TNF-α/IL-17 synergy inhibits IL-13 bioactivity via IL-13Rα2 induction
2014; Elsevier BV; Volume: 134; Issue: 4 Linguagem: Inglês
10.1016/j.jaci.2014.05.019
ISSN1097-6825
AutoresVahe Badalyan, Robert W. Thompson, Kezia Addo, Lee A. Borthwick, Andrew J. Fisher, Tatiana Ort, Timothy G. Myers, Thomas A. Wynn, Thirumalai R. Ramalingam,
Tópico(s)Dermatology and Skin Diseases
ResumoIL-13 is a pleiotropic cytokine that provokes diverse pathophysiological outcomes. Although its effect during gastrointestinal helminth infection is prototypic of a protective TH2 response (increased peristalsis, goblet cell hyperplasia and mucus secretion, eosinophil recruitment, fibroblast activation, and wound repair), temporal or spatial dysregulation of this response is thought to underlie diseases such as asthma, allergic hyperreactivity, and organ fibrosis.1Wynn T.A. IL-13 effector functions.Annu Rev Immunol. 2003; 21: 425-456Crossref PubMed Scopus (806) Google Scholar IL-13 signals via the IL-13Rα1/IL-4Rα heterodimer to induce several genes specific to TH2 inflammation including CCL26, CCL11, POSTN, and MUC5AC.2Ramalingam T.R. Pesce J.T. Sheikh F. Cheever A.W. Mentink-Kane M.M. Wilson M.S. et al.Unique functions of the type II interleukin 4 receptor identified in mice lacking the interleukin 13 receptor alpha1 chain.Nat Immunol. 2008; 9: 25-33Crossref PubMed Scopus (149) Google Scholar IL-13Rα2 binds IL-13 with significantly higher affinity, and the secreted form found in mice acts as a decoy receptor, protecting mice from IL-13–induced immunopathology. However, humans do not alternatively splice the IL13RA2 transcript and therefore IL-13Rα2 is expressed only as a cell surface protein.3Tabata Y. Khurana Hershey G.K. IL-13 receptor isoforms: breaking through the complexity.Curr Allergy Asthma Rep. 2007; 7: 338-345Crossref PubMed Scopus (64) Google Scholar The factors that regulate the expression of IL-13Rα2 are unclear, and the biological function of the endogenously expressed IL-13Rα2 remains controversial.4O'Toole M. Legault H. Ramsey R. Wynn T.A. Kasaian M.T. A novel and sensitive ELISA reveals that the soluble form of IL-13R-alpha2 is not expressed in plasma of healthy or asthmatic subjects.Clin Exp Allergy. 2008; 38: 594-601Crossref PubMed Scopus (35) Google Scholar, 5Fichtner-Feigl S. Strober W. Kawakami K. Puri R.K. Kitani A. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGF-beta1 production and fibrosis.Nat Med. 2006; 12: 99-106Crossref PubMed Scopus (753) Google Scholar In this study, we show that the inflammatory cytokines TNF-α and IL-17, often associated with severe asthma, synergize to induce IL-13Rα2 in primary human lung fibroblasts and mouse lungs, and evaluate its biological role using a novel IL-13Rα2–blocking antibody. Primary human neonatal lung fibroblasts (NLFs) were grown to confluence and incubated with TNF-α, IL-4, and IL-17 for 72 hours, at which time cell lysates were analyzed by using quantitative PCR with primers specific for IL13RA2 (see the Methods section in this article's Online Repository at www.jacionline.org). Although TNF-α and IL-4 synergistically induced IL13RA2 as described,6Yoshikawa M. Nakajima T. Tsukidate T. Matsumoto K. Iida M. Otori N. et al.TNF-alpha and IL-4 regulate expression of IL-13 receptor alpha2 on human fibroblasts.Biochem Biophys Res Commun. 2003; 312: 1248-1255Crossref PubMed Scopus (33) Google Scholar a combination of TNF-α and IL-17 induced higher expression (Fig 1, A). In contrast, IL13RA1 decreased in the presence of TNF-α (Fig 1, B). IL-13Rα2 mRNA progressively increased over time, peaking at 72 hours (Fig 1, C), and longer incubations did not consistently result in any further increase (data not shown); therefore, 72 hours was chosen as the ideal end point for subsequent experiments. To determine whether IL-13Rα2 expression was sustainable, NLFs were incubated with a combination of TNF/IL-17 for 72 hours, after which the supernatants were removed and the wells rinsed and replenished with fresh media without added cytokines. On removal of TNF-α and IL-17, IL-13Rα2 expression declined between 24 hours and 72 hours postwash, though it remained elevated (Fig 1, D). We confirmed that primary lung fibroblasts derived from healthy adult donors (adult lung fibroblasts) also manifested similar synergy to TNF-α and IL-17 (see Fig E1 in this article's Online Repository at www.jacionline.org). Using flow cytometry, we verified that the transcriptional induction of IL-13Rα2 was associated with augmented surface expression of protein (Fig 1, E and F). To ascertain whether this phenomenon can be recapitulated in vivo, we administered multiple doses of the cytokines into mouse airways. IL-13Rα2 transcripts were strikingly higher in the lungs of mice that received both TNF and IL-17, while IL-13Rα1 message changed negligibly (Fig 1, G). Next, we examined whether TNF/IL-17–induced expression of IL-13Rα2 was capable of altering the biological effects of IL-13. NLFs were incubated with TNF/IL-17 for 72 hours to upregulate IL-13Rα2. Subsequently, the wells were washed with media, and treated with IL-13 in increasing concentrations for 24 hours. Cellular RNA was assayed by using real-time quantitative PCR for CCL26 (eotaxin-3) expression, as a marker for the canonical IL-13 signaling through IL-13Rα1. The expression of CCL26 increased in a dose-dependent fashion on IL-13 stimulation in control wells in which IL-13Rα2 was at baseline levels, whereas the expression of CCL26 was abrogated in conditions in which the expression of IL-13Rα2 was augmented (Fig 2, A and B). Similar data were obtained with adult lung fibroblasts (see Fig E2 in this article's Online Repository at www.jacionline.org). Although the inhibition of IL-13 activity in the setting of increased IL-13Rα2 was likely due to the IL-13Rα2 receptor functioning as a decoy, a number of other alternative explanations, such as concomitant downregulation of IL-13Rα1 or dampening of intracellular signaling networks, could have also led to the attenuation of IL-13 bioactivity after TNF/IL-17 treatment. To investigate these possibilities, NLFs were first incubated with TNF/IL-17 to induce high IL-13Rα2 expression and before the addition of IL-13, some wells were treated with a highly selective neutralizing anti-human IL-13Rα2 mAb. Subsequently, wells were treated with IL-13 in increasing concentrations for 24 hours and CCL26 expression was assayed by using quantitative PCR. As before, in wells expressing basal levels of IL-13Rα2, CCL26 was induced in a dose-dependent fashion after IL-13 stimulation. In wells in which IL-13Rα2 was induced with TNF/IL-17, CCL26 expression was suppressed. However, in wells treated with anti–IL-13Rα2 antibody, addition of IL-13 resulted in the restoration of CCL26 expression in a dose-dependent fashion, confirming that the diminution of IL-13 activity by TNF/IL-17 was due to the increased expression of IL-13Rα2 (Fig 2, C). Although the above results confirm potent decoy activity for IL-13Rα2,7Campbell-Harding G. Sawkins H. Bedke N. Holgate S.T. Davies D.E. Andrews A.L. The innate antiviral response upregulates IL-13 receptor alpha2 in bronchial fibroblasts.J Allergy Clin Immunol. 2013; 131: 849-855Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar they fail to explore its signaling activity, which has been proposed in some studies.5Fichtner-Feigl S. Strober W. Kawakami K. Puri R.K. Kitani A. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGF-beta1 production and fibrosis.Nat Med. 2006; 12: 99-106Crossref PubMed Scopus (753) Google Scholar To uncover the possible signaling potential for this ligand-receptor pair in fibroblasts, we performed a transcriptome-wide microarray analysis in which the effect of IL-13 stimulation in NLFs with or without TNF/IL17 pretreatment, in the presence or absence of the anti–IL-13Rα2 mAb, was compared. With this approach, the effects of IL-13 signaling through IL-13Rα1 and IL-13Rα2 could be distinguished. CCL26 was the most abundant IL-13–induced transcript in this genome-wide screen, upregulated 12.3-fold (ie, 23.6, q value = 6 × 10−8) over baseline (Fig 2, D; see Fig E3 in this article's Online Repository at www.jacionline.org). On TNF/IL17 pretreatment, this diminished to 3.2-fold (21.7), in accord with the above-described IL-13Rα2–mediated inhibition. Surprisingly, although IL-13 binding to IL-13Rα2 reduced the transcript abundance of CCL26, it did not result in any additional statistically significant changes in the transcriptome profile of fibroblasts (Fig 2, D, and Fig E3) that were distinguishable from the pretreatment controls. Blocking IL-13Rα2 with the antibody restored IL-13–induced CCL26 expression (Fig 2, D, and Fig E3). These data indicate that in NLFs, IL-13 binding to the high-affinity IL-13Rα2 serves to dampen canonical IL-13 signaling, as opposed to inducing other signaling pathways. Asthma syndrome is a heterogeneous mixture of distinct phenotypic subtypes and only those cohorts that have a "IL-13 high" signature are indeed likely to benefit from therapeutic modalities that block IL-13/IL-13Rα1 interactions.8Corren J. Lemanske R.F. Hanania N.A. Korenblat P.E. Parsey M.V. Arron J.R. et al.Lebrikizumab treatment in adults with asthma.N Engl J Med. 2011; 365: 1088-1098Crossref PubMed Scopus (1380) Google Scholar Steroid-resistant and severe asthma subtypes are often associated with neutrophilia, TNF-α, and IL-17 activity9Seys S.F. Grabowski M. Adriaensen W. Decraene A. Dilissen E. Vanoirbeek J.A. et al.Sputum cytokine mapping reveals an 'IL-5, IL-17A, IL-25-high' pattern associated with poorly controlled asthma.Clin Exp Allergy. 2013; 43: 1009-1017Crossref PubMed Scopus (67) Google Scholar and therefore may not benefit from the blockade of IL-13, and perhaps the mechanisms we described above already operate in these patients to quench endogenous IL-13 activity via IL-13Rα2. Indeed, due caution must be exercised because blocking IL-13/IL-13Rα1 interactions in these patients might actually lead to disease aggravation because IL-13 has been shown to downmodulate the inflammation induced by TNF-α and IL-17.10Newcomb D.C. Boswell M.G. Zhou W. Huckabee M.M. Goleniewska K. Sevin C.M. et al.Human TH17 cells express a functional IL-13 receptor and IL-13 attenuates IL-17A production.J Allergy Clin Immunol. 2011; 127 (e1-4): 1006-1013Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar We thank the Wynn lab members for helpful suggestions. Human lung fibroblasts were purchased from the American Type Culture Collection (ATCC CCL-75, Rockville, Md). Adult primary lung fibroblasts were isolated from healthy adult donors at Newcastle University, Newcastle upon Tyne, United Kingdom, as previously described.E1Suwara M.I. Green N.J. Borthwick L.A. Mann J. Mayer-Barber K.D. Barron L. et al.IL-1alpha released from damaged epithelial cells is sufficient and essential to trigger inflammatory responses in human lung fibroblasts.Mucosal Immunol. 2014; 7: 684-693Crossref PubMed Scopus (125) Google Scholar All participants provided informed consent before participation in this study. All aspects of the study were approved by Newcastle and North Tyneside Local Research Ethics Committee (Ref. 2001/179). Fibroblasts were incubated in Dulbecco's modified Eagle medium (Life Technologies, Carlsbad, Calif) supplemented with 10% FBS, 4 mM l-glutamine, 100 units/mL of penicillin G, and 100 μg/mL of streptomycin. Cells were passaged every 4 to 7 days, and passages 4 to 9 were used in all experiments. Confluent fibroblasts were removed from flasks and wells by treatment with 0.05% trypsin in 0.53 mM EDTA and resuspended in serum-supplemented media to quench trypsin. Female BALB/c mice were purchased from Taconic Biotechnology (Germantown, NY). Experiments commenced when mice were 15 weeks old. All mice experiments were performed under protocols approved by the National Institute of Allergy and Infectious Diseases Animal Care and Use Committee and the National Institutes of Health Interagency Animal Model Committee. On days 1, 2, 8, and 9, mice were anesthetized with ketamine/xylazine and challenged intratracheally with saline or 1 ug of recombinant murine TNF-α and IL-17, singly, or in combination, diluted in 30 μL of saline. Mice were sacrificed on day 10, and their lungs were harvested and processed for RNA extraction. Recombinant human TNF-α, IL-4, IL-13, IL-17, and recombinant murine TNF-α were purchased from Peprotech (Rocky Hill, NJ). Recombinant mouse IL-17 was purchased from Biolegend (San Diego, Calif). Purified mouse anti-human IL-13Rα2 mAb was provided by Janssen Biotech (formerly Centocor Biotech, Springhouse, Pa). Fibroblasts were plated in Corning Costar 24-well cell culture plates (Corning Life Sciences, Tewksbury, Mass), with cell numbers ranging from 30,000 to 50,000 per well per experiment. Cells were stimulated with the human recombinant TNF-α, IL-4, and IL-17 A at concentrations of 20 ng/mL and IL-13 at concentrations of 0.1, 0.5, 2.5, and 20 ng/mL. Fibroblasts were incubated with the above cytokines for periods of 24 to 96 hours. Total RNA was extracted with an RNeasy kit (Qiagen, Valencia, Calif) or MagMAX-96 Total RNA Isolation Kit (Life Technologies) according to manufacturer instructions. Complementary DNA was synthesized using the Superscipt II (Life Technologies). Real-time quantitative PCR was performed with an ABI 7900HT using SYBR green chemistry. Data were analyzed using the comparative Ct method using SAGE software (http://sage.niaid.nih.gov). The table of primers used for quantitative PCR is given in Table E1. To assay for IL-13 bioactivity, CCL26 (eotaxin-3) was chosen on the basis of previous reports.E2Banwell M.E. Tolley N.S. Williams T.J. Mitchell T.J. Regulation of human eotaxin-3/CCL26 expression: modulation by cytokines and glucocorticoids.Cytokine. 2002; 17: 317-323Crossref PubMed Scopus (60) Google Scholar, E3Hoeck J. Woisetschlager M. Activation of eotaxin-3/CCLl26 gene expression in human dermal fibroblasts is mediated by STAT6.J Immunol. 2001; 167: 3216-3222Crossref PubMed Scopus (100) Google Scholar Two different passages of NLFs were first incubated with TNF/IL-17 for 72 hours to induce high IL-13Ra2 expression and some wells were treated with a highly selective neutralizing anti-human IL-13Ra2 mAb during the last 1 hour. Subsequently, the wells were washed with media, and treated with IL-13 for 20 hours. RNA quality was verified by using Bioanalyzer with RNA Integrity Number greater than 9.0 for all samples. Amplification and labeling of the RNA samples were performed using the Illumina TotalPrep RNA Amplification (Applied Biosystems) and an input of 500 ng of total RNA per sample. Biotinylated aRNA was hybridized to Illumina HumanHT-12 v4.0 Expression BeadChip (GEO Accession GPL10558) having 47,323 unique probes, using reagents provided, and imaged using the Illumina HiScan-SQ. Signal data were extracted from the image files with the Gene Expression module (v. 1.9.0) of the GenomeStudio software (v. 2011.1) from Illumina, Inc (San Diego, Calif). Signal intensities were converted to log2 scale. Calculation of detection P values is described in the GenomeStudio Gene Expression Module User Guide. Data for array probes with insufficient signal (detection P value < .1 in at least 2 arrays) were removed from the data set. After dropping nonperforming probes, Quantile normalization was applied across all arrays. ANOVA was performed on the normalized log2 expression estimates to test for mRNA expression differences. A P value of .05 was used for the statistical significance cutoff, after adjusting for the familywize error rate using the Benjamini-Hochberg method to account for multiple testing. Statistical analysis was performed using JMP/Genomics software (version 6.0; SAS Institute, Inc, Cary, NC). Full protocol and microarray data are accessible through GEO Series accession number GSE56338 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE56338). Fluorescence-activated cell sorting (FACS) analysis of cell surface receptors for IL-13 was performed with allophycocyanin-conjugated mouse anti-human IL-13Ra1 mAb (RnD Systems, Minneapolis, Minn) and phycoerythrin-conjugated mouse anti-human IL-13Ra2 mAb (Cell Sciences, Canton, Mass). Fibroblasts were briefly detached using 0.05% trypsin solution (Life Technologies) and incubated with manufacturer-recommended concentrations of anti-human IL-13Rα1 or IL-13Rα2 for 30 minutes at 4°C in FACS buffer (PBS supplemented with 1% FBS). Cells were washed twice with FACS buffer and acquired with BD FACS Canto II. Data were analyzed with FlowJo software (version 9.7.4; www.Flowjo.com). Individual replicate data are presented for each representative experiment, with group means as bars ± SEM. Unless otherwise specified, statistical significance was determined by using the unpaired 2-tailed t test and differences were considered significant at P < .05. Analysis was performed using GraphPad Prism (version 6.00; www.graphpad.com).Fig E2Induction of IL-13Rα2 by TNF-α and IL-17 in ALFs is associated with diminution of CCL26 expression by IL-13. Representative ALFs from a healthy donor were cultured with or without TNF-α and IL-17 for 72 hours. Media were replaced without or with low (0.5 ng/mL) or high (5 ng/mL) concentrations of IL-13 for 24 hours, at which time cells were harvested for RNA and quantitative PCR was performed for IL13RA2 and CCL26. ALFs, Adult lung fibroblasts.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3Expression profile of differentially expressed transcripts in response to IL-13, ± IL-13Rα2 induction, ± anti–IL-13Rα2 mAb. A, List of experimental groups and their treatment conditions that were studied in quadruplicates by microarray. B, Heat-map of log2 expression level, relative to media-only control. After pretreatment to induce IL-13Rα2, IL-13 was added in the presence or absence of anti–IL-13Rα2-blocking mAb. Entries for IL13 with q value > 0.05 (comparing media control) are not color coded. C, Venn diagram of statistically significant expression changes, showing the number of probes having log2 fold change > 0.5 (up or down) and false discovery rate–adjusted P value < .05. Ab, Antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Primer sequences used for quantitative PCRSpeciesGeneForwardReverseH sapiensIL13RA1TGAGTCTGCTGTGACTGAGCTCAGGTTTCACACGGGAAGTTH sapiensIL13RA2GGTCTTCCGGATGAAGGCTAGATATTGCCTCTCTCCCCGCH sapiensCCL26CTGGGTGCGAAGCTATGAATTCTTGCCTCTTTTGGTAGTGAAH sapiensGAPDHAGCCACATCGCTAGACACGCCCAATACGACCAAATCCM musculusHprtGCCCTTGACTATAATGAGTACTTCAGGTTCAACTTGCGCTCATCTTAGGM musculusIl13ra1CCTGAAGGAGCCAGTCCAAAGCCCACCTGCAGACAGATTTM musculusIl13ra2GGAAAGGAGGACAAAGAGGTCGATTTAGTGTGCTGAAAGCTCTACTC Open table in a new tab
Referência(s)