Chromatin structure modulates DNA repair by photolyase invivo
1997; Springer Nature; Volume: 16; Issue: 8 Linguagem: Inglês
10.1093/emboj/16.8.2150
ISSN1460-2075
Autores Tópico(s)Photosynthetic Processes and Mechanisms
ResumoArticle15 April 1997free access Chromatin structure modulates DNA repair by photolyase in vivo Bernhard Suter Bernhard Suter Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Magdalena Livingstone-Zatchej Magdalena Livingstone-Zatchej Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Fritz Thoma Fritz Thoma Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Bernhard Suter Bernhard Suter Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Magdalena Livingstone-Zatchej Magdalena Livingstone-Zatchej Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Fritz Thoma Fritz Thoma Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland Search for more papers by this author Author Information Bernhard Suter1, Magdalena Livingstone-Zatchej1 and Fritz Thoma1 1Institut für Zellbiologie, ETH-Hönggerberg, CH-8093 Zürich, Switzerland The EMBO Journal (1997)16:2150-2160https://doi.org/10.1093/emboj/16.8.2150 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Yeast and many other organisms use nucleotide excision repair (NER) and photolyase in the presence of light (photoreactivation) to repair cyclobutane pyrimidine dimers (CPDs), a major class of DNA lesions generated by UV light. To study the role of photoreactivation at the chromatin level in vivo, we used yeast strains which contained minichromosomes (YRpTRURAP, YRpCS1) with well-characterized chromatin structures. The strains were either proficient (RAD1) or deficient (rad1Δ) in NER. In contrast to NER, photolyase rapidly repairs CPDs in non-nucleosomal regions, including promoters of active genes (URA3, HIS3, DED1) and in linker DNA between nucleosomes. CPDs in nucleosomes are much more resistant to photoreactivation. These results demonstrate a direct role of chromatin in modulation of a DNA repair process and an important role of photolyase in repair of damaged promoters with presumptive effects on gene regulation. In addition, photoreactivation provides an in vivo test for chromatin structure and stability. In active genes (URA3, HIS3), photolyase repairs the non-transcribed strand faster than the transcribed strand and can match fast removal of lesions from the transcribed strand by NER (transcription-coupled repair). Thus, the combination of both repair pathways ensures efficient repair of active genes. Introduction In eukaryotic cells, DNA is folded around histone octamers into nucleosomes, connected by linker DNA and further condensed into higher-order chromatin structures. Since packaging affects the accessibility of DNA to proteins, all DNA processing reactions including transcription and DNA repair must be intimately coupled to, and might even be regulated by, structural and dynamic properties of chromatin. Indeed, nucleosomes positioned in promoter regions play a significant role in the regulation of transcription. Factors binding to promoter elements can compete with nucleosome formation during replication and establish 'preset' open promoters, or factors may lead to a disruption of nucleosomes ('remodelling') and generate a nuclease-sensitive region (NSR; Becker, 1994; Wallrath et al., 1994). Furthermore, transcription elongation can lead to local dissociation and reassembly of histone octamers (e.g. genes transcribed by RNA polymerase II; Cavalli and Thoma, 1993; Cavalli et al., 1996) or to a complete disruption or loss of nucleosome structures (e.g. rDNA genes transcribed by RNA polymerase I; Conconi et al., 1989; Dammann et al., 1993). Cyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4 PD) are the two major classes of stable DNA lesions (pyrimidine dimers, PD) generated by UV light. Unless repaired, PDs may lead to blockage of transcription, mutations, cell death and cancer. Pyrimidine dimers are removed by two pathways: (i) nucleotide excision repair (NER); and (ii) photoreactivation. NER is a ubiquitous multistep pathway in which more than 30 proteins are involved to execute sequentially damage recognition, excision of an oligonucleotide with the pyrimidine dimer and gap repair synthesis (reviewed in Friedberg et al., 1995). The major components have been identified and the basic reaction has been reconstituted on naked DNA substrates (Aboussekhra et al., 1995). NER shares some proteins with the general transcription machinery which may link NER to transcription (transcription-coupled repair) and partially explains why the transcribed strand of an active gene is faster repaired than the non-transcribed strand or the genome overall (Friedberg, 1996; Sancar, 1996a). However, the relation between chromatin structure and NER is not resolved. We previously developed an assay to map CPDs along the DNA sequence and to compare it with the local chromatin structure determined by micrococcal nuclease (MNase) digestion and by indirect end-labelling (Smerdon and Thoma, 1990). This and a subsequent study (Bedoyan et al., 1992) were done in a yeast strain containing a minichromosome (YRpTRURAP) with a defined chromatin structure as a model substrate (Thoma, 1986). These studies (Smerdon and Thoma, 1990; Bedoyan et al., 1992) showed fast repair on the transcribed strand consistent with transcription-coupled repair, and slow repair in the non-transcribed strand. Repair was also efficient in a nuclease-sensitive promoter region of the URA3 gene, but slow in the nuclease-sensitive origin of replication (ARS1). Although those experiments indicated some modulation of NER by chromatin structure, they did not reveal clear differences between nuclease-sensitive regions and nucleosomes. As an alternative or additional pathway to NER, a wide variety of organisms, including bacteria, fungi, plants, invertebrates and many vertebrates, can revert CPDs by CPD-photolyase in the presence of photoreactivating blue light (of wavelength 350–450 nm) restoring the bases to their native form (Yasui et al., 1994; Sancar, 1996b). More recently, (6-4) photolyases have been identified in Drosophila (Todo et al., 1993, 1996), Xenopus laevis and rattlesnakes (Kim et al., 1996). A homologue gene was found in humans (Todo et al., 1996), suggesting that photolyases are widespread. CPD-photolyases recognize CPDs with a selectivity similar to that of sequence-specific DNA-binding proteins (Sancar et al., 1987), which suggests that they might compete with histones for DNA accessibility in a similar way as do transcription factors. The Escherichia coli enzyme and the yeast enzyme recognize the same substrates, but the yeast enzyme shows a reduced number of phosphate contacts which could be advantageous for binding DNA in nucleosomes (Baer and Sancar, 1989). Injection of enzymes from Anacystis and Saccharomyces into human cells showed that both enzymes could act to some extent in chromatin and that the eukaryotic enzyme was more efficient in the removal of CPDs (Zwetsloot et al., 1985). Although the enzymes and the reaction mechanism of photolyases have been characterized in detail (reviewed in Sancar, 1996b), a direct examination has not been made as to: (i) how CPDs are recognized by photolyase in chromatin; (ii) whether chromatin might affect photoreactivation; or (iii) how photolyase repairs transcriptionally active genes. In contrast to the complex NER pathway, in which damage recognition and repair is carried out by different proteins, photoreactivation depends on a single enzyme and the reaction can be strictly controlled by presence or absence of photoreactivating light. Hence, monitoring CPD repair by photoreactivation allows direct conclusions to be made about the accessibility of CPDs to photolyase in chromatin in vivo. Here, we use yeast strains containing minichromosomes with well-characterized chromatin structures as model substrates to study the effect of different chromatin structures on the repair of CPDs by photolyase. We show a strong modulation of photoreactivation by chromatin structure, an active role of photolyase in repair of open gene promoters, and preferential repair of the non-transcribed strands. The results further document that photolyase is a useful tool with which to monitor chromatin structure in a living cell. Results Saccharomyces cerevisiae strains FTY117 and JMY1 are deficient in NER (rad1Δ) and contain the minichromosomes YRpCS1 and YRpTRURAP respectively (Figure 1). The chromatin structures of both minichromosomes have been determined previously using micrococcal nuclease (MNase) (Thoma, 1986; Losa et al., 1990; Tanaka et al., 1996). The minichromosomes contain several NSRs separated by positioned nucleosomes. NSRs are considered to be nucleosome-free or to contain disrupted nucleosomes. The NSRs include promoter regions of the DED1 gene joined to the 3′ end of the HIS3 gene, the divergent promoters of the PET56 and HIS3 gene, and the promoter and the 3′ end of the URA3 gene. Many NSRs contain poly dT-tracts and polypyrimidine regions (● in Figure l). Poly dT-tracts are ubiquitous in yeast and serve as promoter elements to stimulate transcription (Struhl, 1985; Iyer and Struhl, 1995). Both minichromosomes contain an origin of replication (ARS1), which is structured as a NSR flanked by a nucleosome. Figure 1.Chromatin structures of the minichromosomes. (A) YRpCS1 of S.cerevisiae strain FTY117 and CSY1 contains the pet56-HIS3-ded1 sequence with the HIS3 gene and the truncated DED1 and PET56 genes inserted in the UNF region of the TRP1ARS1 circle. UNF denotes the TRP1ARS1 region from the ARS1 consensus element (solid oval) to the EcoRI site. Nucleosome positions and nucleosome-free regions are shown as described (Losa et al., 1990). The TRP1 gene in YRpCS1 shows overlapping nucleosome positions as in the TRP1ARS1 circle (Thoma et al., 1984). (B) YRpTRURAP of strain JMY1 contains the URA3 gene inserted in the TRP1ARS1 circle. Nucleosome positions and nucleosome-free regions are shown as described (Thoma, 1986; Smerdon and Thoma, 1990). ● denote some polypyrimidine regions and polydT-tracts which are hot spots of CPD formation and which are fast-repaired by photolyase (outside is top strand; inside is bottom strand). Nucleosome positions (circles), the promoter regions (5′), the 3′ ends of the genes (3′), the ARS1 origin of replication (ARS1) are indicated. R (EcoRI), X (XbaI) and V (EcoRV) are restriction sites. Map units in basepairs (bp) are indicated in 0.2 kb steps. Download figure Download PowerPoint Chromatin structure of irradiated cells Cells were irradiated in suspension with UV light (predominantly 254 nm) at a dose of 100 J/m2 to generate approximately one CPD per DNA strand. For chromatin analysis, YRpCS1 minichromosomes were partially purified from FTY117 cells, digested with MNase, and the cutting sites were displayed by indirect end-labelling and compared with those obtained in naked DNA (Figure 2). The pattern revealed positioned nucleosomes separated by linker DNA and nuclease-sensitive regions. The pattern was indistinguishable from that obtained from non-irradiated cells (Losa et al., 1990; Tanaka et al., 1994). Hence, irradiation produced no detectable effect on the chromatin structure of YRpCS1 (Figure 2). In contrast to standard procedures which map MNase cuts by non-denaturing gel electrophoresis (Thoma et al., 1984), Figure 2 shows a Southern blot of an alkaline gel hybridized with an RNA probe specific for the top strand and re-hybridized with a probe specific for the bottom strand. Both strands show an indistinguishable cutting pattern (compare Figure 2A and B), demonstrating that MNase preferentially generates double-strand cuts in linker DNA between nucleosomes and that single-strand nicking on the nucleosome surface is not detected. Figure 2.Chromatin structure and CPD repair by photolyase in minichromosome YRpCS1. (A) Top strand. (B) Bottom strand. The bottom strand is the transcribed strand of the TRP1 and HIS3 genes. FTY117 cells were UV-irradiated with 100 J/m2. Chromatin structure was analysed by micrococcal nuclease digestion (MNase) of DNA (lane 1) and chromatin (CHR, lanes 2 and 3) extracted from irradiated cells. Photoreactivation (+ Photoreact) was for 15 to 120 min (lanes 5–8). CPD distribution and repair was analysed by T4-endoV cleavage (+ T4-endoV, lanes 4–9). Lane 10 is irradiated DNA (same as lane 4) without T4-endoV cleavage. An aliquot of cells was kept in the dark for 120 min (lane 9). Cleavage sites for MNase and T4-endoV are shown by indirect end-labelling from the XbaI site (Figure 1). A schematic interpretation of chromatin structure is shown (left side). Chromatin regions of 140 to 200 bp that are protected against MNase cleavage represent positioned nucleosomes (rectangles), cutting sites between nucleosomes represent linker DNA, long regions with multiple cutting sites represent NSRs (ARS1; 5′PET-5′HIS3; 3′HIS3-5′DED; 5′TRP1). 5′ and 3′ ends of genes, direction of transcription (arrows) are indicated. ● and ▪ indicate fast repair in NSRs and linker DNA, respectively. * denote cross-hybridization with genomic DNA. Size markers (in bp, lane 11) are 261, 460, 690, 895, 1122, 1291, 1796, 2093, 2719 and 3347. (C) CPD repair in the top and bottom strand. The initial damage (0 min) was 1.2 ± 0.2 CPDs in the top and bottom strand. The average and standard deviation of four gels are shown. +UV, −UV, indicates damaged and non-damaged samples; +366, −366, photoreactivated and non-photoreactivated samples. Download figure Download PowerPoint CPD repair by photolyase Photoreactivation was done by exposure of the cell suspension to photoreactivating light for 15 to 120 min. A control sample was kept in the dark for 120 min. DNA was extracted, mock-treated or treated with T4-endonuclease V (T4-endoV) which cuts at CPDs (Gordon and Haseltine, 1980). The cutting sites were displayed by indirect end-labelling using alkaline gel electrophoresis (Smerdon and Thoma, 1990; Figures 2, 3, 4). Unirradiated DNA (not shown) and mock-treated DNA showed a background smear due to nicking of DNA during preparation (5T4-endoV lanes; Figures 2, 3, 4). In contrast, T4-endoV-treated DNA revealed numerous bands of different intensities (+ T4-endoV lanes; Figures 2, 3, 4). These bands can be assigned to dipyrimidines and polypyrimidine tracts in the DNA sequence. Many strong bands correspond to T-tracts in the promoter regions of the DED1-, HIS3-, PET56- and URA3- genes, demonstrating that these tracts are hot spots of CPD formation. For example, the strong bands in the promoter region of the DED1 gene (● in 5′ DED, Figure 2) represent CPDs in 5′-CTTTCCTTTTTTCTTTTT GCTTTTTCTTTTTTTTTCTCTT-3′ (top strand, Figure 2A) and in 3′-CTCTTTTTTTTATA TTTTCTCTACCTCCTTGCCCTTTTTC-5′ (bottom strand, Figure 2B). Similarly, the strong bands in the 5′ regions of the PET56 and HIS3 genes represent CPDs in 5′-TCCTTTCCCGCAATTTTCTTTTTC TATTACTCTTGGCCTCCTC TAGTACACTCTATATTTTTTT ATGCCTCGGTAATGATTTTCA TTTTTTTTTTTCCACCTAGCGGATGACTCTTTTTTTTTCTT-3′ (top strand, Figure 2A). In the promoter region of the URA3 gene, the strong bands (•, Figure 3A) reflect CPDs in 5′-CTTTTCAATTCATCATTTTTTTTTT ATTCTTTTTTTTGATTTCGGTTTCCTTGAAATTTTTTTG-3′ (top strand) and 3′-CTTTAAAAAAACTAAGCCATTAGAGGCTTGTC TTCCTTCTTGCTTCCTTCCTCGTGTCTGAATCTA-5′ (bottom strand). T-tracts are ubiquitous promoter elements of yeast genes (Struhl, 1985; Iyer and Struhl, 1995). Hence, UV light efficiently damages these promoter elements and thereby could affect gene expression. Figure 3.Chromatin structure and CPD repair by photolyase in minichromosome YRpTRURAP. UV irradiation of JMY1 cells, photoreactivation, and analysis of CPD distribution and repair was as described in Figure 2. Mapping was from the XbaI site: (A) clockwise using strand-specific probes generated from the XbaI–EcoRV fragment of TRP1; (B) counter-clockwise using strand-specific probes generated from the EcoRI–XbaI fragment of TRP1. Chromatin structure was determined by MNase digestion of non-irradiated cells (FTY23 containing YRpTRURAP) and cutting sites were mapped from the XbaI site using non-denaturing agarose gel electrophoresis. A schematic interpretation is shown as described in Figure 2. ● and ▪ indicate fast repair in NSRs and linker DNA, respectively. ▴ indicate slow repair in ARS1. * denote cross-hybridization with genomic DNA. Size markers (in bp) are 199, 429, 634, 861, 1030, 1535, 1832, 2017, 2432 [(A), lane 15], and 261, 460, 690, 895, 1122, 1291, 1796, 2093 [(B), lane 11]. (C) CPD repair in the top and bottom strand. The initial damage (0 min) was 1.0 ± 0.2 CPDs in the top strand and 1.2 ± 0.2 CPDs in the bottom strand. The average and standard deviation of eight gels are shown. Download figure Download PowerPoint Figure 4.Photoreactivation and NER in YRpCS1. UV irradiation of CSY1 cells, photoreactivation, and analysis of CPD distribution and repair was as described in Figure 2. Mapping was from the XbaI site for the top strand (A) and bottom strand (B). (C) CPD repair in the top and bottom strand. The initial damage (0 min) was 0.8 ± 0.2 CPDs in the top and bottom strand. The average and standard deviation of four gels are shown. Download figure Download PowerPoint Upon irradiation with photoreactivating light, >90% of CPDs were removed from both strands within 120 min. During incubation in the dark for 120 min (dark control), no repair was observed in YRpCS1 (Figure 2C). Hence, in the presence of photoreactivating light the CPDs were repaired by photolyase. (In YRpTRURAP, the dark control sample showed ∼20% less CPDs; Figure 3C. This could be due to a lower initial damage, since that particular sample was irradiated in a separate vessel, or alternatively due to incomplete protection against photoreactivating light.) Fast repair in nuclease-sensitive regions and linker DNA; slow repair in nucleosomes Inspection of the results at individual sites or clusters of CPDs very strikingly reveals two classes of repair: fast repair, when CPDs are removed within 15 to 30 min (● in Figures 2 and 3); and slow repair, when CPDs remain detectable for up to 60–120 min. A comparison of CPD repair with the chromatin analysis shows that fast repair correlates strictly with the accessibility of DNA to MNase (bands in chromatin lanes), and slow repair corresponds to inaccessibility to MNase (no bands in chromatin lanes). This is best observed in Figure 2, where chromatin analysis and CPD repair are displayed on the same gel. Hence, chromatin structure regulates the accessibility to CPDs as it regulates the accessibility to MNase. The locations of fast-repaired sites (●) correspond to NSRs in chromatin. This includes repair of CPDs in T-tracts of the promoter region of DED1 (5′ end) and 3′ end of HIS3 (Figure 2, both strands), the common promoter region of HIS3 and PET56 (5′ ends; Figure 2, top strand). Similarly, the promoter and 3′ end of the URA3 gene are rapidly repaired (Figure 3, both strands). This result strongly suggests a direct role of photolyase in repair of 'open' chromatin regions, in particular of active gene promoters. Sites that are slowly repaired strictly co-localize with regions which are resistant to MNase cleavage and represent positioned nucleosomes (open rectangles in schematic drawings, Figures 2 and 3). This is best observed in the five nucleosomes of the HIS3 gene, in the PET region (Figure 2) as well as in the URA3 gene (Figure 3, bottom strand). In the UNF region of the minichromosomes, one site on the top strand was fast repaired (▪ in Figures 2A and 3B), while a site nearby was slowly repaired. The fast-repair sites correspond to linker region between two positioned nucleosomes, while the slow-repair sites are located within a nucleosome. Similarly, a CPD site that is fast-repaired mapped in the linker between the second and third nucleosome of URA3 (▪ in Figure 3A, top strand). Hence, nucleosomes apparently restrict the accessibility of CPDs to photolyase, but they do not represent a complete block. Repair in the ARS1 region was more heterogeneous showing fast (●, Figures 2 and 3) and slowly repaired sites (▴). The slow site on the top strand includes the B1 and B2 elements of ARS1 and is located in the NSR. The site on the bottom strand includes the ARS1 consensus sequence (A element) located at the edge of a nucleosome (Thoma et al., 1984; Thoma, 1986; Losa et al., 1990). It is possible that photoreactivation in these sites is modulated by the protein complex at the origin of replication associated with these elements (Diffley and Cocker, 1992). Repair of nuclease-sensitive regions: a role of photolyase In wild-type yeast, both repair pathways, NER and photoreactivation, are active under daylight conditions. The results described above in NER-deficient strains suggest a role of photolyase in repair of open NSRs, including promoters of active genes. To address the role and contribution of photolyase in presence of NER, a photoreactivation experiment was performed with the CSY1 strain (Figure 4). CSY1 is wild-type for NER and photolyase and contains the minichromosome YRpCS1 (Figure 1A; Losa et al., 1990). Initially, repair in the CSY1 strain was much faster than in the NER-deficient strains FTY117 and JMY1 (Figure 4C). About 70–80% of CPDs were repaired after only 15 min from both the top and bottom strands and few CPDs remained after 30 min (Figure 4A and B, lanes 2, 4 and 6; also Figure 4C). For comparison, photolyase alone achieved 70–80% repair only after ∼1 h (Figures 2C and 3C). Dark repair alone removed only ∼62% and 73% of CPDs from the top and bottom strands, respectively, within 120 min (Figure 4A and B, lanes 8; also Figure 4C). Inspection of site-specific repair reveals that CPDs in the nuclease-sensitive promoter regions of the DED1 and HIS3/PET56 genes (●, Figure 4) are repaired within 15 min under photoreactivating conditions (lane 4) which is as fast as in the absence of NER (Figures 2 and 3). In contrast to photoreactivation, a large fraction of the CPDs persists in those NSRs during dark repair (NER) for 120 min (Figure 4A and B, lanes 8), although under those conditions already more than half of all the CPDs were removed from each strand. Hence, NER itself does not preferentially repair CPDs in NSRs, which is consistent with our previous observations in YRpTRURAP (Smerdon and Thoma, 1990). It is possible that some factors (transcription factors?) inhibit NER but not photoreactivation. In summary, these results clearly demonstrate that photolyase and not NER plays an important role in rapid repair of 'open' chromatin structures. Although photolyase and NER might compete for the same substrates, there is no obvious inhibition of photoreactivation by NER in the nuclease-sensitive regions. Photoreactivation in transcribed genes The bottom strand is the transcribed strand of the TRP1, HIS3 and DED1 sequences in YRpCS1, while the PET56 promoter induces transcripts from the top strand (Tanaka et al., 1994). The bottom strand is the transcribed strand for the major transcripts of URA3 and TRP1 sequences in YRpTRURAP, but some transcripts were also detected from the top strand outside of the URA3 region (Bedoyan et al., 1992). Several observations indicate that photoreactivation repairs the non-transcribed strand faster than the transcribed strand. First, photoreactivation in the absence of NER appeared to show a small enhancement of repair of the top strand of YRpCS1 (Figure 2C) or YRpTRURAP (Figure 3C). Second, dark repair in CSY1 removed ∼62% from the top strand (Top +UV/−366) and 73% of CPDs from the bottom strand (Bottom +UV/−366) of YRpCS1 (Figure 4C), which is consistent with preferential repair of the transcribed strand by NER (transcription-coupled repair). However, photoreactivation in presence of NER shows almost identical repair curves for both strands (Figure 4C), which indicates that fast repair of the non-transcribed strand by photolyase can match the fast repair of the transcribed strand by NER. Third, in the absence of NER, the top strand (non-transcribed) of the URA3 gene in YRpTRURAP appears to be faster repaired than the bottom strand (Figure 3A and B). The effect on the HIS3 gene in YRpCS1 is not obvious from visual inspection of the gels (Figure 2). We therefore quantified CPD removal over the transcribed regions of the URA3 and HIS3 genes (Figure 5). This includes the nucleosomal region (Figures 2 and 3), but excludes the nuclease-sensitive promoters and 3′ ends. In both genes of the NER-deficient strains FTY117 and JMY1, the non-transcribed strands were faster repaired by photolyase than the transcribed strands (Figure 5A and B). The effect was more pronounced in the URA3 gene. In CSY1, when NER and photolyase are active, both strands of the HIS3 gene showed similar repair curves (Figure 5C). The dark repair control showed the expected preferential repair of the transcribed strand by NER. Hence, fast repair of the non-transcribed strand by photolyase can match fast repair of the transcribed strand by NER. In other words, fast repair of the non-transcribed strand by photolyase is directly opposite to the preferential repair of the transcribed strand by NER. Figure 5.Strand-specific photoreactivation of the transcribed regions of the HIS3 and URA3 genes. (A) URA3 of YRpTRURAP in JMY1. (B) HIS3 of YRpCS1 in FTY117. (C) HIS3 of YRpCS1 in CSY1. The transcribed regions correspond to the nucleosomal regions (see Figures 2 and 3), but exclude the nuclease-sensitive and fast-repaired promoters and 3′ ends. +UV, −UV, indicates damaged and non-damaged samples; +366, −366, photoreactivated and non-photoreactivated samples. NTS, non-transcribed strand (top strand); TS, transcribed strand (bottom strand). The average and standard deviation of four gels are shown in (A), and of two gels in (B) and (C). Download figure Download PowerPoint Discussion CPD repair by photolyase is modulated by chromatin structure The strict correlation between photoreactivation and MNase accessibility provides substantial insight into a DNA repair process as well as into structural and dynamic properties of chromatin. We conclude that CPD repair by photolyase in the living cell is tightly modulated by chromatin structure, which apparently restricts the accessibility of DNA lesions to photolyase (illustrated schematically in Figure 6). Only CPDs that are located in linker DNA or in NSRs are rapidly repaired, while CPDs in nucleosomes are slowly repaired. In contrast to these photoreactivation results, previous results on NER in the same substrate (YRpTRURAP) (Smerdon and Thoma, 1990; Bedoyan et al., 1992), and in particular the results shown in Figure 4, do not reveal a preference of NER for CPD repair in nuclease-sensitive regions. Hence, the photoreactivation results are to our knowledge the first data that show a clear modulation of a DNA repair process by the local chromatin structure. Figure 6.CPD repair in chromatin by photolyase. (A) Photolyase preferentially recognizes CPDs in linker DNA and nuclease-sensitive regions, while DNA-binding proteins and nucleosomes limit the accessibility. Nucleosomes may occupy multiple positions (overlapping circles). Multiple positions are in a dynamic equilibrium (arrows). ▴ represent CPDs; grey circles represent nucleosomes; the Packman symbols represent photolyase. (B) Changing a nucleosome position by 5 bp turns the inner surface of DNA outside and alters the accessibility of DNA lesions. One turn of nucleosomal DNA is shown (adapted from Richmond et al., 1984). The grey circle represents the histone octamer. (C) Remodelling factors (●) may lead to a partial or complete disruption of nucleosome structure and enhance DNA damage recognition. Grey circles represent histones. (D) RNA polymerase II blocked at a CPD on the transcribed strand may prevent access to photolyase, explaining slow repair of the transcribed strand compared with the non-transcribed strand. (E) RNA polymerase II blocked at a CPD on the transcribed strand promotes assembly of the NER machinery, explaining preferential repair of the transcribed strand. Sharing of proteins between the transcription machinery and the NER (stippled polygon) is indicated (white triangle). Download figure Download PowerPoint Photoreactivation in nucleosomes Nucleosomes have an inhibitory effect on photoreactivation. The fact, however, that most CPDs in nucleosomes were repaired within 120 min, can be explained by structural and dynamic properties of nucleosomes. Changes in nucleosome positions, e.g. by sliding of histone octamers along the DNA sequence (Figure 6B) or transient unfolding or disruption (Figure 6C) could allow the inaccessible CPD lesions to become accessible to photolyase. Consistent with such a rearrangement of nucleosomes, it was found that nucleosome positions can be altered in vitro ('nucleosome mobility'; for references see Meersseman et al., 1992) and in vivo in yeast (Thoma, 1986) and that nucleosomes in various yeast sequences [TRP1, URA3 (Thoma et al., 1984; Thoma, 1986; Thoma and Zatchej, 1988), 5S rDNA (Buttinelli et al., 1993)] can occupy multiple positions. High-resolution mappings of the URA3 gene in the genome and in YRpTRURAP showed that the positions may vary by a few base pairs (illustrated in Figure 6A and B; Tanaka et al., 1996). It is presumed that those positions exist in an equilibrium. A shift of
Referência(s)