Highly Tolerated Amino Acid Substitutions Increase the Fidelity of Escherichia coli DNA Polymerase I
2007; Elsevier BV; Volume: 282; Issue: 16 Linguagem: Inglês
10.1074/jbc.m611294200
ISSN1083-351X
AutoresErn Loh, Juno Choe, Lawrence A. Loeb,
Tópico(s)Evolution and Genetic Dynamics
ResumoFidelity of DNA synthesis, catalyzed by DNA polymerases, is critical for the maintenance of the integrity of the genome. Mutant polymerases with elevated accuracy (antimutators) have been observed, but these mainly involve increased exonuclease proofreading or large decreases in polymerase activity. We have determined the tolerance of DNA polymerase for amino acid substitutions in the active site and in different segments of E. coli DNA polymerase I and have determined the effects of these substitutions on the fidelity of DNA synthesis. We established a DNA polymerase I mutant library, with random substitutions throughout the polymerase domain. This random library was first selected for activity. The essentiality of DNA polymerases and their sequence and structural conservation suggests that few amino acid substitutions would be tolerated. However, we report that two-thirds of single base substitutions were tolerated without loss of activity, and plasticity often occurs at evolutionarily conserved regions. We screened 408 members of the active library for alterations in fidelity of DNA synthesis in Escherichia coli expressing the mutant polymerases and carrying a second plasmid containing a β-lactamase reporter. Mutation frequencies varied from 1/1000- to 1000-fold greater compared with wild type. Mutations that produced an antimutator phenotype were distributed throughout the polymerase domain, with 12% clustered in the M-helix. We confirmed that a single mutation in this segment results in increased base discrimination. Thus, this work identifies the M-helix as a determinant of fidelity and suggests that polymerases can tolerate many substitutions that alter fidelity without incurring major changes in activity. Fidelity of DNA synthesis, catalyzed by DNA polymerases, is critical for the maintenance of the integrity of the genome. Mutant polymerases with elevated accuracy (antimutators) have been observed, but these mainly involve increased exonuclease proofreading or large decreases in polymerase activity. We have determined the tolerance of DNA polymerase for amino acid substitutions in the active site and in different segments of E. coli DNA polymerase I and have determined the effects of these substitutions on the fidelity of DNA synthesis. We established a DNA polymerase I mutant library, with random substitutions throughout the polymerase domain. This random library was first selected for activity. The essentiality of DNA polymerases and their sequence and structural conservation suggests that few amino acid substitutions would be tolerated. However, we report that two-thirds of single base substitutions were tolerated without loss of activity, and plasticity often occurs at evolutionarily conserved regions. We screened 408 members of the active library for alterations in fidelity of DNA synthesis in Escherichia coli expressing the mutant polymerases and carrying a second plasmid containing a β-lactamase reporter. Mutation frequencies varied from 1/1000- to 1000-fold greater compared with wild type. Mutations that produced an antimutator phenotype were distributed throughout the polymerase domain, with 12% clustered in the M-helix. We confirmed that a single mutation in this segment results in increased base discrimination. Thus, this work identifies the M-helix as a determinant of fidelity and suggests that polymerases can tolerate many substitutions that alter fidelity without incurring major changes in activity. DNA polymerases function in DNA replication, repair, and recombination and are essential for maintaining the integrity of the genome. Multiple DNA polymerases have been found in prokaryotes, eukaryotes, and viruses and may have different properties, including variations in the accuracy, or fidelity, of DNA synthesis (1Bessman M.J. Kornberg A. Lehman I.R. Simms E.S. Biochim. Biophys. Acta. 1956; 21: 197-198Crossref PubMed Scopus (99) Google Scholar, 2Burgers P.M.J. Koonin E.V. Bruford E. Blanco L. Burtis K.C. Christman M.F. Copeland W.C. Friedberg E.C. Hanaoka F. Hinkle D.C. Lawrence C.W. Nakanishi M. Ohmori H. Prakash L. Prakash S. Reynaud C.-A. Sugino A. Todo T. Wang Z. Weill J.-C. Woodgate R. J. Biol. Chem. 2001; 276: 43487-43490Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 3Matsuda T. Bebenek K. Masutani C. Hanaoka F. Kunkel T.A. Nature. 2000; 404: 1011-1013Crossref PubMed Scopus (325) Google Scholar, 4Beard W.A. Wilson S.H. Structure. 2003; 11: 489-496Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 5Plosky B.S. Woodgate R. Curr. Opin. Genet. Dev. 2004; 14: 113-119Crossref PubMed Scopus (98) Google Scholar). Polymerases that replicate large genomes typically have high fidelity, with error rates on the order of 10-5 to 10-6 (6Rattray A.J. Strathern J.N. Annu. Rev. Genet. 2003; 37: 31-66Crossref PubMed Scopus (138) Google Scholar, 7Thomas D.C. Roberts J.D. Sabatino R.D. Myers T.W. Tan C.K. Downey K.M. So A.G. Bambara R.A. Kunkel T.A. Biochemistry. 1991; 30: 11751-11759Crossref PubMed Scopus (93) Google Scholar, 8Hubscher U. Maga G. Spadari S. Annu. Rev. Biochem. 2002; 71: 133-163Crossref PubMed Scopus (583) Google Scholar) to prevent the accumulation of deleterious mutations in the genome. Deficits in DNA polymerase fidelity have been associated with cancer, accelerated aging, and infertility (9Kujoth G.C. Hiona A. Pugh T.D. Someya S. Panzer K. Wohlgemuth S.E. Hofer T. Seo A.Y. Sullivan R. Jobling W.A. Morrow J.D. Van Remmen H. Sedivy J.M. Yamasoba T. Tanokura M. Weindruch R. Leeuwenburgh C. Prolla T.A. Science. 2005; 309: 481-484Crossref PubMed Scopus (1548) Google Scholar, 10Trifunovic A. Wredenberg A. Falkenberg M. Spelbrink J.N. Rovio A.T. Bruder C.E. Bohlooly Y.M. Gidlof S. Oldfors A. Wibom R. Tornell J. Jacobs H.T. Larsson N.G. Nature. 2004; 429: 417-423Crossref PubMed Scopus (1957) Google Scholar, 11Goldsby R.E. Lawrence N.A. Hays L.E. Olmsted E.A. Chen X. Singh M. Preston B.D. Nat. Med. 2001; 7: 638-639Crossref PubMed Scopus (133) Google Scholar). Mutator and antimutator DNA polymerases harbor amino acid substitutions resulting in decreased and increased fidelity, respectively. These variant enzymes provide insights into the structural basis of accurate DNA synthesis (12Eger B.T. Kuchta R.D. Carroll S.S. Benkovic P.A. Dahlberg M.E. Joyce C.M. Benkovic S.J. Biochemistry. 1991; 30: 1441-1448Crossref PubMed Scopus (88) Google Scholar, 13Bebenek K. Joyce C.M. Fitzgerald M.P. Kunkel T.A. J. Biol. Chem. 1990; 265: 13878-13887Abstract Full Text PDF PubMed Google Scholar, 14Kunkel T.A. Bebenek K. Annu. Rev. Biochem. 2000; 69: 497-529Crossref PubMed Scopus (783) Google Scholar, 15Carroll S.S. Cowart M. Benkovic S.J. Biochemistry. 1991; 30: 804-813Crossref PubMed Scopus (115) Google Scholar, 16Minnick D.T. Bebenek K. Osheroff W.P. Turner R.M.J. Astatke M. Liu L. Kunkel T.A. Joyce C.M. J. Biol. Chem. 1999; 274: 3067-3075Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 17Donlin M.J. Johnson K.A. Biochemistry. 1994; 33: 14908-14917Crossref PubMed Scopus (35) Google Scholar, 18Bell J.B. Eckert K.A. Joyce C.M. Kunkel T.A. J. Biol. Chem. 1997; 272: 7345-7351Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Many mutators have been identified due to the availability of powerful selection methods (19Miller J.H. Suthar A. Tai J. Yeung A. Truong C. Stewart J.L. J. Bacteriol. 1999; 181: 1576-1584Crossref PubMed Google Scholar). The majority of studied mutators harbor amino acid substitutions in well conserved polymerase motifs. Mutator polymerases have also been used extensively in biotechnological applications, such as DNA sequencing and error-prone PCR (20Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6339-6343Crossref PubMed Scopus (299) Google Scholar). Far fewer antimutator enzymes have been identified due to the lack of selection methods. The ones identified thus far either exhibit substantially diminished catalytic activity or possess increased 3′-5′ exonuclease proofreading (21Muzyczka N. Poland R.L. Bessman M.J. J. Biol. Chem. 1972; 247: 7116-7122Abstract Full Text PDF PubMed Google Scholar, 22Gillin F.D. Nossal N.G. J. Biol. Chem. 1976; 251: 5225-5232Abstract Full Text PDF PubMed Google Scholar, 23Reha-Krantz L.J. Bessman M.J. J. Mol. Biol. 1977; 116: 99-113Crossref PubMed Scopus (32) Google Scholar). Decreased polymerase activity allows more time for removal of misincorporations by a proofreading exonuclease. Recent efforts to identify antimutators in proofreading-deficient constructs through 96-well screening have focused only on 3 residues within Motif C and have produced antimutators with less than 10% of wild-type activity (24Summerer D. Rudinger N.Z. Detmer I. Marx A. Angew. Chem. Int. Ed. Engl. 2005; 44: 4712-4715Crossref PubMed Scopus (48) Google Scholar). DNA polymerase I (Pol I) 4The abbreviation used is: Pol I, polymerase I.4The abbreviation used is: Pol I, polymerase I. is a high fidelity polymerase belonging to Family A, which includes Taq Pol I, T7 DNA polymerase, and human DNA polymerase γ, θ, and ν (6Rattray A.J. Strathern J.N. Annu. Rev. Genet. 2003; 37: 31-66Crossref PubMed Scopus (138) Google Scholar, 25Sharief F.S. Vojta P.J. Ropp P.A. Copeland W.C. Genomics. 1999; 59: 90-96Crossref PubMed Scopus (95) Google Scholar, 26Marini F. Kim N. Schuffert A. Wood R.D. J. Biol. Chem. 2003; 278: 32014-32019Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). In this work, we identified determinants of Pol I fidelity that do not involve alterations in proofreading by the 3′-5′ exonuclease and that do not cripple the polymerase activity. This was attained by conducting a comprehensive analysis of amino acid substitutions in Pol I that result in antimutator or mutator activity. We focused on mutations that directly affect nucleotide selection at the incorporation step. We report on the spectrum of amino acid substitutions that both maintain activity and confer either antimutator or mutator phenotypes. Our results indicate that although the catalytic site is optimized for base selection without loss of activity, it is still feasible to create more accurate DNA polymerases without greatly reducing catalytic activity. Furthermore, many of the mutations that affect fidelity are distant from the active site. Escherichia coli strain JS200 (SC-18 recA718 polA12 uvrA155 trpE6 lon-11 sulA1) was first described as SC18-12. Creation of the plasmids pECpolI-3′exo- and pLA230 have been previously described (27Shinkai A. Patel P.H. Loeb L.A. J. Biol. Chem. 2001; 276: 18836-18842Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 28Shinkai A. Loeb L.A. J. Biol. Chem. 2001; 276: 46759-46764Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). Custom oligonucleotides and chemicals were purchased from IDT (Coralville, IA) and Sigma unless otherwise specified. Creation of a Pol I Mutant Library—The E. coli polA gene encoded in plasmid pECpolI-3′exo- was mutated to introduce a PstI restriction site at nucleotide 1493. The polymerase domain was amplified from this plasmid using the primers GGACGTTACGCTGCAGAAG and CGACGGCCAGTGAATTCTTAG according to the error-prone PCR GeneMorph II kit (Stratagene, La Jolla, CA), which includes error-prone Taq Pol I mutant 53 (29Patel P.J. Kawate H. Adman E. Ashbach M. Loeb L.A. J. Biol. Chem. 2001; 276: 5044-5051Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The PCR product was gel-purified (Qiagen, Valencia, CA), cut using PstI and EcoRI (New England Biolabs, Ipswich, MA), and ligated into a pECpolI-3′exo- dummy vector. The dummy vector had Pol I nucleotides 2219-2646 deleted, resulting in an inactive polymerase. The ligated plasmids were transformed into TOP10 cells (Invitrogen). Library size was calculated by counting a fraction of the surviving transformants. Selection of Active Pol I Mutants—The library was transformed into JS200 cells, which were then plated on 2XYT agar and grown overnight at 37 °C. Surviving colonies were inoculated into LB and grown at 30 °C. Individual plasmids from both the unselected and selected library were recovered and sequenced. Analysis of the library mutation spectrum was performed on Phred-Phrap software (30Guo H.H. Choe J. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9205-9210Crossref PubMed Scopus (221) Google Scholar, 31Ewing B. Hillier L. Wendl M.C. Green P. Genome Res. 1998; 8: 175-185Crossref PubMed Scopus (4827) Google Scholar). The index of substitutability at each position was calculated as the percentage of clones containing a mutation at that residue divided by the total number of clones sequenced. Comparison of Evolutionary Conservation Index with Substitutability Index—An index of evolutionary conservation (Fig. 2B) was calculated based on an alignment of the E. coli polymerase domain with orthologues from 30 members of Family A, including representatives from bacteria (E. coli, Yersina pestis, Vibrio cholera, H. influenzae, Pseudomonas aeruginosa, Bordetella pertussis, Neisseria meningitidis, Nostoc7120, Taq, Deinococcus radians, Bst, Staphylococcus aureus, Streptococcus pyogenes, Clostridium tetani, Mycobacterium tuberculosis, Chlamydia trachomatis, and Helicobacter pylori), phage (T5, T7, and Spo1), and eukaryotes (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Homo sapiens DNA polymerase γ and θ, Mus musculus, Drosophila melanogaster, Leishmania major, Plasmodium falciparum, Arabidopsis thaliana, and Trypanosoma brucei) (32Ciccarelli F.D. Doerks T. von Mering C. Creevey C.J. Snel B. Bork P. Science. 2006; 311: 1283-1287Crossref PubMed Scopus (1138) Google Scholar, 33Braithwaite D.K. Ito J. Nucleic Acids Res. 1993; 21: 787-802Crossref PubMed Scopus (526) Google Scholar). The DNA polymerases analyzed were DNA polymerase I (bacteria) or DNA polymeraseγ (eukaryotes) unless otherwise noted. DNA polymeraseγ sequences were included to further differentiate residues that are absolutely required for catalytic activity. Sequences were obtained from Pubmed (available on the World Wide Web at www.ncbi.nlm.nih.gov/) and aligned with ClustalW version 1.83 (available on the World Wide Web at www.ebi.ac.uk/clustalw/). Screen for Mutations in Pol I That Alter Fidelity of DNA Synthesis—Plasmid pECpolI was recovered from active clones and transformed into fresh JS200. After recovery, cells were transformed with the second plasmid pLA230 and grown in LB to an A600 of 2.0 at 30 °C. The culture was then inoculated to a final dilution of 5 × 10-6 into 1 ml of 2XYT containing chloramphenicol (30 μg/ml) and kanamycin (50 μg/ml). Cultures were then grown with aeration for 20 h at 37 °C and plated on LB agar containing either chloramphenicol and carbenicillin (100 μg/ml) or chloramphenicol and kanamycin at a dilution sufficient for 100-500 colonies per plate. Several controls were included: wild type sequences, D424A,I709N, and D424A, I709N,A759R (34Camps M. Naukkarinen J. Johnson B.P. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 9727-9732Crossref PubMed Scopus (115) Google Scholar). Assays were performed in duplicate. Assay for Pol I Polymerase Activity—JS200 cells containing pECpolI mutants were grown in LB at 30 °C with 1 mm isopropyl 1-thio-β-d-galactopyranoside to induce protein expression. Cells were grown to an A600 of 2.0, at which time a 1.5-ml aliquot was pelleted, washed with 1 ml of 20 mm sodium phosphate (pH 7.2), and resuspended in 0.1 ml of the same buffer. Cells were lysed with 5 μl of lysozyme (10 mg/ml) and disrupted by freezing (-80 °C) and thawing. The cell extract was collected by centrifugation at 15,000 rpm for 15 min. The polymerase activity of the supernatant was assayed for ability to incorporate radioactive dTMP into activated calf thymus DNA at 37 °C as previously described (35Glick E. Anderson J.P. Loeb L.A. BioTechniques. 2002; 33: 1136-1144Crossref PubMed Scopus (10) Google Scholar). Assays were performed in triplicate. The background polymerase activity of the cell, measured from cells grown with an empty plasmid vector, was subtracted from all measurements. Protein Purification—Mutant and wild-type Klenow fragments, encompassing the 3′-5′ exonuclease domain and the polymerase domain, were subcloned into the pLEX vector (Invitrogen), expressed, and purified as previously described (27Shinkai A. Patel P.H. Loeb L.A. J. Biol. Chem. 2001; 276: 18836-18842Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). This Pol I construct included a six-histidine N terminus tag. In brief, the pLEX expression plasmid was introduced into E. coli GI724 (F2, l2, lacIq, lacPL8, ampC::Ptrp cI, mcrA, mcrB, INV(rnnd-rnnE)), and cells were grown at 30 °C in 500 ml of induction medium composed of M9 salts, 0.2% casamino acids, 0.5% glucose, 1 mm MgCl2, and 100 mg/ml carbenicillin. When the cultures reached an A600 of 0.5, tryptophan was added to a final concentration of 100 μg/ml, and the culture was incubated at 37 °C for 4 h. The cells were collected by centrifugation, washed with 40 ml of binding buffer (5 mm imidazole, 0.5 m NaCl, 20 mm Tris-HCl, pH 7.9), and suspended in 4 ml of the same buffer containing 200 μg/ml lysozyme and 0.04 ml Protease Inhibitor Mixture III (Calbiochem). Extracts were prepared by freezing/thawing on ice for 2 h, followed by centrifugation at 15,000 rpm for 15 min, and loaded onto a 4-ml nickel-resin column (Novagen, San Diego, CA). The column was washed with 80 ml of wash buffer (15 mm imidazole, 0.5 m NaCl, 20 mm Tris-HCl, pH 7.9) and serially with 8 ml of high imidazole wash buffer (30, 60, 120, and 200 mm imidazole, 0.5 m NaCl, 20 mm Tris-HCl, pH 7.9) and eluted with 8 ml of 400 mm imidazole, 0.5 m NaCl, 20 mm Tris-HCl, pH 7.9. The eluted sample was mixed with 2.5 ml of 80% glycerol and 12.5 μl of 1 m dithiothreitol and stored at 80 °C. Protein concentrations were determined by the method of Bradford. To assay the polymerase and 3′-5′ exonuclease activity, a DNA duplex with a 5′ overhang (template strand) was prepared using a template oligonucleotide, CCCGGGAAATTTCCGGAATTCGATATTGCTAGCGGGAATTCGGCGCG, and the primer oligonucleotide CGCGCCGAATTCCCGCTAGCAATAG, the latter of which was 32P-radiolabeled at the 5′ terminus. The purified enzyme (40 fmol) was incubated with the DNA duplex (20 fmol) in 10 μl of 50 mm Tris-HCl, pH 7.5, 10 mm KCl, 2.5 mm MgCl2, 1 mm dithiothreitol at 37 °C for 30 min. Klenow 3′-5′ exonuclease-proficient enzyme (4 fmol) was used as a control. Reactions were terminated with 20 μl of 98% formamide, 10 mm EDTA; 5 μl of each product was analyzed by electrophoresis through 14% denaturing acrylamide electrophoresis and quantified by phosphorimaging analysis. M13 Gapped Assay—We characterized the DNA synthesis fidelity of purified mutant and wild-type polymerase in vitro on the M13 gapped forward mutation assay, as previously described (36Bebenek K. Kunkel T.A. Methods Enzymol. 1995; 262: 217-232Crossref PubMed Scopus (192) Google Scholar). Gap fill-in reactions occurred in 10 μl of 50 mm Tris-HCl, pH 7.5, 10 mm KCl, 2.5 mm MgCl2, 1 mm dithiothreitol at 37 °C with all four dNTPs at 50 μm each. The complete fill-in of the M13 gapped substrate was monitored by gel (data not shown) and by the consistency of mutation rates after incubation with increased amounts of the DNA polymerase. To explore the protein sequence space of Pol I, we generated a random mutation library of the polA gene using error-prone PCR. Because we wanted to focus on mutations in the polymerase domain, nucleotides at positions 1493-2784 that encode the polymerase catalytic domain were randomly substituted, and the 3′-5′ exonuclease proofreading activity was inactivated by a D424A substitution (27Shinkai A. Patel P.H. Loeb L.A. J. Biol. Chem. 2001; 276: 18836-18842Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 37Derbyshire V. Freemont P.S. Sanderson M.R. Beese L. Friedman J.M. Joyce C.M. Steitz T.A. Science. 1988; 240: 199-201Crossref PubMed Scopus (298) Google Scholar). For simplicity, mutants henceforth will only be named by their polymerase domain genotype. For example, the D424A mutant is referred to as "wild type," whereas the double mutant D424A,I709N is referred to as only I709N. A library of greater than 1.0 × 104 mutants was established, with a mean amino acid substitution of 4.2 per gene (polymerase domain only). To select for active mutants, the library was transfected into JS200 E. coli cells, which contain a temperature-sensitive allele of Pol I; growth at the restrictive temperature requires complementation with a plasmid-borne active Pol I (27Shinkai A. Patel P.H. Loeb L.A. J. Biol. Chem. 2001; 276: 18836-18842Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 38Witkin E.M. Roegner M.V. J. Bacteriol. 1992; 174: 4166-4168Crossref PubMed Google Scholar). Approximately 10% of the original library formed colonies at the restrictive temperature. From the surviving population, 592 individual clones were sequenced to reveal a spectrum of tolerable substitutions across the polymerase domain (Fig. 1). A mean of 2.8 amino acid mutations were present in the active clones. Across the entire polymerase domain, the probability (30Guo H.H. Choe J. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9205-9210Crossref PubMed Scopus (221) Google Scholar) that a single random amino acid substitution will inactivate the enzyme is 34 ± 2% (mean ± S.E.). To compare the tolerance to substitutions at different amino acid positions, an index of substitutability was calculated based on the percentage of active clones that harbored a mutation at that residue (30Guo H.H. Choe J. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9205-9210Crossref PubMed Scopus (221) Google Scholar). These indices were consistent with the prediction that the active site of the polymerase, located in the interior-facing surfaces of the enzyme, harbors the most highly conserved residues, whereas residues located on the outer surfaces and lacking direct contact with the reaction substrates more readily tolerate substitutions (Fig. 2A and Table 1). To quantify how well these results match the amino acid conservation among Family A DNA polymerases, we compiled a protein sequence alignment of 30 Family A DNA polymerase species (17 prokaryotic, 10 eukaryotic, and 3 viral) and calculated indices for evolutionary conservation at each position (Fig. 2B). By comparing the substitutability of different amino acid residues in Pol I with the evolutionary conservation among Family A polymerases, we were able to identify regions of discrepancy between the functional and evolutionary conservation (Fig. 2B). Residues where the functional tolerance is at least 35% greater than the evolutionary conservation include 516, 656, 720, 723, 726, 738, 757, and 802.TABLE 1Mean substitutability indices of Pol I regionsSubstitutability inside region (mean ± S.E.)Substitutability outside region (mean ± S.E.)t test (p value)%%Entire protein0.68 ± 0.03Evolutionarily conserved (Motifs A, B, and C)0.31 ± 0.070.71 ± 0.052.4E-05Family A conserved (Motifs A, B, C, 1, 2, and 6)0.37 ± 0.040.76 ± 0.053.9E-08Helices0.74 ± 0.050.62 ± 0.030.16β strands0.61 ± 0.090.69 ± 0.030.46Hinges0.48 ± 0.100.70 ± 0.040.054 Open table in a new tab To assess the accuracy of the mutant polymerase enzymes, we screened 408 clones from our active library for their polymerase fidelity using a second plasmid pLA230 as a reporter (28Shinkai A. Loeb L.A. J. Biol. Chem. 2001; 276: 46759-46764Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). This reporter contains an opal (TAA) codon at the N terminus of the β-lactamase protein, which terminates its translation. Errors that are produced in this codon during the Pol I-catalyzed replication of pLA230 render the bacteria resistant to the antibiotic carbenicillin. The reversion frequency has been shown to be inversely related to the in vitro fidelity of the Pol I enzyme (28Shinkai A. Loeb L.A. J. Biol. Chem. 2001; 276: 46759-46764Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). The reversion frequency for cells expressing the wild-type Pol I was 8.9 ± 1.9 × 10-7 (mean ± S.E.). Clones with a reversion frequency at least 10-fold below or above wild-type were classified as antimutators and mutators, respectively (Fig. 3). The lowest and highest reversion frequency were ∼1/1000- and 1000-fold that of wild type. Approximately 12% (51Loh E. Loeb L.A. DNA Repair (Amst.). 2005; 4: 1390-1398Crossref PubMed Scopus (33) Google Scholar) of the clones were antimutators, whereas only 2.4% (10Trifunovic A. Wredenberg A. Falkenberg M. Spelbrink J.N. Rovio A.T. Bruder C.E. Bohlooly Y.M. Gidlof S. Oldfors A. Wibom R. Tornell J. Jacobs H.T. Larsson N.G. Nature. 2004; 429: 417-423Crossref PubMed Scopus (1957) Google Scholar) were mutators. To determine the catalytic activity of the same 408 clones, we measured their capacity to incorporate radiolabeled dTMP into activated calf thymus DNA in vitro (35Glick E. Anderson J.P. Loeb L.A. BioTechniques. 2002; 33: 1136-1144Crossref PubMed Scopus (10) Google Scholar). The activity of the polymerases varied greatly (Fig. 3), ranging from 15 to 125% of that of clones expressing similar amounts of wild-type enzyme as determined by Western blots. The only clones with activity greater than wild-type were mutators. Both mutators and antimutators were obtained without significant diminution in catalytic activity. To verify that the results of our reversion and polymerase activity assays were internally valid, we included three wild-type controls that had nucleotide substitutions that did not change the encoded amino acid sequence. In addition, two previously characterized extreme mutators, I709N and the double mutant I709N,A759R, were included (28Shinkai A. Loeb L.A. J. Biol. Chem. 2001; 276: 46759-46764Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 34Camps M. Naukkarinen J. Johnson B.P. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 9727-9732Crossref PubMed Scopus (115) Google Scholar). Their reversion frequencies are ∼200- and 1700-fold, respectively, above wild-type, consistent with prior studies. In order to confirm that the enhanced fidelity of DNA synthesis measured in vivo reflects a greater accuracy by the DNA polymerase, we purified the polymerase from a mutant, K601I,A726V, that exhibited a 10-fold enhanced accuracy without a significant reduction in activity. First, both the mutant and a wild-type control were cloned into the pLEX vector and expressed with a six-histidine N terminus tag. After chromatography on a nickel column, both the purified mutant polymerase and the wild-type control polymerase were tested for 3′-5′ exonuclease activity to ensure that the mutant did not exhibit any proofreading (Fig. 4). The polymerases were incubated with double-stranded DNA with a mismatched G:A (primer-template) at the 3′-primer terminus. Less than 0.001% of the terminal nucleotides were hydrolyzed in 30 min at 37 °C in a reaction containing a 4 nm concentration of the mutant or wild-type DNA polymerase and 2 nm DNA. 3′-5′ exonuclease activity was also absent when the polymerases were incubated with double-stranded DNA with a matched A:T at the 3′-primer terminus (data not shown). The fidelity of the mutant protein and of the wild type were then measured in vitro using an M13 gapped forward mutation assay (36Bebenek K. Kunkel T.A. Methods Enzymol. 1995; 262: 217-232Crossref PubMed Scopus (192) Google Scholar), in which the enzymes catalyze the incorporation of four dNTPs into gapped M13 circular DNA. The complete fill-in of the M13 gapped substrate was monitored by gel (data not shown) and by the consistency of mutation rates after incubation with increased amounts of the DNA polymerase. A 5-fold increase in the amount of enzyme used for fill-in did not alter the mutation frequency significantly. In two separate experiments, the frequency of mutations in the gapped segment of M13 DNA was 3.1- and 2.6-fold less in reactions catalyzed by K601I,A726V than in reactions catalyzed by the wild-type polymerase (Table 2). 68 and 82% of the mutations were single base substitutions with the wild-type and mutant polymerase, respectively. The largest reduction in error rate, 10-fold, occurred with A to C transversions (Table 3). The mutant exhibited reduced mutation rates for 10 of the possible 12 misinserted bases. Mutation rates for the remaining two, A to G transitions and C to A transversions, were increased less than 2-fold. Many of the error rates for the wild-type Klenow control were comparable with those that have been previously published (13Bebenek K. Joyce C.M. Fitzgerald M.P. Kunkel T.A. J. Biol. Chem. 1990; 265: 13878-13887Abstract Full Text PDF PubMed Google Scholar).TABLE 2Forward mutation rate of K601I,A726V mutant relative to wild typeDNA polymerasePlaques scoredMutant frequencyRelative mutation rateTotalMutantWild type13,326780.004611.0017,301900.004191.00K601I,A726V32,512890.001500.3226,722710.001640.39 Open table in a new tab TABLE 3Error spectrum of purified mutant K601I,A726V and wild-type Klenow DNA polymerasesChangeMispairWild type (Klenow 3′exo)K601I,A726V (Klenow 3′exo-)A → GA·dCTP1/230,0001/150,000A → CA·dGTP1/93,000≤1/980,000A → TA·dATP1/340,0001/890,000G → AG·dTTP1/340,0001/890,000G → CG·dGTP1/29,0001/53,000G → TG·dATP1/26,0001/100,000C → AC·dTTP≤1/420,0001/400,000C → GC·dCTP1/130,0001/360,000C → TC·dATP1/23,0001/46,000T → AT·dTTP1/250,000≤1/890,000T → GT·dCTP1/360,0001/530,000T → CT·dGTP1/53,0001/110,000 Open table in a new tab The mapping of mutations present in each antimutator and mutator revealed regions where mutations were more frequent. One region, encompassing residues 720-728 and cor
Referência(s)