Produção Nacional
Revisado por pares
The Novel Cdc42 Guanine Nucleotide Exchange Factor, Zizimin1, Dimerizes via the Cdc42-binding CZH2 Domain
2004; Elsevier BV; Volume: 279; Issue: 36 Linguagem: Inglês
10.1074/jbc.m404535200
ISSN1083-351X
AutoresNahum Meller, Mohammad Irani-Tehrani, Boris I. Ratnikov, Bryce M. Paschal, Martin A. Schwartz,
Tópico(s)Wnt/β-catenin signaling in development and cancer
ResumoRho family small GTPases are critical regulators of multiple cellular processes and activities. Dbl homology domain-containing proteins are the classical guanine nucleotide exchange factors (GEFs) responsible for activation of Rho proteins. Recently another group of mammalian Rho-GEFs was discovered that includes CDM (Ced-5, DOCK180, Myoblast city) proteins that activate Rac and zizimin1 that activates Cdc42 via a nonconventional GEF module that we named the CZH2 domain. We report here that zizimin1 dimerizes via the CZH2 domain and that dimers are the only form detected. Dimerization was mapped to a ∼200-amino acid region that overlaps but is distinct from the Cdc42-binding sequences. Rotary shadowing electron microscopy revealed zizimin1 to be a symmetric, V-shaped molecule. Experiments with DOCK180 and homology analysis suggest that dimerization may be a general feature of CZH proteins. Deletion and mutation analysis indicated existence of individual Cdc42-binding sites in the zizimin1 monomers. Kinetic measurements demonstrated increased binding affinity of Cdc42 to zizimin1 at higher Cdc42 concentration, suggesting positive cooperativity. These features are likely to be critical for Cdc42 activation. Rho family small GTPases are critical regulators of multiple cellular processes and activities. Dbl homology domain-containing proteins are the classical guanine nucleotide exchange factors (GEFs) responsible for activation of Rho proteins. Recently another group of mammalian Rho-GEFs was discovered that includes CDM (Ced-5, DOCK180, Myoblast city) proteins that activate Rac and zizimin1 that activates Cdc42 via a nonconventional GEF module that we named the CZH2 domain. We report here that zizimin1 dimerizes via the CZH2 domain and that dimers are the only form detected. Dimerization was mapped to a ∼200-amino acid region that overlaps but is distinct from the Cdc42-binding sequences. Rotary shadowing electron microscopy revealed zizimin1 to be a symmetric, V-shaped molecule. Experiments with DOCK180 and homology analysis suggest that dimerization may be a general feature of CZH proteins. Deletion and mutation analysis indicated existence of individual Cdc42-binding sites in the zizimin1 monomers. Kinetic measurements demonstrated increased binding affinity of Cdc42 to zizimin1 at higher Cdc42 concentration, suggesting positive cooperativity. These features are likely to be critical for Cdc42 activation. The Rho family of low molecular weight GTPases includes 22 human genes, the best known members being RhoA, Rac1, and Cdc42 (1Wennerberg K. Der C.J. J. Cell Sci. 2004; 117: 1301-1312Crossref PubMed Scopus (469) Google Scholar). Rho proteins are important regulators of multiple cellular processes and activities. These include control of cell morphology, polarity, migration, adhesion to extracellular matrix proteins or other cells, proliferation, apoptosis, tumorigenesis, phagocytosis, vesicular transport, and gene transcription (2Aznar S. Fernandez-Valeron P. Espina C. Lacal J.C. Cancer Lett. 2004; 206: 181-191Crossref PubMed Scopus (105) Google Scholar, 3Etienne-Manneville S. Hall A. Nature. 2002; 420: 629-635Crossref PubMed Scopus (3788) Google Scholar, 4Erickson J.W. Cerione R.A. Biochemistry. 2004; 43: 837-842Crossref PubMed Scopus (115) Google Scholar). Cdc42 mediates cell polarity, gene expression, cell cycle progression, and cell-cell contacts (5Bishop A.L. Hall A. Biochem. J. 2000; 348: 241-255Crossref PubMed Scopus (1660) Google Scholar). The effects of Cdc42 are mediated by several effectors: actin polymerization and reorganization via activation of WASP and p65PAK proteins; microtubule reorganization via PAR-6, IQGAP1, and p65PAK; and vesicle trafficking via PAR-6 and potentially also the coatomer complex (6Etienne-Manneville S. J. Cell Sci. 2004; 117: 1291-1300Crossref PubMed Scopus (553) Google Scholar). It is not entirely clear how Rho proteins mediate such diverse and complex effects, but their selective targeting, activation, and inactivation probably play important roles.Like other GTPases, Rho proteins are active when bound to GTP and inactive when bound to GDP. Conversion of the GDP-bound proteins to the active state is catalyzed by guanine nucleotide exchange factors (GEFs). 1The abbreviations used are: GEF, guanine nucleotide exchange factor; ND, nucleotide-depleted; DH, Dbl homology; WCE, whole cell extract; EM, electron microscopy; EDC, 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide; HA, hemagglutinin; IP, immunoprecipitation; WT, wild type; GTPγS, guanosine 5′-3-O-(thio)triphosphate. 1The abbreviations used are: GEF, guanine nucleotide exchange factor; ND, nucleotide-depleted; DH, Dbl homology; WCE, whole cell extract; EM, electron microscopy; EDC, 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide; HA, hemagglutinin; IP, immunoprecipitation; WT, wild type; GTPγS, guanosine 5′-3-O-(thio)triphosphate. For nucleotide exchange, the GEF first binds with low affinity to the GDP-bound protein and induces dissociation of GDP from this complex, which leads to formation of a higher affinity intermediate. This intermediate is then dissociated by binding of GTP (7Cherfils J. Chardin P. Trends Biochem. Sci. 1999; 24: 306-311Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar). GEFs can therefore be distinguished from other GTPase-interacting proteins by their ability to bind preferentially to the nucleotide-depleted (ND) state compared with GTP- or GDP-bound states (8Hart M.J. Sharma S. elMasry N. Qiu R.G. McCabe P. Polakis P. Bollag G. J. Biol. Chem. 1996; 271: 25452-25458Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar). The classical GEFs for Rho GTPases share a common motif, designated the Dbl homology (DH) domain, that mediates nucleotide exchange (10Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (463) Google Scholar). In mammals, over 60 DH domain-containing proteins have been identified, illustrating the need for selective activation of Rho proteins by different signaling pathways and under diverse conditions (11Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (973) Google Scholar).Another family of mammalian Rho-GEFs was recently discovered that includes CDM (Ced-5, DOCK180, Myoblast city) proteins that activate Rac, and zizimin1 that activates Cdc42 (9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar, 12Wu Y.C. Horvitz H.R. Nature. 1998; 392: 501-504Crossref PubMed Scopus (138) Google Scholar, 13Cote J.F. Vuori K. J. Cell Sci. 2002; 115: 4901-4913Crossref PubMed Scopus (339) Google Scholar, 14Brugnera E. Haney L. Grimsley C. Lu M. Walk S.F. Tosello-Trampont A.C. Macara I.G. Madhani H. Fink G.R. Ravichandran K.S. Nat. Cell Biol. 2002; 4: 574-582Crossref PubMed Scopus (468) Google Scholar). This family includes 11 mammalian genes, which, based on sequence homology, can be divided into a subfamily related to CDM proteins and a subfamily related to zizimin1. The two groups share two conserved domains that we named CZH1 and CZH2 for CDM-zizimin homology 1 and 2, respectively (9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar). We propose here to name collectively the superfamily CZH proteins. The CZH2 domain, also called DOCKER or DHR2, is a GEF domain that shows no sequence homology to DH domains. The function of the CZH1 domain, also named DHR1, remains unknown (13Cote J.F. Vuori K. J. Cell Sci. 2002; 115: 4901-4913Crossref PubMed Scopus (339) Google Scholar, 14Brugnera E. Haney L. Grimsley C. Lu M. Walk S.F. Tosello-Trampont A.C. Macara I.G. Madhani H. Fink G.R. Ravichandran K.S. Nat. Cell Biol. 2002; 4: 574-582Crossref PubMed Scopus (468) Google Scholar).Genetic evidence in worms, flies, and mice demonstrated the necessity of CDM proteins for cell migration and engulfment of apoptotic bodies (12Wu Y.C. Horvitz H.R. Nature. 1998; 392: 501-504Crossref PubMed Scopus (138) Google Scholar, 15Erickson M.R. Galletta B.J. Abmayr S.M. J. Cell Biol. 1997; 138: 589-603Crossref PubMed Scopus (231) Google Scholar, 16Fukui Y. Hashimoto O. Sanui T. Oono T. Koga H. Abe M. Inayoshi A. Noda M. Oike M. Shirai T. Sasazuki T. Nature. 2001; 412: 826-831Crossref PubMed Scopus (362) Google Scholar, 17Nolan K.M. Barrett K. Lu Y. Hu K.Q. Vincent S. Settleman J. Genes Dev. 1998; 12: 3337-3342Crossref PubMed Scopus (179) Google Scholar). DOCK180 contributes to integrin-mediated Rac activation and cell spreading and neurite out-growth induced by nerve growth factor (18Katoh H. Negishi M. Nature. 2003; 424: 461-464Crossref PubMed Scopus (290) Google Scholar). Another member, DOCK4, has tumor suppressor activity via regulation of intercellular junctions (19Yajnik V. Paulding C. Sordella R. McClatchey A.I. Saito M. Wahrer D.C. Reynolds P. Bell D.W. Lake R. van den Heuvel S. Settleman J. Haber D.A. Cell. 2003; 112: 673-684Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). Green plants have a distinct Rho GTPase family termed ROPs but completely lack DH proteins (20Valster A.H. Hepler P.K. Chernoff J. Trends Cell Biol. 2000; 10: 141-146Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Interestingly a zizimin homolog, named SPIKE1, was identified in Arabidopsis, and it is now known to interact with multiple ROPs (21Qiu J.L. Jilk R. Marks M.D. Szymanski D.B. Plant Cell. 2002; 14: 101-118Crossref PubMed Scopus (163) Google Scholar). 2D. Szymanski, personal communication. 2D. Szymanski, personal communication.We report here that zizimin1 forms V-shaped dimers via a 200-amino acid region within the CZH2 domain. Individual Cdc42-binding sites most likely exist in each subunit. Analysis of binding affinity suggests positive cooperativity. These data provide the first insights into the biochemical properties of CZH family exchange factors.MATERIALS AND METHODSCell Culture and TransfectionsCOS7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum penicillin and streptomycin, all from Invitrogen. 24 h before transfection, the cells were subcultured so as to reach 50–70% confluency the next day for transfection. Unless indicated otherwise, the cells were transfected in 100-mm tissue culture dishes with 1.3 g of total DNA using Effectene (Qiagen) according to the manufacturer's instructions. For electron microscopy and BIAcore experiments, 6 × 106 cells were electroporated with 20 μg of total DNA in 0.4-ml cuvettes at 250 volts and 950 microfarads. The cells were collected 48 h post-transfection.Zizimin1 PurificationTransfected cells were collected by trypsinization, washed twice in cold phosphate-buffered saline, and lysed 10 min on ice in 50 mm Tris, pH 7.5, 150 mm NaCl, 1% Triton X-100, and 1% protein inhibitors mixture (final concentrations, 1 mm 4-(2-aminoethyl)benzenesulfonyl fluoride, 15 μm pepstatin A, 14 μm E-64, 40 μm bestatin, 20 μm leupeptin, and 0.8 μm aprotinin; Sigma P8340). The lysates were cleared by 10 min of centrifugation at 16,000 × g. A portion of this whole cell extract (WCE) was reserved, and the rest was incubated with M2 anti-FLAG affinity beads (Sigma F2426) for 3 h, on a rocker at 4 °C. For coimmunoprecipitation experiments, the beads were washed three times in lysis buffer at 4 °C, 10 min/wash and eluted in 2× SDS-PAGE loading buffer (0.125 m Tris, pH 6.8, 4% SDS, 20% glycerol 10% β-mercaptoethanol). In the experiment presented in Fig. 1C, cell lysis and immunoprecipitation were done in RIPA buffer (50 mm Tris, pH 7.5, 500 mm NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and 1% protease inhibitor mixture).When purifying zizimin1 for electron microscopy (EM), the immunoprecipitates were washed three times in lysis buffer for 30 min each time and once in 50 mm Tris, pH 7.5, 500 mm ammonium acetate for 30 min. Zizimin1 was eluted for 30 min at 4 °C in 50 mm Tris, pH 7.5, 500 mm ammonium acetate, and 0.2 mg/ml 3× FLAG peptide (Sigma F4799). When purifying zizimin1 for surface plasmon resonance experiments, the immunoprecipitates were washed three times in lysis buffer for 30 min each time and once for 30 min in 50 mm Tris, pH 7.5, 500 mm NaCl, 1%Triton X-100. Zizimin1 was eluted 30 min at 4 °C in 50 mm Tris, pH 7.5, 500 mm NaCl, 1% Triton X-100, and 0.3 mg/ml FLAG peptide (Sigma #F3290). Some of the material was analyzed by SDS-PAGE, and the rest was supplemented with 0.5 mg/ml bovine serum albumin and dialyzed into phosphate-buffered saline.Chemical Cross-linkingCells were collected by trypsinization, washed twice in phosphate-buffered saline, and lysed in 20 mm HEPES, pH 7.5, 150 mm NaCl, 1% Triton X-100, 1% protease inhibitor mixture. After 10 min of incubation on ice, the lysates were clarified by 16,000 × g centrifugation for 10 min. 5 mm 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide (EDC) dissolved in water was added for 30 min at room temperature. Control samples received equal volumes of water. The reaction was stopped by addition of 5× SDS loading buffer (0.3125 m Tris, pH 6.8, 10% SDS, 50% glycerol, and 25% β-mercaptoethanol).Determination of Zizimin1 Molecular WeightSedimentation—COS7 cells, untransfected or transiently transfected with HA-tagged zizimin1, were harvested by trypsinization and washed twice in phosphate-buffered saline. The cells were lysed 10 min on ice in 20 mm Tris, pH 7.5, 150 mm NaCl, 0.1% Triton X-100, and 1% protein inhibitors mixture. The lysates were centrifuged for 30 min at 100,000 × g, and the supernatants were collected. 500-μl aliquots of lysates or protein standards were loaded onto 11.2 ml of 5–20% sucrose gradients in lysis buffer. After 16 h of centrifugation at 270,000 × g, fractions of ∼600 μl (this value varied slightly between experiments) were collected starting at the bottom. The fractions were separated by SDS-PAGE. The protein standards gels were stained with Coomassie, and the cell lysates were analyzed by Western blotting with anti-HA or anti-zizimin1. The protein standards used are in Fig. 3B.Fig. 3Zizimin1 is a dimer.A, lysates of COS7 cells were fractionated on a 5–20% sucrose gradient (top panel) or on a Superose-6 gel filtration column (bottom panel). The fractions were analyzed by SDS-PAGE and Western blotting using anti-zizimin1 antibody. Protein standards were fractionated in parallel, and the fractions were analyzed by SDS-PAGE and Coomassie staining (not shown). Peak fractions of the protein standards are indicated by arrows. An arrow between fractions indicates that the peak spanned the two fractions. The remaining fractions, not displayed, were negative for zizimin1. B, lysates of COS7 cells expressing HA-tagged zizimin1 were analyzed as in A and probed with anti-HA antibody. Note that for sucrose gradients the fractions size and numbers vary between experiments. Additional fractions that are not displayed were negative for zizimin1. C, summary of zizimin1 sedimentation coefficient, Stokes radius, and molecular weight values obtained from sedimentation and gel filtration experiments.View Large Image Figure ViewerDownload (PPT)Gel Filtration—Zizimin1 expression, cell lysis, and Western blotting were done as for the sedimentation experiments. Lysates were spun 10 min at 16,000 × g, and supernatants were resolved on a Superose 6 10/30 column (Amersham Biosciences) using lysis buffer as running buffer. Fifty 0.5-ml fractions were collected. The standards were detected by absorption at A280; standards used were thyroglobulin, bovine IgG, ovalbumin, myoglobin, and vitamin B12 with molecular masses of 670, 158, 44, 17, and 1.35 kDa, respectively.Molecular Mass Calculation—The method was adopted from UCSF web sites itsa.ucsf.edu/∼hdeacon/calculate.html and itsa.ucsf.edu/∼hdeacon/Stokesradius.html. To calculate molecular mass from sedimentation and gel filtration data, we used the relationship M = αaS where M is the molecular mass, a is the Stokes radius in cm, S is the sedimentation coefficient, and α = 6πηoN/(1 – νρ), where ηo is the viscosity of the solvent (which is 1.002 × 10–2 for water), ν is the specific density (0.725 for protein), ρ is the density of solvent (0.998 for water), and n is Avogadro's number.Electron MicroscopyFLAG-zizimin1 was purified as described above. Protein at 100 μg/ml was diluted into glycerol so that the final concentration was 12.5 mm Tris, pH 7.5, 125 mm ammonium acetate, 0.05 mg/ml 3× FLAG peptide, and 50% glycerol. 200-μl aliquots were sprayed on to freshly cleaved mica sheets. The sheets were rotary shadowed with platinum at a 9° angle and stabilized with carbon at a 90° angle. The replicas were floated off of the mica in distilled water and collected on 200-mesh copper grids for examination using a JEOL 100CX transmission electron microscope.Cdc42 Pull-down AssaysThe cell lysates were prepared as for the immunoprecipitation experiments (see above). Glutathione S-transferase-Cdc42 pull-down was done as described (9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar).Binding of Purified Zizimin1 Dimers to Cdc42FLAG-tagged zizimin1 constructs were immunoprecipitated as described above followed by 30 min of elution at 4 °C in 50 mm Tris, pH 7.5, 500 mm NaCl, 1% Triton X-100, 0.5 mg/ml bovine serum albumin, and 0.2 mg/ml 3× FLAG peptide. The eluate was diluted and supplemented to bring the final concentration to 50 mm Tris, pH 7.5, 150 mm NaCl, 1% Triton X-100, 0.5 mg/ml bovine serum albumin, and 0.06 mg/ml 3× FLAG peptide. Each eluate was divided; 4% was saved as total sample, 27% was used for anti-HA IP, and 68% was pulled down with ND-Cdc42.Surface Plasmon ResonanceAnti-mouse IgG1 was covalently immobilized on CM5 chips, then anti-FLAG monoclonal antibody (Sigma F3165) was allowed to bind to the chips followed by binding of FLAG zizimin1, purified as described above. Bacterially expressed His6-Cdc42 was purified using TALON metal affinity resin (BD Biosciences Clontech; Palo Alto, CA) and used as an analyte. Binding kinetics were measured using a BIAcore 3000 at 25 °C at a flow rate of 50 μl/min. Association was followed for 2 min, and dissociation was measured for 10 min. The running buffer was 10 mm HEPES, 7.4, 150 mm NaCl, 0.05% P20, 3 mm EDTA. To regenerate the chip, Cdc42 was dissociated from zizimin1 using 35 μl of running buffer containing 10 μm GTP, 3 mm MgCl2, and no EDTA. The data were analyzed with the 1:1 model using the BIAevaluation 3.1 software.DNA ConstructsHA-tagged zizimin1 constructs were cloned in the pEF4-Myc-His-C vector (Invitrogen) as described (9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar).FLAG-tagged Zizimin1 Fragments—A linker coding for FLAG followed by glycine (DYKDDDDKG) and a KpnI site was constructed using the oligonucleotides 5′-GCCACCATGGATTACAAGGATGACGATGACAAGGGTGGTACC-3′ and 5′-GATCGGTACCACCCTTGTCATCGTCATCCTTGTAATCCATGGTGGCGTAC-3′. It was cloned into pEF-4-Myc-His-C using the KpnI and BamHI sites to generate pEF-FLAGKPN. Zizimin1 fragments were amplified by PCR and cloned in pEF-FLAG-Kpn using the KpnI and NotI sites.FLAG Full-length Zizimin1—A sequence coding for FLAG followed by two glycines (GCCACCATGGATTACAAGGATGACGATGACAAG GGTGGT) was added to zizimin1 before its first codon using PCR, and the FLAG-zizimin1 insert was cloned into pEF4-Myc-His-C using the KpnI and NotI sites.Zizimin11865–6 AA—Zizimin1 amino acids 1865–1866 were mutated from YI to AA using the site-directed mutagenesis kit QuikChange XL (Stratagene, La Jolla, CA) and the primers 5′-GATCTGGATTCTAAGTATGCCGCGGCCCAGGTGACTCACGTCATC-3′ and 5′-GATGACGTGAGTCACCTGGGCCGCGGCATACTTAGAATCCAGATC-3′. This mutation creates a SacII site. A fragment containing the mutation was subcloned into the pEF-FLAG-zizimin1 and pEF-HA-zizimin1 vectors and sequenced.His6-Cdc42—The cDNA coding for human wild type Cdc42 was amplified by PCR using the primers 5′-TCTGGATCCGGGAGGAGGACAGACAATTAAGTGTGTTGTTGG-3′ and 5′-AAAGAATTCTCATAGCAGCACACACCTGC-3′. The insert was cloned into pRSET-B (Invitrogen) using the BamHI and EcoRI sites. All of the constructs were confirmed by sequencing.FLAG- and HA-tagged DOCK180 were from Dr. Kodi Ravichandran (The Beirne Carter Center for Immunology Research and the Department of Microbiology and Pharmacology, University of Virginia, Charlottesville, VA).AntibodiesAnti-zizimin1 antibody was raised in rabbits immunized with a peptide bearing the first 12 amino acids using standard procedures. The resultant sera were affinity purified on columns conjugated to the same peptide. Anti-HA monoclonal antibody was from Covance (Princeton, NJ; MMS-101P).RESULTSZizimin1 Oligomerizes—Sequence analysis of zizimin1 indicated potential coiled coil structures in the last 100 amino acids (9Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (146) Google Scholar). These structures are often implicated in oligomerization, which prompted us to test whether zizimin1 exists as higher order complexes. We therefore transfected COS7 cells with HA-tagged zizimin1 alone or together with FLAG-tagged protein. When cell lysates were immunoprecipitated with antibody to FLAG, HA-zizimin1 was efficiently precipitated from cells co-expressing FLAG-zizimin1 but not from control cells that expressed only HA-zizimin1. These results demonstrate self-association of zizimin1 (Fig. 1B).As an independent assay for oligomerization, lysates of cells overexpressing HA-zizimin1 were treated with the zero-length cross-linking reagent EDC that links amino and carboxylic acid groups when they are within close proximity (22Grabarek Z. Gergely J. Anal. Biochem. 1990; 185: 131-135Crossref PubMed Scopus (713) Google Scholar). The samples were then analyzed by SDS-PAGE and Western blotting with anti-HA. Cross-linking induced the appearance of a single major higher molecular mass band (Fig. 1D). No higher oligomers were detected. Fibronectin and zizimin1 have similar monomer molecular weights (fibronectin, 263; zizimin1, 236), and plasma fibronectin is a disulfide-bonded dimer; thus, fibronectin run under reduced or nonreduced conditions was used as a marker for monomers and dimers, respectively (arrows on Fig. 1D). The EDC-induced zizimin1 band had the same mobility as the fibronectin dimer, suggesting that zizimin1 forms oligomers, most likely dimers.Mapping the Oligomerization Domain—To identify sequences in zizimin1 required for oligomerization, the interactions between FLAG-tagged full-length zizimin1 and HA-tagged deletion mutants were tested by co-immunoprecipitation. Deletion of the C-terminal 191 amino acids (Δ1879-end) modestly reduced the association, whereas deletion of 373 amino acids (Δ1696-end) nearly abolished the interaction (Fig. 1B). When lysates containing the HA-tagged C-terminal deletion constructs were treated with EDC, the more slowly migrating species was decreased for zizimin1Δ1879-end and further diminished with zizimin1Δ1696-end (Fig. 1D).To test whether residues 1696–1878 are sufficient for oligomerization, we co-expressed FLAG and HA forms of a similar fragment (1693–1878) and performed the co-immunoprecipitation and cross-linking assays. HA-zizimin11693–1878 precipitated with FLAG-zizimin11693–1878 but not with a FLAG-tagged zizimin1 pleckstrin homology domain that was used as a negative control (Fig. 2B). EDC treatment induced a slower migrating band compatible with dimeric zizimin11693–1878 (Fig. 2D). These results show that zizimin1 amino acids 1696–1878 encompass the core sequence required for oligomerization, whereas amino acids 1879–2069 enhance the association. The potential coiled-coil lies at the last hundred amino acids and thus is outside the main oligomerization motif. Efforts to further map the interactions involved in dimer formation were unsuccessful because neither the 1693–1777 nor the 1775–2069 fragments showed significant dimer formation by either chemical cross-linking or co-immunoprecipitation (Fig. 2, B–D).Fig. 2Mapping the oligomerization domain.A, schematic diagram of the zizimin1 C-terminal region and the fragments used in the experiments. The area represented by dashed line is not to scale. B, association of zizimin1 fragments was determined by co-immunoprecipitation. HA-tagged zizimin1 fragments (bait) were co-expressed in COS7 cells with FLAG-tagged fragments (hunter) and immunoprecipitated with anti-FLAG antibody. The FLAG-tagged zizimin1 pleckstrin homology domain (PH, amino acids 172–282) was used as a negative control. Level of the different fragments in the IPs and the corresponding whole cell extracts (W; representing 9% of the extract used for IP) was determined by Western blotting with anti-HA (top panels) or anti-FLAG antibody (bottom panels). C, the experiment was performed and is displayed as in B. The positions of different fragments are indicated by arrows. The very top bands in the HA or FLAG blots are the heavy chain of the FLAG antibody used for IP. D, HA-tagged zizimin11693–1878 and zizimin11775-end were expressed in COS7 cells. Cell lysates treated with (+) or without (–)5mm EDC were analyzed by SDS-PAGE and anti-HA Western blotting.View Large Image Figure ViewerDownload (PPT)DOCK180 Oligomerization—As mentioned in the introduction, this family of GEFs can be divided into DOCK180-related and zizimin-related proteins. The amino acids from position 1696 to the end are part of the CZH2 domain, which is conserved among all family members. This homology raises the question whether the DOCK180-related proteins also oligomerize. We therefore expressed FLAG-tagged together with HA-tagged DOCK180 and assayed co-immunoprecipitation. HA-DOCK180 was detected in anti-FLAG immunoprecipitates in the presence of FLAG-DOCK180 but not in its absence (Fig. 1C). Thus, DOCK180 also self-associates, suggesting that this property is conserved throughout the CZH family.Zizimin1 Is a Dimer—To determine whether zizimin1 assembles into dimers or higher oligomers, hydrodynamic properties were assayed. Lysates of nontransfected or zizimin1-overexpressing COS7 cells were analyzed by both gel filtration and sedimentation on sucrose gradients. The resultant fractions were analyzed by Western blotting to detect zizimin1. Globular protein standards were separated in parallel. These measurements showed that endogenous zizimin1 had a Stokes radius of 86 Å and a sedimentation coefficient of 12.6 S (Fig. 3). When overexpressed at moderate levels, the main peak of HA-zizimin1 had a Stokes radius of 13.6 S but showed a tail toward a higher molecular weight. Neither endogenous nor HA-zizimin1 had any protein detectable at the position expected for monomers. Calculations of the molecular weight based on these values (see "Materials and Methods") yielded a molecular weight for zizimin1 of 480 kDa. Based on amino acid composition, the monomer mass of zizimin is 236 kDa; thus hydrodynamic measurements indicate that zizimin1 exists mainly as a dimer. However, when expressed at high levels, HA-zizimin1 ran as much higher aggregates (not shown), suggesting that higher order oligomers are possible under some conditions.Rotary Shadow Electron Microscopy—To view the zizimin1 complex, the protein was overexpressed in COS7 cells at levels where it remains primarily dimeric according to hydrodynamics, purified by FLAG immunoprecipitation, rotary-shadowed, and examined by EM. Analysis by SDS-PAGE and Coomassie staining demonstrated that the protein ran as a single major band (not shown). EM images revealed symmetric, V-shaped structures with varying angles between the two arms (Fig. 4). Although the resolution of the technique does not allow a detailed analysis of protein structure, it appears that the arms may be composed of several globular domains. EM images are therefore compatible with zizimin1 being a dimer held together at the C terminus. EM images of control samples from mock-transfected cells lacked the V-shaped structures (not shown).Fig. 4EM images of zizimin1. FLAG-tagged zizimin1 purified from COS7 cells was rotary-shadowed and electron microscopy images taken of the replicas. An image of 50,000 magnification is shown. The inset shows an individual zizimin1 molecule at higher magnification.View Large Image Figure ViewerDownload (PPT)Individual Cdc42-binding Sites in Zizimin1 Monomers—The zizimin1 CZH2 domain mediates both the interaction with Cdc42 and dimerization. The relationship between dimerization and Cdc42 binding was therefore explored. Because zizimin1 appears to exist exclusively as a dimer, we tested whether monomers that contain individual Cdc42-binding sites can function independently. To obtain a zizimin1 point mutant deficient in Cdc42 binding, we mutated tyrosine 1865 and isoleucine 1866, which are conserved in all CZH family members, to alanine. A parallel mutation in DOCK180 was found to inhibit the interaction with Rac (14Brugnera E. Haney L. Grimsley C. Lu M. Walk S.F. Tosello-Trampont A.C. Macara I.G. Madhani H. Fink G.R. Ravichandran K.S. Nat. Cell Biol. 2002; 4: 574-582Crossref PubMed Scopus (468) Google Scholar). The Zizimin1AA mutation almost completely suppressed Cdc42 binding (Fig. 5A). Zizimin1AA showed a modest (∼3-fold) decrease in its ability to dimerize with WT protein compared with WT/WT dimers (Fig.
Referência(s)