Scopus (28) Google Scholar). Light emission was monitored with a manual luminometer (model 1250; Bio-Orbit Oy, Turku, Finland) over an integration period of 10 s. All of the transfections were repeated, in duplicate, at least three times. To ascertain that equal amounts of plasmid DNA from the different constructs had entered the insect cells, equal amounts of the reaction mixture after the luciferase assay were fixed by dot-blot on a nylon membrane followed by probing with the luc cDNA and densitometric scanning. All transfections included appropriate negative controls, viz. mock-transfected Sf9 cells and cells subjected only to viral infection without plasmid transfection. In vivo mopping (28Habib S. Hasnain S.E. J. Biol. Chem. 1996; 271: 28250-28258Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) was monitored on a Lumicount microplate luminometer (Packard Instrument Company, Meriden, CT) according to the manufacturer's instructions. For this, 2 μg of the reporter plasmid was used (pAcSp·pol·luc or pcSp·pol·luc) with or without 18 μg of specific competitor (pAR1 or pAR2) or nonspecific competitor (pUC19). The binding reaction was carried out as described for the EMSAs, but after incubation with the labeled probes the tubes were exposed to short-wave UV light for half an hour using a hand-held UV monitor (model UVGL-58; UVP, Inc., San Gabriel, CA), and the DNA-protein complexes were resolved as described earlier (5Burma S. Mukherjee B. Jain A. Habib S. Hasnain S.E. J. Biol. Chem. 1994; 269: 2750-2757Abstract Full Text PDF PubMed Google Scholar). A 140-bp PCR product was generated using forward and reverse primers termed FPL and FPR, corresponding to the coding and noncoding strands of AcNPV, respectively, containing the AcSp motif approximately in the center of the amplicon. The primer sequences are: FPL, TATGTATCTATCGTATAGAG, and FPR, ACACACTCCGAAGAACTACC. 5 ng of pKN603luc was used as the template for PCR. 200 ng of each primer was radiolabeled with T4 polynucleotide kinase (New England BioLabs) and [γ-32P]ATP and used separately in a PCR reaction along with an equal amount of unlabeled opposite primer to generate a radiolabeled coding or noncoding strand. The PCR products were gel-purified and concentrated to a final volume of about 100 μl. 2 μl was used to take Cerenkov counts in a scintillation counter. About 25,000 cpm was used per reaction. The DNase I reaction was carried out at ambient temperature as follows. The binding reaction was carried out using 4 footprinting units (∼100 ng) of pure recombinant human Sp1 (Promega Inc.), as per the Sp1 EMSA conditions in a volume of 40 μl followed by the addition of 40 μl of a 5 mm CaCl2, 10 mmMgCl2 mix. 30 s later, 1.3 μl of 1:3 diluted RNase-free DNase I (Promega Inc.) was added and incubated for 2 min, followed by the addition of 90 μl of stop solution (200 mm NaCl, 30 mm EDTA, 1% SDS). The DNA was extracted twice with an equal volume of 1:1 phenol:chloroform, and glycogen was added to a final concentration of 20 mg/ml; the mixture was precipitated with ethanol at −70 °C for 3 h, washed twice with 70% ethanol, and resuspended in 5 μl of sequencing loading buffer containing 90% formamide. Control DNase I reactions were carried out under identical conditions except that no protein was added. A + G ladders were generated for both strands using formic acid and piperidine according to the method of Maxam and Gilbert (29Maxam A.M. Gilbert W. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 560-564Crossref PubMed Scopus (5442) Google Scholar). Equal counts of all reactions were loaded onto an 8% denaturing acrylamide gel containing 1× TBE and 8 m urea and resolved at 75 watts for 2 h, after which the gel was fixed for 10 min in 10% acetic acid and 20% methanol, covered with plastic film, dried under vacuum, and subjected to autoradiography at −70 °C. A series of progressive Bal31 exonuclease deletion constructs of pNEluc (30Hasnain S.E. Nakhai B. Ehtesham N.Z. Sridhar P. Ranjan A. Talwar G.P. Jha P.K. DNA Cell Biol. 1994; 13: 275-282Crossref PubMed Scopus (12) Google Scholar), encompassing the complete 4-kb sequence upstream from the polh gene promoter within theAcNPV EcoRI-I fragment, were generated and used in luciferase-based transient expression assays (31Sridhar P. Awasthi A.K. Azim C.A. Burma S. Habib S. Jain A. Mukherjee B. Ranjan A. Hasnain S.E. J. Biosci. ( Bangalore ). 1994; 19: 603-614Google Scholar). This deletion analysis identified two regions, region I and region II, spanning map units 0–1.5 and 2.5–3.12, respectively, on the EcoRI “I” fragment of the viral genome. Deletion of these sequences resulted in a drastic reduction of reporter gene expression in comparison with the original pNEluc plasmid construct (31Sridhar P. Awasthi A.K. Azim C.A. Burma S. Habib S. Jain A. Mukherjee B. Ranjan A. Hasnain S.E. J. Biosci. ( Bangalore ). 1994; 19: 603-614Google Scholar). Having identified the approximate boundaries of upstream sequences influencing polh promoter activity, three clones with defined upstream sequences were constructed and used in luciferase-based transient expression assays to evaluate the effect of such cis-acting sequences on the minimal promoter-driven expression (Fig. 1). pAJpolluc displayed basal luciferase expression, pKN603luc consistently showed 2–3-fold increased expression above pAJpolluc, and pKNluc displayed about a 20-fold increase in basal expression. The results complement our earlier observations that the 4-kb sequence upstream from the polh promoter does contain sequence elements that enhance basal polh expression. Having demonstrated the stimulatory role of the upstream 766-bp sequence on reporter gene expression from the polh basal promoter, we evaluated the importance of this sequence vis-à-vis the essential determinants of this promoter. We previously showed that the hexamotif (AATAAA) present within the initiator region of the polyhedrin promoter is critical for PPBP binding (5Burma S. Mukherjee B. Jain A. Habib S. Hasnain S.E. J. Biol. Chem. 1994; 269: 2750-2757Abstract Full Text PDF PubMed Google Scholar, 8Mukherjee B. Burma S. Hasnain S.E. J. Biol. Chem. 1995; 270: 4405-4411Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) and subsequent expression from this promoter (6Ghosh S. Jain A. Mukherjee B. Habib S. Hasnain S.E. J. Virol. 1998; 72: 7484-7493Crossref PubMed Google Scholar). To further extend this observation, the expression of luciferase in pAJmHluc was compared with pAJpBS603mH-luc. Luciferase expression from the construct pAJpBS603-luc (carrying an intact hexamotif and the ORF603 sequence) was used as a control. pAJpBS603mH-luc exhibited reduced lucexpression compared with pAJpBS603-luc, but this activity was still significantly higher than pAJmHluc, which did notcarry the ORF603 upstream sequence. In pAJmH−luc (where the hexamotif was mutated without the presence of any upstream sequences), luciferase activity above the background cut-off limit of 10 mV was not detected. These data demonstrate that the hexamotif is critical for promoter function; however, its absence can be compensated, albeit to a lesser extent, by sequence elements within the upstream region II containing ORF603. To arrive at the sequence determinants involved in rescuing basal transcription in the presence of the mutant polh initiator, the ORF603 sequence was scanned for binding motifs specific for known transcription factors. A region from −438 to −468, termed as AcSp, which was GC-rich in the otherwise AT-rich baculovirus genome, was identified within this sequence stretch (Fig. 1). Analysis of this sequence showed some similarity to the GC-rich sequences that bind the general transcription factor Sp1, which is known to play an important role in the initiator-mediated mechanisms of transcription (32Ham J. Steger G. Yaniv M. EMBO J. 1994; 13: 147-157Crossref PubMed Scopus (58) Google Scholar, 33Zenzie-Gregory B. Khachi A. Garuaway I.P. Smale S.T. Mol. Cell. Biol. 1993; 13: 3841-3849Crossref PubMed Scopus (91) Google Scholar, 34Chalkley G.E. Peter Verrijzer C. EMBO J. 1999; 18: 4835-4845Crossref PubMed Scopus (176) Google Scholar). Comparison of the AcSp sequence with the Sp1-binding motif consensus (defined by comparing sequences from 36 sources) (35Jones K.A. Kadonaga J.T. Luciw P.A. Tjian R.T. Science. 1986; 232: 575-759Crossref PubMed Scopus (446) Google Scholar, 36Kadonaga J.T. Jones K.A. Tjian R.T. Trends Biochem. Sci. 1986; 11: 20-23Abstract Full Text PDF Scopus (878) Google Scholar), (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(G/T), identified two putative Sp family binding motifs, TACCGCTGC, with about 70% homology with the consensus GC box, and a consensus CACCC motif, which is bound by some Sp family proteins. This analysis and the fact that the polh promoter is an initiator promoter pointed to the possibility of the involvement of an Sp1-mediated mechanism in polh promoter regulation. EMSAs were carried out to ascertain the presence oftrans-acting factor(s) in Sf9 cells that could bind to the AcSp motif. The oligonucleotides corresponding to the cSp sequence and the AcSp sequence were used as probes in EMSAs with nuclear extracts prepared from uninfected and AcNPV-infectedSf9 cells (24Hasnain S.E. Habib S. Jain A. Burma S. Mukherjee B. Methods Enzymol. 1996; 274: 20-32Crossref PubMed Scopus (11) Google Scholar). It is evident that at least one complex of similar mobility is obtained with both uninfected (Fig.3 a, lanes 3 and4) and infected (lanes 5 and 6) nuclear extracts using both probes. In addition, a faster mobility complex is also evident under these binding conditions with uninfected cell nuclear extract (lanes 3 and 4) with both of the probes. These results demonstrate the presence of a host factor(s) in the insect cell nuclear extracts that can bind to the Sp1-like sequence motif present within ORF603 of region II (AcSp) as well as cSp. The Sp-like complex generated with uninfectedSf9 nuclear extract was subjected to cross-competition analyses in EMSAs using authentic Sp1-binding motifs. Fig.3 b shows AcSp binding to (uninfected) Sf9 nuclear extract in the absence of any cold competitor (lane 2) and in the presence of AcSp, cSp, and pUC18 cold competitors (lanes 3, 4, and 5, respectively). It is interesting to note that in certain instances the consensus Sp1 sequence can compete even better than the homologous competitor for the AcSp probe. This is understandable because the factor(s) present could well have a higher affinity for the Sp1 cognate sequence defined by cSp rather than the AcSp sequence. pUC18 did not compete for the binding, further pointing to the specificity of the complexes formed. Having shown that the Sf9 Sp-like factor(s) binding to the AcSp sequence can be effectively competed out by the consensus Sp1 sequence, the reverse experiment was carried out using radiolabeled cSp oligonucleotide as a probe in EMSAs. It is apparent that the binding (Fig. 3 c, lane 3) was abolished after homologous cold competition (lane 4), but when cold AcSp was used as a competitor (lane 5), the complex with reduced mobility was competed out rather inefficiently. This is further evident after comparison of the competition with the nonspecific competitor pUC18 (lane 6). Interestingly, the complex of higher mobility (lower shift) was better competed.Lanes 1 and 3 show cSp mobility without and with the nuclear extract, respectively. Lane 2 shows the binding of AcSp with the nuclear extract to compare the similar nature of the shifts obtained with both of the probes. The data presented above established the presence of factor(s) present in Sf9 cells, which specifically bind to AcSp as well as to the Sp1 consensus sequence, indicating that the insect factor(s) behaved like the Sp family of proteins in terms of cognate sequence recognition and cross-cold competitions. It was therefore pertinent to investigate whether the Sf9 Sp family complex is the same as the well characterized Sp family of factors present in HeLa cells. Fig.3 d shows the binding of AcSp and cSp with Sf9 and HeLa nuclear extracts. Lanes 3 and 5 show the binding of factor(s) present in Sf9 and HeLa extracts to radiolabeled AcSp, respectively. Lanes 4 and 6show the binding