Mitochondrial Glycerol Phosphate Acyltransferase Contains Two Transmembrane Domains with the Active Site in the N-terminal Domain Facing the Cytosol
2001; Elsevier BV; Volume: 276; Issue: 46 Linguagem: Inglês
10.1074/jbc.m107885200
ISSN1083-351X
AutoresMaría R. González-Baró, Deborah A. Granger, Rosalind Coleman,
Tópico(s)Metabolomics and Mass Spectrometry Studies
ResumoThe topography of mitochondrial glycerol-3-phosphate acyltransferase (GPAT) was determined using rat liver mitochondria and mutagenized recombinant rat GPAT (828 aa (amino acids)) expressed in CHO cells. Hydrophobicity analysis of GPAT predicts two transmembrane domains (TMDs), residues 472–493 and 576–592. Residues 224–323 correspond to the active site of the enzyme, which is believed to lie on the cytosolic face of the outer mitochondrial membrane. Protease treatment of rat liver mitochondria revealed that GPAT has a membrane-protected segment of 14 kDa that could correspond to the mass of the two predicted TMDs plus a loop between aa 494 and 575. Recombinant GPAT constructs containing tagged epitopes were transiently expressed in Chinese hamster ovary cells and immunolocalized. Both the C and N termini epitope tags could be detected after selective permeabilization of only the plasma membrane, indicating that both termini face the cytosol. A 6–8-fold increase in GPAT-specific activity in the transfected cells confirmed correct protein folding and orientation. When the C terminus and loop-tagged GPAT construct was immunoassayed, the epitope at the C terminus could be detected when the plasma membrane was permeabilized, but loop-epitope accessibility required disruption of the outer mitochondrial membrane. Similar results were observed when GPAT was truncated before the second TMD, again consistent with an orientation in which the loop faces the mitochondrial intermembrane space. Although protease digestion of the HA-tagged loop resulted in preservation of a 14-kDa fragment, consistent with a membrane protected loop domain, neither the truncated nor loop-tagged enzymes conferred GPAT activity when overexpressed, suggesting that the loop plays a critical structural or regulatory role for GPAT function. Based on these data, we propose a GPAT topography model with two transmembrane domains in which both the N (aa 1–471) and C (aa 593–end) termini face the cytosol and a single loop (aa 494–575) faces the intermembrane space. The topography of mitochondrial glycerol-3-phosphate acyltransferase (GPAT) was determined using rat liver mitochondria and mutagenized recombinant rat GPAT (828 aa (amino acids)) expressed in CHO cells. Hydrophobicity analysis of GPAT predicts two transmembrane domains (TMDs), residues 472–493 and 576–592. Residues 224–323 correspond to the active site of the enzyme, which is believed to lie on the cytosolic face of the outer mitochondrial membrane. Protease treatment of rat liver mitochondria revealed that GPAT has a membrane-protected segment of 14 kDa that could correspond to the mass of the two predicted TMDs plus a loop between aa 494 and 575. Recombinant GPAT constructs containing tagged epitopes were transiently expressed in Chinese hamster ovary cells and immunolocalized. Both the C and N termini epitope tags could be detected after selective permeabilization of only the plasma membrane, indicating that both termini face the cytosol. A 6–8-fold increase in GPAT-specific activity in the transfected cells confirmed correct protein folding and orientation. When the C terminus and loop-tagged GPAT construct was immunoassayed, the epitope at the C terminus could be detected when the plasma membrane was permeabilized, but loop-epitope accessibility required disruption of the outer mitochondrial membrane. Similar results were observed when GPAT was truncated before the second TMD, again consistent with an orientation in which the loop faces the mitochondrial intermembrane space. Although protease digestion of the HA-tagged loop resulted in preservation of a 14-kDa fragment, consistent with a membrane protected loop domain, neither the truncated nor loop-tagged enzymes conferred GPAT activity when overexpressed, suggesting that the loop plays a critical structural or regulatory role for GPAT function. Based on these data, we propose a GPAT topography model with two transmembrane domains in which both the N (aa 1–471) and C (aa 593–end) termini face the cytosol and a single loop (aa 494–575) faces the intermembrane space. mitochondrial glycerol 3-phosphate acyltransferase hemagglutinin outer mitochondrial membrane transmembrane domain Chinese hamster ovary phosphate-buffered saline 1,4-piperazinediethanesulfonic acid amino acids green fluorescent protein 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid lysophosphatidic acid acyltransferase Glycerol phosphate acyltransferase (GPAT)1 (EC 2.3.1.15) catalyzes the first and committed step in de novo cellular glycerolipid synthesis, the formation of 1-acyl-sn-glycerol-3-phosphate (lysophosphatidic acid) from glycerol-3-phosphate and long chain fatty acyl-CoA substrates (1Bell R.M. Coleman R.A. Annu. Rev. Biochem. 1980; 49: 459-487Crossref PubMed Scopus (452) Google Scholar, 2Coleman R.A. Lewin T.M. Muoio D.M. Annu. Rev. Nutr. 2000; 20: 77-103Crossref PubMed Scopus (253) Google Scholar). Mammalian cells contain two GPAT isozymes that have different cellular locations, one in the endoplasmic reticulum and the other in mitochondria, that can be distinguished by sensitivity to inactivation by sulfhydryl reagents. The mitochondrial GPAT is an outer mitochondrial membrane (OMM) protein composing about 10% of the total enzymatic activity in most mammalian tissues. In liver, however, GPAT specific activity is similar in the two subcellular organelles. Only the mitochondrial GPAT isoform has been cloned. Recombinant mouse (3Yet S.-F. Lee S. Hahm Y.T. Sul H.S. Biochemistry. 1993; 32: 9486-9491Crossref PubMed Scopus (76) Google Scholar) and rat (4Bhat B.G. Wang P. Kim J.-H. Black T.M. Lewin T.M. Fiedorek T.F. Coleman R.A. Biochim. Biophys. Acta. 1999; 1439: 415-423Crossref PubMed Scopus (49) Google Scholar) GPAT open reading frames encode proteins of 827 and 828 amino acids, respectively, with a high degree of homology. Alignment of rat mitochondrial GPAT with other acyltransferases shows four homology blocks (5Lewin T.M. Wang P. Coleman R.A. Biochemistry. 1999; 38: 5764-5771Crossref PubMed Scopus (224) Google Scholar), and when conserved amino acids within these regions are mutated, GPAT activity is altered or abolished (5Lewin T.M. Wang P. Coleman R.A. Biochemistry. 1999; 38: 5764-5771Crossref PubMed Scopus (224) Google Scholar, 6Heath R.J. Rock C.O. J. Bacteriol. 1998; 180: 1425-1430Crossref PubMed Google Scholar, 7Dircks L.K. Ke J. Sul H.S. J. Biol. Chem. 1999; 274: 34728-34734Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 8Heath R.J. Rock C.O. J. Bacteriol. 1999; 181: 1944-1946Crossref PubMed Google Scholar). Kinetic studies using recombinant GPAT with site-directed mutations in this region identify specific amino acids that contribute to substrate binding or to catalysis. Thus, it was surprising that a recent report in this journal did not include information on these extensive studies but concluded that the active site region of GPAT lay in a domain on the side of the mitochondrial membrane opposite to the substrate binding and catalytic domains (9Balija B.S. Chakraborty T.R. Nikonov A.V. Morimoto T. Haldar D. J. Biol. Chem. 2000; 275: 31668-31673Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). Identification of the structure and orientation of membrane proteins is essential to elucidate enzyme interactions with substrates and products, especially when these are also hydrophobic. Furthermore, knowledge of the orientation of membrane domains is critical in determining their accessibility to regulatory signals. To clarify the orientation of mitochondrial GPAT and the topography of its active site in the OMM, we used native mitochondria and recombinant epitope-tagged proteins expressed in cultured CHO cells to probe the positions of the different domains. Rabbit polyclonal anti-GPAT antibody raised against the gel-purified protein expressed in bacteria was commercially produced by Immunodynamics, La Jolla, CA. Monoclonal antibodies against the epitopes used were from Sigma (anti-FLAG), Invitrogen (Carlsbad, CA, anti-Myc), and Covance (Princeton, NJ; anti-HA). Mitochondrial marker Mito-Tracker CMX-Ros was from Molecular Probes (Eugene, OR). Tissue culture and transfection media and reagents were from Life Technologies-Invitrogen (Princeton, NJ). Proteases and protease inhibitors were purchased from Sigma and Life Technologies. Female (150–200 g) Sprague-Dawley rats were housed on a 12-h/12-h light/dark cycle with free access to water and fed ad libitum with Purina rat chow. They were then fasted for 48 h and refed for 24 h with a high sucrose (69.5%), low fat (0.5%) diet (Dyets Inc.) to up-regulate mitochondrial GPAT expression (10Shin D.-H. Paulauskis J.D. Moustaid N. Sul H.S. J. Biol. Chem. 1991; 266: 23834-23839Abstract Full Text PDF PubMed Google Scholar). Animals were killed by CO2 narcosis. After dissection, livers were immediately placed on ice and homogenized in Buffer A (0.25m sucrose, 25 mm Tris-HCl, pH 7.4, 10 mm EDTA, 1 mm dithiothreitol). Mitochondria were isolated by differential centrifugation (11Fleischer S. McIntyre J.O. Vidal J.C. Methods Enzymol. 1979; 55: 32-39Crossref PubMed Scopus (73) Google Scholar), resuspended in Buffer A, and stored in aliquots at −80 °C. Protein concentrations were determined by the BCA method (Pierce) using bovine serum albumin as the standard. Mitochondria were analyzed for protease-protected fragments after preincubation with buffer (Control) or with 1% Triton X-100 to disrupt the OMM. The integrity of the OMM was determined by measuring the activity of the intermembrane space marker, adenylate kinase (12Schnaitman C. Greenawalt J.W. J. Cell Biol. 1968; 38: 158-175Crossref PubMed Scopus (1010) Google Scholar). To determine the accessibility of GPAT domains to protease, 350 μg of mitochondrial protein was then incubated in a final volume of 0.1 ml with selected proteases. For proteinase K, 20 μg of protease was added with 50 mm Tris-HCl, pH 7.4, 0.25 m sucrose, and 2 mm CaCl2 for 30 min on ice. The reaction was stopped by adding 1 mm AEBSF (4-(2-aminoethyl)benzenesulfonyl fluoride), 2 mmphenylmethylsulfonyl fluoride, 100 μm leupeptin, and 2 μg/ml aprotinin. After 5 min the samples were centrifuged at 11,000 × g for 5 min, and the pellet was used for immunodetection of GPAT fragments. For Glu-C endoproteinase (V8 protease), the mitochondria (350 μg of protein) were incubated with 0.062 V8 protease units in 50 mm ammonium acetate buffer, pH 4.0, for 90 min at 22 °C. The reaction was stopped by adding 0.1 mm 2,4-diisochlorocoumarin and incubating for 5 min on ice. For chymotrypsin, mitochondria (350 μg of protein) were incubated with 20 μg of the protease in 0.125 m sucrose, 0.5 mm CaCl2, and 25 mm Tris-HCl, pH 8, at 22 °C for 30 min. The reaction was stopped by adding 2 mm phenylmethylsulfonyl fluoride. For trypsin, mitochondria (200 μg) were incubated with 25 μg/ml protease in 0.125m sucrose and 10 mm Tris-HCl, pH 8, at 22 °C for 20 min. The reaction was stopped with the addition of 2 mg/ml soybean trypsin inhibitor. Four GPAT constructs were made (Fig. 3). The cDNA encoding the complete open reading frame of rat liver mitochondrial GPAT (4Bhat B.G. Wang P. Kim J.-H. Black T.M. Lewin T.M. Fiedorek T.F. Coleman R.A. Biochim. Biophys. Acta. 1999; 1439: 415-423Crossref PubMed Scopus (49) Google Scholar) was first subcloned in pcDNA3.1 (Invitrogen) digested withBamHI-XhoI (pcDNA3.1-GPAT). A FLAG epitope at the C terminus was added by a two-step polymerase chain reaction procedure in which the 30 nucleotides encoding the epitope, anXbaI restriction site, and a stop codon were added at the 3′ end of the open reading frame (13Igal, R. A., Wang, S., Gonzalez-Baro, M., and Coleman, R. A. (August 23, 2001) J. Biol. Chem.10.1074/jbc.M103386200.Google Scholar). The polymerase chain reaction product was then inserted in the BamHI-XbaI sites of the multicloning site of pcDNA3.1. This construct pcDNA3.1-GPAT-FLAG is referred to as GFLAG. To insert hemagglutinin (HA) epitopes, mutagenesis was performed using the Gene Editor system (Promega). For the mutagenic reactions, GPAT-FLAG (BamHI-XbaI) was subcloned into pGEM-11Zf(+) (Promega), and this construct, pGEM11Z-GPAT-FLAG, was used as a template. The HA epitope was inserted near the N terminus after amino acid 33 using a mutagenic primer (75 nucleotides) that contains the 27 nucleotides (in bold in the nucleotide sequence below) that encode the HA epitope (YPYDVPDYA) flanked with 22 GPAT cDNA complementary bases at the 5′ end and 26 bases at the 3′ end. The sequence of the mutagenic primer was: ATGTAAACACACGAATGAGGACTACCCATATGACGTCCCGGACTACGCCTGGGTTGACTGTGGCTTCAAACCTAC. Correct insertion of the epitope was corroborated by DNA sequencing and by restriction digestion with NdeI (the NdeI site is underlined in the mutagenic primer sequences). The mutated plasmid, pGEM11f(+)-GPAT-FLAG-HA33, was then digested with BamHI andXbaI and subcloned into the BamHI-XbaI sites of pcDNA3.1 to generate pcDNA3.1-GPAT-FLAG-HA33 (HA33). Insertion of the HA after amino acid 496 was performed similarly, using the mutagenic primer (74 nucleotides long) GCCTGCTCCTCTACAGACACTACCCATATGACGTCCCGGACTACGCCAGGCAGGGA- ATCCACCTCTCCACGCTG to obtain the construct pGEM11f(+)-GPAT-FLAG-HA496. After subcloning into pcDNA 3.1, the construct pcDNA3.1-GPAT-FLAG-HA496 (HA496) was obtained. To construct GPAT truncated after amino acid 576, pcDNA3.1-GPAT was used as a template for polymerase chain reaction. A 5′ primer contained the BamHI site and the first bases of the GPAT open reading frame, and a 3′ primer contained an XhoI site and 21 complementary bases to the GPAT codons that encode amino acids 570- 576. The polymerase chain reaction product was then subcloned in theBamHI-XhoI sites of the plasmid pcDNA3.1-Myc-His (Invitrogen). The construct pcDNA3.1-GPATtr576-Myc (Tr576Myc) was confirmed by DNA sequencing. CHO K1 cells were grown in minimum essential medium containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37 °C with 5% CO2. Cells were grown in 100-mm dishes to 70–80% confluence and then transfected with the constructs GFLAG, HA33, HA496, and Tr576Myc or with the empty vector pcDNA3.1. Cationic liposomes (LipofectAMINE, Life technologies) were used following the product instructions. After 27 h, the cells were harvested, homogenized in Buffer A, and centrifuged at 20,000 ×g for 20 min. The cellular particulate pellet was resuspended in buffer A, separated into aliquots, and stored at −80 °C. Protein was determined using bovine serum albumin as a standard (14Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Immunocytochemistry was performed as described (15Lin S. Cheng D. Liu M.S. Chen J. Chang T.Y. J. Biol. Chem. 1999; 274: 23276-23285Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). CHO K1 cells (106 cells) were seeded in sterile 100-mm tissue culture dishes, each containing 4–5 sterile glass coverslips, incubated at 37 °C until they reached 70% confluence, and then transfected with the epitope-tagged GPAT constructs. After 27 h, the cells were washed in PBS and incubated for 25 min with 0.1 μm Texas red mitochondrial marker in culture media. The cells were then rinsed with PBS and fixed in 4% paraformaldehyde for 10 min at 23 °C. After washing in PBS, cells were permeabilized with 5 μg/ml digitonin in buffer B (0.3 m sucrose, 25 mm MgCl2, 0.1 m KCl, 1 mm EDTA, 10 mm PIPES, pH 6.8) for 5 min on ice or with 1% Triton X-100 in PBS for 30 min at 23 °C. Cells were incubated in the following dilutions of the primary antibody: 1:1000 of anti-FLAG, 1:500 of anti-HA, and 1:500 of anti-Myc. After a 60-min incubation, cells were washed in PBS and incubated for 45 min in a 1:200 dilution of the fluorescein isothiocyanate-conjugated secondary antibody:goat anti-mouse IgG (Santa Cruz Biotechnology). Finally, cells were washed in PBS and the coverslips mounted. Cells were visualized with a Zeiss LSH 210 fluorescence microscope equipped with green and blue filters. The mitochondrial protease digestion products were separated on a 4–20% gradient (8% for the cellular particulate of CHO cells expressing recombinant GPAT) polyacrylamide gel containing 1% SDS and transferred to a polyvinylidene difluoride membrane (Bio-Rad). For chemiluminescent detection, immunoreactive bands were visualized by incubating the membrane with horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse IgG and PicoWest reagents (Pierce). GPAT was assayed in rat liver mitochondria (20–80 μg of protein) and in total particulate preparations from CHO cells expressing the recombinant GPAT constructs (40–80 μg of protein). The assay was performed at 23 °C with 300 μm[3H]glycerol 3-phosphate and 112.5 μmpalmitoyl-CoA in the presence or absence of 1 mm N-ethylmaleimide to inhibit the microsomal isoform (16Coleman R.A. Haynes E.B. J. Biol. Chem. 1983; 258: 450-465Abstract Full Text PDF PubMed Google Scholar). Microsomal GPAT was estimated by subtracting theN-ethylmaleimide-resistant activity (mitochondrial GPAT) from the total. All assays measured initial rates (5Lewin T.M. Wang P. Coleman R.A. Biochemistry. 1999; 38: 5764-5771Crossref PubMed Scopus (224) Google Scholar). [3H]Glycerol-3-phosphate was synthesized enzymatically (17Chang Y.-Y. Kennedy E.P. J. Lipid Res. 1967; 8: 447-455Abstract Full Text PDF PubMed Google Scholar). GPAT activity was also assayed with immobilized palmitoyl-CoA on agarose beads (180 μm) (Sigma) using rat liver mitochondria or CHO cell total particulate preparations under isosmotic conditions (intact) or hyposmotic conditions (10 mmTris-HCl, pH 7.4), which disrupted the OMM. Disruption of the OMM was monitored by loss of adenylate kinase activity. The GPAT amino acid sequence deduced from the cDNA complete open reading frame was examined using algorithms that predict the possible location of TMDs based on the hydrophobicity of the residues. Four different programs available on the Internet (TMPred (18Hofmann K. Stoffel W. Biol. Chem. Hoppe-Seyler. 1993; 374: 166Google Scholar), TMHMM (19Sonnhammer E.L.L. von Heijne G. Krogh A. Proc. Int. Conf. Intell. Syst. Mol. Biol. 1998; 6: 175-182PubMed Google Scholar), DAS (20Cserzo M. Wallin E. Simon I. von Heijne G. Elofsson A. Protein Eng. 1997; 10: 673-676Crossref PubMed Google Scholar), and SOSUI) strongly predicted the presence of two TMDs between amino acids 472–493 and 576–592 (Fig.1 A). These two TMDs were the only ones predicted by TMHMM and SOSUI. These programs also identify three non-membrane segments: an N-terminal region (aa 1–471), a loop region (aa 494–575), and a C-terminal region (aa 593–828). DAS and TMPred predict two additional TMDs between residues 184–203 and 235–254. These predicted TMDs have lower scores, and because the region aa 235–254 lies between two highly conserved regions that correspond to the active site of GPAT (5Lewin T.M. Wang P. Coleman R.A. Biochemistry. 1999; 38: 5764-5771Crossref PubMed Scopus (224) Google Scholar, 6Heath R.J. Rock C.O. J. Bacteriol. 1998; 180: 1425-1430Crossref PubMed Google Scholar, 8Heath R.J. Rock C.O. J. Bacteriol. 1999; 181: 1944-1946Crossref PubMed Google Scholar), this predicted TMD is highly improbable because it would cause portions of the active site to lie on opposite faces of the OMM. The TMD predicted for aa 184–203 is the only possible one between the N terminus and the active site domain. Specific experiments were carried out to determine the existence of this TMD and the two prime TMD predictions. When rat liver mitochondria were treated with different specific and nonspecific proteases and the reaction products were blotted with a polyclonal anti-full-length GPAT antibody, several immunoreactive bands were detected (Fig.2, A–C), suggesting that the OMM had acted as a barrier for the proteolysis. One of the bands (13.5/16 kDa) corresponds approximately to the size of the loop plus the two TMDs (calculated: 13.6 kDa). The higher molecular mass bands (23, 26, 28, and 31 kDa) might result from incomplete hydrolysis of protected sites within nearby membrane-associated regions. As previously reported (21Hesler C.B. Carroll M.A. Haldar D. J. Biol. Chem. 1985; 260: 7452-7456Abstract Full Text PDF PubMed Google Scholar), trypsin did not hydrolyze GPAT unless the OMM was disrupted (Fig. 2 D). To determine the orientation of GPAT, several constructs were designed to contain specific epitopes in the domains delimited by the two TMDs or truncations of GPAT proximal to the second TMD (Fig. 1 B). CHO K1 cells were transiently transfected with these constructs, and the expression of GPAT was monitored by Western blot both with the specific antibodies for the epitopes (anti-FLAG, anti-HA, and anti-Myc) and with assays for GPAT activity (Fig.3). Although the four proteins corresponding to the different constructs were expressed with the correct predicted molecular weights, only the GPAT transfectants with epitopes added at the C terminus (GFLAG) or near the N terminus (HA33) were active. Compared with vector-transfected control cells membranes, GFLAG and HA33 cells had 6–8-fold increases in mitochondrial GPAT specific activity. Cells transfected with GPAT constructs containing the HA epitope in the loop (HA496) or with the truncated construct (Tr576Myc), however, expressed GPAT activity similar to the vector-transfected control. This lack of activity was surprising because neither of the loop constructs was near the active site domain, and in both, the active site domain remained on the opposite, cytosolic side of the OMM (see below). Because previous studies indicated that the active site of GPAT faces the cytosol (21Hesler C.B. Carroll M.A. Haldar D. J. Biol. Chem. 1985; 260: 7452-7456Abstract Full Text PDF PubMed Google Scholar, 22Dircks L.K. Sul H.S. Biochim. Biophys. Acta. 1997; 1348: 17-26Crossref PubMed Scopus (59) Google Scholar, 23Chakraborty T.R. Vancura A. Balija V.S. Haldar D. J. Biol. Chem. 1999; 274: 29786-29790Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar), we tested GPAT activity in CHO cell total particulate preparations by using immobilized palmitoyl-CoA as a substrate to corroborate the correct insertion of the recombinant proteins (Table I). GPAT was able to access agarose-bound palmitoyl-CoA under isosmotic conditions when the OMM was intact, showing that the active site of the enzyme faces the cytosol and can interact with agarose beads that cannot cross the membrane. Furthermore, disruption of the OMM under hyposmotic conditions did not increase GPAT activity, indicating a lack of latency of GPAT activity. The integrity of the OMM under each condition was confirmed by assaying the activity of the intermembrane marker, adenylate kinase. Full adenylate kinase activity was present in the membranes treated with isosmotic buffer, whereas 75% of adenylate kinase activity was lost after incubation with the hyposmotic buffer. Similar results were obtained when we tested the GPAT activity in intact and hyposmotic-swelled rat liver mitochondria. GPAT specific activity in intact mitochondria (adenylate kinase 100% active) was 0.62 nmol/min/mg of protein and in OMM-disrupted mitochondria (adenylate kinase 22% active) was 0.58 nmol/min/mg of protein.Table IThe active site of GPAT faces the cytosolIsotonicHypotonicGPAT-FLAGGPAT activity0.280.26AK activity (%)10025GPAT-HA33GPAT activity0.300.30AK activity (%)10023N-Ethylmaleimide-resistant (mitochondrial) GPAT activity was measured with agarose-immobilized palmitoyl-CoA as a substrate in total particulate preparations from CHO cells expressing GPAT-FLAG and GPAT-HA33 after either disruption by hypotonic swelling or incubation under isotonic conditions. The degree of the OMM disruption was assessed by the percentage of adenylate kinase (AK) activity recovered under each condition. Control adenylate kinase activity was 8.1 μm ATP/min. GPAT activity is expressed as nmol/min/mg of protein. Open table in a new tab N-Ethylmaleimide-resistant (mitochondrial) GPAT activity was measured with agarose-immobilized palmitoyl-CoA as a substrate in total particulate preparations from CHO cells expressing GPAT-FLAG and GPAT-HA33 after either disruption by hypotonic swelling or incubation under isotonic conditions. The degree of the OMM disruption was assessed by the percentage of adenylate kinase (AK) activity recovered under each condition. Control adenylate kinase activity was 8.1 μm ATP/min. GPAT activity is expressed as nmol/min/mg of protein. In each of the epitope- tagged GPAT transfectants, the location of each epitope relative to the OMM was determined by probing with specific fluorescent antibodies after digitonin or Triton X-100 treatment. Digitonin permeabilizes only the plasma membrane, whereas Triton X-100 permeabilizes intracellular membranes, including the OMM (24Roitelman J. Olender E.H. Bar-Nun S. Dunn W.A. Simoni R.D. J. Cell Biol. 1992; 117: 959-973Crossref PubMed Scopus (149) Google Scholar, 25Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar). We confirmed this differential permeabilization by examining the susceptibility of adenylate kinase to protease digestion. When cells were incubated with 50 μg/ml proteinase K and then permeabilized with digitonin, adenylate kinase activity in both total cellular particulate and intact CHO cells was 100% of control activity, showing a lack of protease entry into the intermembrane space. In contrast, cells or total cellular particulate fractions permeabilized with 1% Triton X-100 lost 75% of the adenylate kinase activity, indicating disruption of the OMM that allowed proteinase K to have access to the enzyme. Fluorescent images for the FLAG, HA, and Myc epitope antibodies (green) or the mitochondrial marker (red) were analyzed either after the plasma membrane was permeabilized with digitonin or after the intracellular membranes were permeabilized with Triton X-100 (Fig.4). Specificity of the antibody signal was tested by probing control CHO cells transfected with the empty plasmid with both the primary antibody (anti-HA, anti-FLAG, or anti-Myc) and the fluorescein isothiocyanate-labeled secondary antibody. CHO cells expressing the epitope-tagged GPAT constructs were also probed with only the secondary antibody. In both cases, the fluorescent signal remained at background values (results not shown). The CHO cells expressing recombinant epitope-tagged GPAT exhibited an antibody-staining pattern within discrete structures in the cytoplasm, similar to the mitochondrial localization signal. The results show that the C terminus of GPAT faces the cytosol, because in the full-length GPAT construct tagged in the C terminus (GFLAG), this epitope was recognized in digitonin-treated cells when only the plasma membrane was permeabilized (Fig. 4). As expected, no change in staining was observed when these cells were permeabilized with Triton X-100. Similarly, the full-length GPAT containing an HA epitope near the N terminus (HA33) could be probed with anti-HA antibody after permeabilization with either digitonin or Triton X-100, showing that in this construct the N terminus is exposed to the cytosol. Both GFLAG and HA33 transfectants expressed high GPAT activity (8- and 6-fold more than control cells) (Fig. 3) and had their active sites exposed on the cytosolic surface, as evidenced by activity with agarose-linked palmitoyl-CoA substrate (Table I). These data indicate that the N and C termini and the active site of GPAT all face the cytosolic face of the OMM. Two constructs were made to test the presence of the putative loop between residues 472–493 and 576–592. CHO cells transfected with HA496 were identified with the HA antibody only after permeabilization with Triton X-100 but not after digitonin. This difference indicates that the HA epitope was not accessible to the antibody unless the OMM was disrupted. As was observed in GFLAG and HA33 transfectants, the C-terminal FLAG epitope present in the HA496 transfectants remained accessible to the FLAG antibody in digitonin-permeabilized cells, indicating that the C terminus of this construct was in its usual position on the cytoplasmic face of the OMM. The correct orientation of the GPAT-HA496 construct was further verified in total membrane fractions obtained from CHO cells that expressed HA496. When these membranes were exposed to proteinase K, anti-HA antibody detected a membrane-protected fragment whose molecular mass (∼14 kDa) matches the calculated molecular mass of the loop plus the two TMDs (Fig.5). This fragment did not react with the anti-FLAG antibody, consistent with protease degradation of the FLAG epitope and C terminus on the cytosolic face of the OMM. Adenylate kinase activity corroborated the integrity of the OMM. Similarly with the second loop construct, Tr576Myc, which is truncated just before the second TMD, cells became stained with the Myc antibody only after intracellular membranes had been disrupted with Triton X-100; the Myc epitope was not accessible to the antibody in cells permeabilized with digitonin, indicating that the shortened C terminus was located in the intermembrane space. Taken as a whole, these results indicate that GPAT C- and N-terminal domains are located in the cytosolic face of the OMM and that the loop lies in the intermembrane space. The mitochondrial isoform of GPAT is an intrinsic membrane protein (1Bell R.M. Coleman R.A. Annu. Rev. Biochem. 1980; 49: 459-487Crossref PubMed Scopus (452) Google Scholar) and requires detergents for isolation and purification (26Yet S.-F. Moon Y.K. Sul H.S. Biochemistry. 1995; 34: 7303-7310Crossref PubMed Scopus (52) Google Scholar, 27Nikonov A.V. Morimoto T. Haldar D. Pandalai S.G. Recent Research Developmen
Referência(s)