Portal de Periódicos da CAPES

Repression of glucocorticoid-stimulated angiopoietin-like 4 gene transcription by insulin

2014; Elsevier BV; Volume: 55; Issue: 5 Linguagem: Inglês

10.1194/jlr.m047860

1539-7262

Taiyi Kuo, Tzu-Chieh Chen, Stephanie Yan, Fritz Foo, Cecilia Ching, Amy McQueen, Jen-Chywan Wang,

FOXO transcription factor regulation

Angiopoietin-like 4 (Angptl4) is a glucocorticoid receptor (GR) primary target gene in hepatocytes and adipocytes. It encodes a secreted protein that inhibits extracellular LPL and promotes adipocyte lipolysis. In Angptl4 null mice, glucocorticoid-induced adipocyte lipolysis and hepatic steatosis are compromised. Markedly, insulin suppressed glucocorticoid-induced Angptl4 transcription. To unravel the mechanism, we utilized small molecules to inhibit insulin signaling components and found that phosphatidylinositol 3-kinase and Akt were vital for the suppression in H4IIE cells. A forkhead box transcription factor response element (FRE) was found near the 15 bp Angptl4 glucocorticoid response element (GRE). Mutating the Angptl4 FRE significantly reduced glucocorticoid-induced reporter gene expression in cells. Moreover, chromatin immunoprecipitation revealed that GR and FoxO1 were recruited to Angptl4 GRE and FRE in a glucocorticoid-dependent manner, and cotreatment with insulin abolished both recruitments. Furthermore, in 24 h fasted mice, significant occupancy of GR and FoxO1 at the Angptl4 GRE and FRE was found in the liver. In contrast, both occupancies were diminished after 24 h refeeding. Finally, overexpression of dominant negative FoxO1 mutant abolished glucocorticoid-induced Angptl4 expression, mimicking the insulin suppression. Overall, we demonstrate that both GR and FoxO1 are required for Angptl4 transcription activation, and that FoxO1 negatively mediates the suppressive effect of insulin. Angiopoietin-like 4 (Angptl4) is a glucocorticoid receptor (GR) primary target gene in hepatocytes and adipocytes. It encodes a secreted protein that inhibits extracellular LPL and promotes adipocyte lipolysis. In Angptl4 null mice, glucocorticoid-induced adipocyte lipolysis and hepatic steatosis are compromised. Markedly, insulin suppressed glucocorticoid-induced Angptl4 transcription. To unravel the mechanism, we utilized small molecules to inhibit insulin signaling components and found that phosphatidylinositol 3-kinase and Akt were vital for the suppression in H4IIE cells. A forkhead box transcription factor response element (FRE) was found near the 15 bp Angptl4 glucocorticoid response element (GRE). Mutating the Angptl4 FRE significantly reduced glucocorticoid-induced reporter gene expression in cells. Moreover, chromatin immunoprecipitation revealed that GR and FoxO1 were recruited to Angptl4 GRE and FRE in a glucocorticoid-dependent manner, and cotreatment with insulin abolished both recruitments. Furthermore, in 24 h fasted mice, significant occupancy of GR and FoxO1 at the Angptl4 GRE and FRE was found in the liver. In contrast, both occupancies were diminished after 24 h refeeding. Finally, overexpression of dominant negative FoxO1 mutant abolished glucocorticoid-induced Angptl4 expression, mimicking the insulin suppression. Overall, we demonstrate that both GR and FoxO1 are required for Angptl4 transcription activation, and that FoxO1 negatively mediates the suppressive effect of insulin. Angiopoietin-like 4 (Angptl4), also known as the fasting-induced adipose factor, or Fiaf, encodes a secreted protein that inhibits LPL activity (1Hato T. Tabata M. Oike Y. The role of angiopoietin-like proteins in angiogenesis and metabolism.Trends Cardiovasc. Med. 2008; 18: 6-14Crossref PubMed Scopus (268) Google Scholar, 2Kersten S. Regulation of lipid metabolism via angiopoietin-like proteins.Biochem. Soc. Trans. 2005; 33: 1059-1062Crossref PubMed Scopus (110) Google Scholar, 3Li C. Genetics and regulation of angiopoietin-like proteins 3 and 4.Curr. Opin. Lipidol. 2006; 17: 152-156Crossref PubMed Scopus (62) Google Scholar). LPL hydrolyzes TGs in lipoproteins, such as chylomicrons and VLDLs, into monoacylglycerol and FFAs, which can then be taken up into the cells. Angptl4 can also induce lipolysis in adipocytes (1Hato T. Tabata M. Oike Y. The role of angiopoietin-like proteins in angiogenesis and metabolism.Trends Cardiovasc. Med. 2008; 18: 6-14Crossref PubMed Scopus (268) Google Scholar, 2Kersten S. Regulation of lipid metabolism via angiopoietin-like proteins.Biochem. Soc. Trans. 2005; 33: 1059-1062Crossref PubMed Scopus (110) Google Scholar, 3Li C. Genetics and regulation of angiopoietin-like proteins 3 and 4.Curr. Opin. Lipidol. 2006; 17: 152-156Crossref PubMed Scopus (62) Google Scholar, 4Gray N.E. Lam L.N. Yang K. Zhou A.Y. Koliwad S. Wang J.C. Angiopoietin-like 4 (Angptl4) protein is a physiological mediator of intracellular lipolysis in murine adipocytes.J. Biol. Chem. 2012; 287: 8444-8456Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). For adipocytes, the net metabolic effect of Angptl4 is to mobilize lipids to plasma. The importance of Angptl4 in the regulation of lipid homeostasis is supported by a series of physiological studies (2Kersten S. Regulation of lipid metabolism via angiopoietin-like proteins.Biochem. Soc. Trans. 2005; 33: 1059-1062Crossref PubMed Scopus (110) Google Scholar, 5Yoshida K. Shimizugawa T. Ono M. Furukawa H. Angiopoietin-like protein 4 is a potent hyperlipidemia-inducing factor in mice and inhibitor of lipoprotein lipase.J. Lipid Res. 2002; 43: 1770-1772Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar). First, injecting ANGPTL4 recombinant proteins rapidly increases plasma TG and FFA levels (5Yoshida K. Shimizugawa T. Ono M. Furukawa H. Angiopoietin-like protein 4 is a potent hyperlipidemia-inducing factor in mice and inhibitor of lipoprotein lipase.J. Lipid Res. 2002; 43: 1770-1772Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar, 6Akiyama T.E. Lambert G. Nicol C.J. Matsusue K. Peters J.M. Brewer Jr, H.B. Gonzalez F.J. Peroxisome proliferator-activated receptor beta/delta regulates very low density lipoprotein production and catabolism in mice on a Western diet.J. Biol. Chem. 2004; 279: 20874-20881Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Mice overexpressing Angptl4 in muscle and adipose tissue have increased plasma TG levels (7Mandard S. Zandbergen F. van Straten E. Wahli W. Kuipers F. Muller M. Kersten S. The fasting-induced adipose factor/angiopoietin-like protein 4 is physically associated with lipoproteins and governs plasma lipid levels and adiposity.J. Biol. Chem. 2006; 281: 934-944Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar), and adenoviral-mediated overexpression of Angptl4 in liver causes hyperlipidemia and hepatic steatosis (8Xu A. Lam M.C. Chan K.W. Wang Y. Zhang J. Hoo R.L. Xu J.Y. Chen B. Chow W.S. Tso A.W. et al.Angiopoietin-like protein 4 decreases blood glucose and improves glucose tolerance but induces hyperlipidemia and hepatic steatosis in mice.Proc. Natl. Acad. Sci. USA. 2005; 102: 6086-6091Crossref PubMed Scopus (252) Google Scholar). Second, compared with WT mice, those lacking Angptl4 gene (Angptl4−/−) are hypolipidemic and have lower plasma FFA levels (9Bäckhed F. Ding H. Wang T. Hooper L.V. Koh G.Y. Nagy A. Semenkovich C.F. Gordon J.I. The gut microbiota as an environmental factor that regulates fat storage.Proc. Natl. Acad. Sci. USA. 2004; 101: 15718-15723Crossref PubMed Scopus (4338) Google Scholar, 10Köster A. Chao Y.B. Mosior M. Ford A. Gonzalez-DeWhitt P.A. Hale J.E. Li D. Qiu Y. Fraser C.C. Yang D.D. et al.Transgenic angiopoietin-like (angptl)4 overexpression and targeted disruption of angptl4 and angptl3: regulation of triglyceride metabolism.Endocrinology. 2005; 146: 4943-4950Crossref PubMed Scopus (349) Google Scholar). Furthermore, treating mice with Angptl4 antibody reduces plasma TG levels (11Desai U. Lee E.C. Chung K. Gao C. Gay J. Key B. Hansen G. Machajewski D. Platt K.A. Sands A.T. et al.Lipid-lowering effects of anti-angiopoietin-like 4 antibody recapitulate the lipid phenotype found in angiopoietin-like 4 knockout mice.Proc. Natl. Acad. Sci. USA. 2007; 104: 11766-11771Crossref PubMed Scopus (150) Google Scholar). When fed with high-fat diet, Angptl4−/− mice become obese faster than WT mice (12Bäckhed F. Manchester J.K. Semenkovich C.F. Gordon J.I. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice.Proc. Natl. Acad. Sci. USA. 2007; 104: 979-984Crossref PubMed Scopus (1926) Google Scholar). However, these mice eventually develop fibrinopurulent peritonitis, ascites, intestinal fibrosis, and cachexia (9Bäckhed F. Ding H. Wang T. Hooper L.V. Koh G.Y. Nagy A. Semenkovich C.F. Gordon J.I. The gut microbiota as an environmental factor that regulates fat storage.Proc. Natl. Acad. Sci. USA. 2004; 101: 15718-15723Crossref PubMed Scopus (4338) Google Scholar). Finally, genetic studies also support the critical role of Angptl4 in the regulation of lipid homeostasis. Population-based sequencing of human ANGPTL4 gene uncovered genetic variations that contribute to a reduced level of plasma TG (13Romeo S. Pennacchio L.A. Fu Y. Boerwinkle E. Tybjaerg-Hansen A. Hobbs H.H. Cohen J.C. Population-based resequencing of ANGPTL4 uncovers variations that reduce triglycerides and increase HDL.Nat. Genet. 2007; 39: 513-516Crossref PubMed Scopus (425) Google Scholar). Also, serum ANGPTL4 levels and white adipose tissue (WAT) ANGPTL4 expression are inversely correlated in monozygotic twins. The expression of Angptl4 gene is modulated by various signals. Thiazolidinedione, fibrate, and FFA induce Angptl4 transcription through members of the PPAR family, PPARγ, α, and β/δ, respectively (14Georgiadi A. Lichtenstein L. Degenhardt T. Boekschoten M.V. van Bilsen M. Desvergne B. Muller M. Kersten S. Induction of cardiac Angptl4 by dietary fatty acids is mediated by peroxisome proliferator-activated receptor beta/delta and protects against fatty acid-induced oxidative stress.Circ. Res. 2010; 106: 1712-1721Crossref PubMed Scopus (111) Google Scholar, 15Yoon J.C. Chickering T.W. Rosen E.D. Dussault B. Qin Y. Soukas A. Friedman J.M. Holmes W.E. Spiegelman B.M. Peroxisome proliferator-activated receptor gamma target gene encoding a novel angiopoietin-related protein associated with adipose differentiation.Mol. Cell. Biol. 2000; 20: 5343-5349Crossref PubMed Scopus (337) Google Scholar). Hypoxia and transforming growth factor β also activate Angptl4 transcription (16Le Jan S. Amy C. Cazes A. Monnot C. Lamande N. Favier J. Philippe J. Sibony M. Gasc J.M. Corvol P. et al.Angiopoietin-like 4 is a proangiogenic factor produced during ischemia and in conventional renal cell carcinoma.Am. J. Pathol. 2003; 162: 1521-1528Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar, 17Li H. Ge C. Zhao F. Yan M. Hu C. Jia D. Tian H. Zhu M. Chen T. Jiang G. et al.Hypoxia-inducible factor 1 alpha-activated angiopoietin-like protein 4 contributes to tumor metastasis via vascular cell adhesion molecule-1/integrin beta1 signaling in human hepatocellular carcinoma.Hepatology. 2011; 54: 910-919Crossref PubMed Scopus (132) Google Scholar, 18Padua D. Zhang X.H. Wang Q. Nadal C. Gerald W.L. Gomis R.R. Massague J. TGFbeta primes breast tumors for lung metastasis seeding through angiopoietin-like 4.Cell. 2008; 133: 66-77Abstract Full Text Full Text PDF PubMed Scopus (751) Google Scholar). Our group previously showed that glucocorticoids stimulate Angptl4 transcription in adipocytes and hepatocytes (19Koliwad S.K. Kuo T. Shipp L.E. Gray N.E. Backhed F. So A.Y. Farese Jr, R.V. Wang J.C. Angiopoietin-like 4 (ANGPTL4, fasting-induced adipose factor) is a direct glucocorticoid receptor target and participates in glucocorticoid-regulated triglyceride metabolism.J. Biol. Chem. 2009; 284: 25593-25601Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). A glucocorticoid response element (GRE) was identified in 3′ untranslated region of rat Angptl4 gene and is located between +6,267 and +6,241 [relative to transcription start site (TSS)] (19Koliwad S.K. Kuo T. Shipp L.E. Gray N.E. Backhed F. So A.Y. Farese Jr, R.V. Wang J.C. Angiopoietin-like 4 (ANGPTL4, fasting-induced adipose factor) is a direct glucocorticoid receptor target and participates in glucocorticoid-regulated triglyceride metabolism.J. Biol. Chem. 2009; 284: 25593-25601Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). The Angptl4 GRE sequence is conserved within rat, mouse, and human. Notably, Angptl4 expression is highly induced upon fasting, and glucocorticoid signaling is required for this fasting response (20Gray N.E. Lam L.N. Yang K. Zhou A.Y. Koliwad S. Wang J.C. Angiopoietin-like 4 (Angptl4) is a physiological mediator of intracellular lipolysis in murine adipocytes.J. Biol. Chem. 2012; 287: 8444-8456Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar). Physiological studies further confirmed that Angptl4 is involved in glucocorticoid-regulated lipid metabolism. Excess glucocorticoid-induced fatty liver and hyperlipidemia are protected in Angptl4−/− mice (19Koliwad S.K. Kuo T. Shipp L.E. Gray N.E. Backhed F. So A.Y. Farese Jr, R.V. Wang J.C. Angiopoietin-like 4 (ANGPTL4, fasting-induced adipose factor) is a direct glucocorticoid receptor target and participates in glucocorticoid-regulated triglyceride metabolism.J. Biol. Chem. 2009; 284: 25593-25601Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). Furthermore, glucocorticoid-induced lipolysis in WAT is reduced in Angptl4−/− mice (20Gray N.E. Lam L.N. Yang K. Zhou A.Y. Koliwad S. Wang J.C. Angiopoietin-like 4 (Angptl4) is a physiological mediator of intracellular lipolysis in murine adipocytes.J. Biol. Chem. 2012; 287: 8444-8456Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar). Previous studies have shown that serum ANGPTL4 levels and the expression of ANGPTL4 are inversely correlated with insulin sensitivity (21van Raalte D.H. Brands M. Serlie M.J. Mudde K. Stienstra R. Sauerwein H.P. Kersten S. Diamant M. Angiopoietin-like protein 4 is differentially regulated by glucocorticoids and insulin in vitro and in vivo in healthy humans.Exp. Clin. Endocrinol. Diabetes. 2012; 120: 598-603Crossref PubMed Scopus (32) Google Scholar, 22Soronen J. Laurila P.P. Naukkarinen J. Surakka I. Ripatti S. Jauhiainen M. Olkkonen V.M. Yki-Jarvinen H. Adipose tissue gene expression analysis reveals changes in inflammatory, mitochondrial respiratory and lipid metabolic pathways in obese insulin-resistant subjects.BMC Med. Genomics. 2012; 5: 9Crossref PubMed Scopus (61) Google Scholar, 23Mizutani N. Ozaki N. Seino Y. Fukami A. Sakamoto E. Fukuyama T. Sugimura Y. Nagasaki H. Arima H. Oiso Y. Reduction of insulin signaling upregulates angiopoietin-like protein 4 through elevated free fatty acids in diabetic mice.Exp. Clin. Endocrinol. Diabetes. 2012; 120: 139-144Crossref PubMed Scopus (22) Google Scholar). In 3T3-L1 adipocytes, insulin suppresses Angptl4 gene expression (24Yamada T. Ozaki N. Kato Y. Miura Y. Oiso Y. Insulin downregulates angiopoietin-like protein 4 mRNA in 3T3–L1 adipocytes.Biochem. Biophys. Res. Commun. 2006; 347: 1138-1144Crossref PubMed Scopus (51) Google Scholar, 25Dutton S. Trayhurn P. Regulation of angiopoietin-like protein 4/fasting-induced adipose factor (Angptl4/FIAF) expression in mouse white adipose tissue and 3T3–L1 adipocytes.Br. J. Nutr. 2008; 100: 18-26Crossref PubMed Scopus (48) Google Scholar). Notably, in adipocytes, glucocorticoids promote lipolysis, whereas insulin inhibits this process. Moreover, insulin resistance could lead to dyslipidemia and hepatic steatosis, which both can be a result of excess or prolonged glucocorticoid exposure. Based on these data, we propose that insulin suppresses glucocorticoid-induced Angptl4 transcription to antagonize glucocorticoid-modulated lipid metabolism. In this report, we investigated the effect of insulin on glucocorticoid-stimulated Angptl4 gene expression and unraveled the transcriptional mechanism underlying insulin-suppressed glucocorticoid-induced Angptl4 transcription. H4IIE rat hepatoma cells were cultured in DMEM (Mediatech) with 5% FBS (Tissue Culture Biologicals) and incubated at 37°C with 5% CO2. For all cell culture experiments, H4IIE cells were grown to 95% confluence, and treatments were diluted in DMEM only and applied to cultured cells. Rat primary hepatocytes were provided by the Cell Biology Core of University of California, San Francisco Liver Center. Treatments were applied as follows: 0.5 μM dexamethasone (Dex; Sigma D4902), 1 nM insulin (Sigma I9278), 10 μM phosphatidylinositol 3-kinase (PI3K) inhibitor GDC-09410 (Selleck S1064), 5 μM Akt inhibitor API-2 (Tocris 2151), 0.5 nM mammalian target of rapamycin (mTOR) inhibitor MK-8669 (also known as deforolimus, Selleck S1022), 200 nM S6 kinase (S6K) inhibitor rapamycin (Cayman 13346), and 5 μM glycogen synthase kinase (GSK) inhibitor SB-216763 (Tocris 1616). Male 8-week-old C57BL/6 mice were purchased from Charles River. The control group of mice was continuously fed, while the experimental group of mice was fasted for 24 h starting at 10 AM, or fasted and refed the next morning at 10 AM for 24 h. Then, the mice were euthanized, and their liver tissues were collected at the same time. The Office of Laboratory Animal Care at the University of California, Berkeley (#R306-0111) approved all animal experiments conducted. Total RNA from H4IIE cells was isolated using Nucleospin RNA II kit (Macherey-Nagel 740955), and total RNA from mouse liver was prepared with TRI Reagent® RT (Molecular Research Center Inc.). To synthesize randomly primed cDNA, 0.5 μg of total RNA, 4 μl of 2.5 mM 2'-deoxynucleoside 5'-triphosphate, and 2 μl of 15 μM random primers (New England Biolabs) were mixed at a volume of 16 μl and incubated at 70°C for 10 min. Then, a 4 μl cocktail containing 25 units of Moloney Murine Leukemia Virus Reverse Transcriptase (New England Biolabs), 10 units of RNasin (Promega) and 2 μl of 10× reaction buffer (New England Biolabs) was added and incubated at 42°C for 1 h and then 95°C for 5 min. The cDNA was diluted appropriately for real-time quantitative PCR (qPCR) using the EVA QPCR SuperMix Kit (Biochain) following the manufacturer's protocol. qPCR was performed in a StepOne PCR System (Applied Biosystems) and analyzed with the ΔΔ-Ct method, as supplied by the manufacturer. Rpl19 gene expression was used for internal normalization. Mouse primers used were mRpl19_cDNA_Fo: ATGGAGCACATCCACAAGC; mRpl19_cDNA_Re: TCCTTGGTCTTAGACCTGCG; mAngptl4_cDNA_Fo: AAGATGCACAGCATCACAGG; and mAngptl4_cDNA_Re: ATGGATGGGAAATTGGAGC. Rat primers used were rRPL19_cDNA_Fo: ACAAGCGGATTCTCATGGAG; rRPL19_cDNA_Re: TCCTTGGTCTTAGACCTGCG; rAngptl4_cDNA_Fo: AGACCCGAAGGATAGAGTCCC; and rAngptl4_cDNA_Re: CCTTCTGGAACAGTTGCTGG. Reporter plasmids harboring different GR binding regions (GBRs) were cotransfected with pcDNA3-hGR (150 ng) and pRL Renilla (100 ng) into H4IIE cells in 12-well plates. pGL4.10-E4TATA reporter plasmid was generated by insertion of a 50 bp minimal E4 TATA promoter sequence into the BglII to HindIII sites of vector pGL4.10 to drive luciferase expression. Different lengths of the Angptl4 GBR regions were then inserted into the upstream of KpnI and XhoI sites of E4 TATA sequences. The QuikChange Lightning mutagenesis kit (Stratagene) was used to make site-directed mutations per the manufacturer's instructions. Lipofectamine 2000 (Invitrogen) was used to transfect H4IIE cells according to the technical manual. Twenty-four hours posttransfection, cells were treated with control ethanol, 0.5 μM Dex, 1 nM insulin in DMEM only for 16–20 h. Cells were then harvested, and their luciferase activities were measured with the Dual-Luciferase Reporter Assay kit (Promega) according to the technical manual. Cloning primers used were Luc_rAngptl4_KpnI_+6529bp: gctgcaGGTACCgctcttgttacctgctatgt; Luc_rAngptl4_XhoI_+6030bp: cgctctCTCGAGtggagatgcagagggacca; Luc_rAngptl4_KpnI_+6376bp: gctgcaGGTACCggaagctgaaatcactggga; Luc_rAngptl4_XhoI_+6181bp: cgctctCTCGAGggttccaaggcacagctca; and Luc_rAngptl4_KpnI_+6244bp: gctgcaGGTACCcagagaacaaaatgttctgagg. Mutagenesis primers used were Luc_rAngptl4_mtFOX_sense: CAAAGTTGGAGTAAAGATGTTCCTCGGGTGGAG and Luc_rAngptl4_mtFOX_antisense: CTCCACCCGAGGAACATCTTTACTCCACACTTTG. Human expression vector for dominant negative Akt was described previously (26Failor K.L. Desyatnikov Y. Finger L.A. Firestone G.L. Glucocorticoid-induced degradation of glycogen synthase kinase-3 protein is triggered by serum- and glucocorticoid-induced protein kinase and Akt signaling and controls beta-catenin dynamics and tight junction formation in mammary epithelial tumor cells.Mol. Endocrinol. 2007; 21: 2403-2415Crossref PubMed Scopus (59) Google Scholar) and was provided by Dr. Gary Firestone (University of California Berkeley). H4IIE cells (1 × 108 to 2 × 108 cells) were treated with control ethanol, 0.5 µM Dex, 1 nM insulin, or a combination of Dex and insulin for 30 min, followed by cross-linking with formaldehyde at a final concentration of 1% at room temperature for 5 min. The reactions were quenched with 0.125 M glycine. The cells were then washed twice with 1× PBS and scraped and lysed in cell lysis buffer (50 mM HEPES-KOH at pH 7.4, 1 mM EDTA, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100), supplemented with protease inhibitor (PI) cocktails (Calbiochem). The cell lysate was incubated for 15 min at 4°C, and the crude nuclear extract was collected by centrifugation at 600 g for 5 min at 4°C. The nuclei were resuspended in 1 ml of ice-cold RIPA buffer (10 mM Tris-HCL at pH 8.0, 1 mM EDTA, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, supplemented with PI). The chromatin was fragmented on ice with Branson Sonifier 250 sonicator (4 min total, 20 s pulse at 30% power followed by 40 s pause). To remove insoluble components, the samples were centrifuged at 13,000 rpm for 15 min at 4°C, and the supernatant was collected. Fifty to 100 μl supernatant was aliquoted as input, and the rest of supernatant was divided equally for antibody addition. One and half micrograms of normal rabbit IgG antibody (sc-2027, Santa Cruz Biotechnology), 2.5 μg of rabbit polyclonal anti-GR antibody (IA-1), 4 μg of FoxO1 antibody (sc-11350×, Santa Cruz Biotechnology), 4 μg of FoxO3 antibody (07-702, Millipore), or 4 μg of hepatic nuclear factor-3β/FoxA2 antibody (sc-9187×, Santa Cruz Biotechnology) was added to the supernatant and nutated at 4°C overnight. Our GR antibody, IA-1, was raised in a rabbit against a synthetic peptide comprising residues 75–103 of human GR. The IA-1 antibody was purified from the serum by binding to human GR fragment 27–506 immobilized to agarose beads (Sterogene Actigel), then eluted at low pH. The eluted antibody was neutralized, concentrated to 1 µg/µl, and stored at −80°C. We found IA-1 to be at least as specific for GR by western and chromatin immunoprecipitation (ChIP) sequencing compared with the published N499 and H-300 (SC-8992, Santa Cruz Biotechnology). The next day, 100 μl of 50% protein A/G plus-agarose bead slurry (Santa Cruz Biotechnology) was added into each immunoprecipitated sample and nutated for 2 h at 4°C. These washes followed: twice with RIPA buffer, twice with RIPA buffer containing 500 mM NaCl, twice with LiCl buffer (20 mM Tris at pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% Tergitol-type NP-40 (NP-40, nonyl phenoxypolyethoxylethanol), 0.5% sodiumdeoxycholate), and one last time with RIPA buffer. After removing the remaining wash buffer, 75 μl of proteinase K solution (Tris-EDTA (TE) at pH 8.0, 0.7% SDS, 200 μg/ml proteinase K) was added to each immunoprecipitation reaction, followed by incubation at 55°C for 3 h and 65°C overnight to reverse formaldehyde cross-linking. ChIP DNA fragments were purified with QIAquick PCR purification kit (Qiagen), eluting in 60–120 μl of Qiagen Elution Buffer. ChIP DNA samples were then subjected to real-time qPCR analysis with the following primers: rAngptl4_ChIP_+6093bp_Fo: TTGACCGACTGGAGATAGGG and rAngptl4_ChIP_+6205bp_Re: ATGTTGTGAGCTGTGCCTTG. Liver tissues were harvested from control and experimental groups of C57BL/6 mice, minced with a razor blade, and collected in 1× SSC buffer (150 mM NaCl and 15 mM sodium citrate). Samples were then washed on a nutator, followed by centrifugation at 4,000 rpm for 3 min at 4°C to remove supernatant. The liver pellets were resuspended in PBS and cross-linked with 1% formaldehyde for 15 min at room temperature with gentle shaking, and the reaction was quenched with the addition of glycine. Centrifugation followed to remove supernatant, and the cell pellets were washed with ice-cold PBS plus PI with shaking. Once PBS was removed, the cells were resuspended in hypotonic buffer (10 mM HEPES at pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2% NP-40, 1 mM EDTA, 5% sucrose) with PI, 1.5 mM spermine, and 0.5 mM spermidine added right before use. Cells were homogenized using Polytron PT 2100 homogenizer for four pulses of 10 s each. Homogenized cells in hypotonic buffer are mounted onto cushion buffer (10 mM Tris-HCl at pH 7.5, 15 mM NaCl, 60 mM KCl, 1 mM EDTA, 10% sucrose, with PI, 1.5 mM spermine, and 0.5 mM spermidine added right before use) and centrifuged at 4,000 rpm at 4°C for 5 min, followed by the removal of supernatant. SDS-sonication buffer (50 mM Tris-HCl at pH 8.0, 2 mM EDTA, and 1% SDS added right before use) was applied to resuspend the nuclei pellet for sonication at 60% output for five times, 10 s each. To remove insoluble components, the samples were centrifuged at 13,000 rpm for 15 min at 4°C, and the supernatant was collected. Then, 3 vol of dilution buffer (20 mM Tris-HCl at pH 8.0, 2 mM EDTA, 200 mM NaCl, 1% Triton X-100, and 0.1% Na-deoxycholate) was added to the supernatant, and 100 μl of 50% protein A/G plus-agarose bead slurry with 5 μg of IgG antibody was added to each sample for preclearing at 4°C for 1 h with gentle shaking. Then, the sample was centrifuged at 4,000 rpm at 4°C for 3 min, 100 μl of the supernantant was saved for input, and the rest was divided accordingly for immunoprecipitation overnight. The next day, 60 μl of 50% protein A/G plus-agarose bead slurry was applied, and the samples were nutated for 2 h at 4°C. The following 500 μl washes were done, all supplemented with PI: once with TSE I (20 mM Tris-HCl at pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100, and 0.1% SDS); once with TSE II (20 mM Tris-HCl at pH 8.0, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, and 0.1% SDS); once with TSE III (10 mM Tris-HCl at pH 8.0, 1 mM EDTA, 0.25 M LiCl, 1% NP-40, and 1% Na-deoxycholate), and twice with TE (10 mM Tris-HCl at pH 8.0 and 1 mM EDTA) buffer. Centrifugation at 8,000 rpm at 4°C for 1 min was used to remove supernatant between washes. Freshly prepared 400 μl elution buffer (100 mM NaHCO3 and 1% SDS) was added to each sample, and elution buffer (up to 400 μl in total) was added for input. The samples were nutated for 1 h at room temperature. To reverse the cross-linking, after centrifugation, supernatant was transferred to new Eppendorf tubes, and a final concentration of 200 mM NaCl was added to each sample, followed by 65°C water bath incubation for >6 h. The next day, 8 μl of 0.5 M EDTA, 16 μl of 1 M Tris-HCL at pH 6.5, and 1.5 μl of 25 mM proteinase K were added to each sample, followed by 65°C water bath incubation for 1 h. To purify DNA, chloroform extraction was done for each sample, and real-time qPCR was carried out for data analysis. FoxO1Δ256 adenoviruses were provided from Dr. Mimmo Accili (Columbia University) (27Nakae J. Kitamura T. Silver D.L. Accili D. The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression.J. Clin. Invest. 2001; 108: 1359-1367Crossref PubMed Scopus (506) Google Scholar), which express human influenza hemagglutinin (HA) epitope tag-containing proteins. H4IIE cells were infected with adenoviruses for 48 h, followed by 5–6 h treatment of control ethanol, 0.5 μM Dex, or Dex plus 1 nM insulin. Antibody against HA tag (Roche 11583816001) was used to detect the overexpression level of FoxO1, and GAPDH (abcam ab9483) was included as internal control. Mouse primary hepatocytes were treated with 0.5 µM of Dex (a synthetic glucocorticoid), 1 nM insulin, a combination of insulin and Dex, or ethanol (vehicle control) for 5 h. At the end of the treatment, RNA was isolated from these cells, and reverse transcription was performed. Real-time PCR (qPCR) was then used to monitor the expression of Angptl4. We found that Angptl4 gene expression was ∼3.4-fold higher in Dex-treated cells than ethanol-treated cells (Fig. 1A). Although insulin treatment did not significantly decrease Angptl4 expression, insulin treatment abolished Dex-induced Angptl4 expression (Fig. 1A). We previously showed that Dex markedly augmented the expression of Angptl4 in rat H4IIE hepatoma cells. We thus examined whether insulin inhibited Angptl4 expression in H4IIE cells. H4IIE cells were treated with 0.5 µM of Dex, 1 nM insulin, a combination of insulin and Dex, or ethanol for 5 h. Gene expression of Angptl4 was then performed. Indeed, we found that Dex increased Angptl4 expression ∼18.9-fold (Fig. 1A). Insulin treatment abolished this induction (Fig. 1A), whereas insulin alone did not significantly affect Angptl4 expression. Overall, these results support that the H4IIE cell line is a viable cell culture model for studying the mechanism of insulin effect on Angptl4 expression. To learn how insulin inhibits Dex-induced Angptl4 expression, various small molecules that inhibit the activity of each signaling protein in the insulin signaling pathway were applied (Fig. 1B). In detail, GDC-0941 inhibits class I PI3K (28Folkes A.J. Ahmadi K. Alderton W.K. Alix S. Baker S.J. Box G. Chuckowree I.S. Clarke P.A. Depledge P. Eccles S.A. et al.The identification of 2-(1H-indazol-4-yl)-6-(4-methanesulfonyl-piperazin-1-ylmethyl)-4-morpholin-4-yl-t hieno[3,2-d]pyrimidine (GDC-0941) as a potent, selective, orally bioavailable inhibitor of class I PI3 kinase for the treatment of cancer.J. Med. Chem. 2008; 51: 5522-5532Cr