The IGF2 Receptor Is a USF2-specific Target in Nontumorigenic Mammary Epithelial Cells but Not in Breast Cancer Cells
2003; Elsevier BV; Volume: 278; Issue: 39 Linguagem: Inglês
10.1074/jbc.m305791200
ISSN1083-351X
AutoresMarilyn N. Szentirmay, Huixin Yang, Snehalata A. Pawar, Charles Vinson, Michèle Sawadogo,
Tópico(s)DNA Repair Mechanisms
ResumoThe antiproliferative activities of the USF proteins and the frequent loss of USF function in cancer cells suggest a role for these ubiquitous transcription factors in tumor suppression. However, the cellular targets that mediate the effects of USF on cellular proliferation and transformation remain uncharacterized. IGF2R, with multiple functions in both normal growth and cancer, was investigated here as a possible USF target in both nontumorigenic and tumorigenic breast cell lines. The 5′-flanking sequences of the human IGF2R gene contain multiple, highly conserved E boxes almost identical to the consensus USF DNA-binding sequence. These E boxes were found to be essential for IGF2R promoter activity in the nontumorigenic mammary epithelial cell line MCF-10A. USF1 and USF2 bound the IGF2R promoter in vitro, and both USF1 and USF2, but not c-Myc, were present within the IGF2R promoter-associated chromatin in vivo. Overexpressed USF2, but not USF1, transactivated the IGF2R promoter, and IGF2R mRNA was markedly decreased by expression of a USF-specific dominant negative mutant, identifying IGF2R as a USF2 target. IGF2R promoter-driven expression was USF-independent in both MCF-7 and MDA-MB-231 breast cancer cell lines, suggesting that a defect in USF function may contribute to down-regulation of IGF2R expression in cancer cells. The antiproliferative activities of the USF proteins and the frequent loss of USF function in cancer cells suggest a role for these ubiquitous transcription factors in tumor suppression. However, the cellular targets that mediate the effects of USF on cellular proliferation and transformation remain uncharacterized. IGF2R, with multiple functions in both normal growth and cancer, was investigated here as a possible USF target in both nontumorigenic and tumorigenic breast cell lines. The 5′-flanking sequences of the human IGF2R gene contain multiple, highly conserved E boxes almost identical to the consensus USF DNA-binding sequence. These E boxes were found to be essential for IGF2R promoter activity in the nontumorigenic mammary epithelial cell line MCF-10A. USF1 and USF2 bound the IGF2R promoter in vitro, and both USF1 and USF2, but not c-Myc, were present within the IGF2R promoter-associated chromatin in vivo. Overexpressed USF2, but not USF1, transactivated the IGF2R promoter, and IGF2R mRNA was markedly decreased by expression of a USF-specific dominant negative mutant, identifying IGF2R as a USF2 target. IGF2R promoter-driven expression was USF-independent in both MCF-7 and MDA-MB-231 breast cancer cell lines, suggesting that a defect in USF function may contribute to down-regulation of IGF2R expression in cancer cells. USF1 and USF2 are ubiquitously expressed basic helix-loop-helix-leucine zipper (bHLHzip) 1The abbreviations used are: bHLHzip, basic helix-loop-helix-leucine zipper; IGF2R, insulin-like growth factor 2 receptor; WT, wild type; HA, hemagglutinin; ChIP, chromatin immunoprecipitation; PIPES, 1,4-piperazinediethanesulfonic acid; RT, reverse transcriptase; ML, major late. transcription factors that share nearly identical C-terminal bHLHzip motifs and bind as both homodimers and heterodimers to DNA sequences centered on CAC(G/A)TG. All USF dimers have identical affinities for the 12-bp consensus binding site, GGTCACGTGACC (1Bendall A.S. Molloy P.L. Nucleic Acids Res. 1994; 22: 2801-2810Crossref PubMed Scopus (125) Google Scholar). The USF DNA binding specificity for the central 6 bp, but not the full 12-bp preference, is shared with several other bHLHzip transcription factors, including c-Myc (2Blackwell T.K. Huang J. Ma A. Kretzner L. Alt F.W. Eisenman R.N. Weintraub H. Mol. Cell Biol. 1993; 13: 5216-5224Crossref PubMed Scopus (333) Google Scholar, 3Desbarats L. Gaubatz S. Eilers M. Genes Dev. 1996; 10: 447-460Crossref PubMed Scopus (112) Google Scholar, 4Aksan I. Goding C.R. Mol. Cell. Biol. 1998; 18: 6930-6938Crossref PubMed Scopus (179) Google Scholar). Whereas c-Myc promotes cellular proliferation and transformation, overexpressed USF has been shown to suppress these processes (5Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar). In focus formation assays, cotransfection of USF1 or USF2 prevented transformation of primary rat embryonic fibroblasts by c-Myc and activated Ras (5Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar). USF1 blocked c-Myc-dependent but not E1A-dependent transformation, consistent with a mechanism in which USF1 competes with Myc for DNA-binding sites. In contrast to USF1, USF2 displayed more general growth suppression properties, inhibiting both c-Myc and E1A-mediated transformation and also blocking HeLa cell colony formation (5Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar). The ability of USF to antagonize the transforming potential of c-Myc together with the similar binding preferences of Myc and USF suggest that these factors share a subset of common targets, and indeed, c-Myc and USF bind to some common promoters in vivo (6Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1997; 17: 2529-2537Crossref PubMed Scopus (139) Google Scholar, 7Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1999; 19: 8393-8399Crossref PubMed Scopus (147) Google Scholar). The degree to which the DNA binding specificity bears on target selection and biological activity by USF and Myc is not known but is likely to depend on the promoter and cell context. USF1 and USF2 transcriptional and antiproliferative activities have been shown to be cell context-dependent. In cells derived from normal breast epithelium, both endogenous and exogenous USF1 and USF2 strongly activated transcription from artificial promoters containing USF-binding sites (8Ismail P.M. Lu T. Sawadogo M. Oncogene. 1999; 18: 5582-5591Crossref PubMed Scopus (74) Google Scholar). In contrast, USF antiproliferative activities and transcriptional activity at artificial promoters were impaired in several tumorigenic cell lines. In Saos-2 osteosarcoma cells, USF failed to activate transcription, and exogenous USF did not inhibit cellular proliferation (9Qyang Y. Luo X. Lu T. Ismail P. Krylov D. Vinson C. Sawadogo M. Mol. Cell. Biol. 1999; 19: 1508-1517Crossref PubMed Scopus (148) Google Scholar). Endogenous USF did not transactivate an artificial promoter in several breast cancer cell lines, even though the USF protein levels and in vitro DNA-binding properties were the same as in normal breast epithelial cells (8Ismail P.M. Lu T. Sawadogo M. Oncogene. 1999; 18: 5582-5591Crossref PubMed Scopus (74) Google Scholar). In three of six breast cancer cell lines, both exogenous USF1 and USF2 were inactive, whereas in the other three cell lines, overexpressed USF1, but not USF2, activated the USF-responsive reporter. This latter situation parallels the case in HeLa cells, where overexpression of USF was required to observe transcriptional or antiproliferative activities (5Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar, 10Luo X. Sawadogo M. Mol. Cell. Biol. 1996; 16: 1367-1375Crossref PubMed Scopus (118) Google Scholar). Besides the correspondence between loss of USF activity and tumorigenic status of the cells studied so far (8Ismail P.M. Lu T. Sawadogo M. Oncogene. 1999; 18: 5582-5591Crossref PubMed Scopus (74) Google Scholar, 9Qyang Y. Luo X. Lu T. Ismail P. Krylov D. Vinson C. Sawadogo M. Mol. Cell. Biol. 1999; 19: 1508-1517Crossref PubMed Scopus (148) Google Scholar), there is evidence for a role of USF in regulating growth in normal cells. In particular, mice lacking the Usf2 gene produce small offspring with decreased viability, whereas the destruction of both Usf1 and Usf2 genes results in early embryonic lethality (11Sirito M. Lin Q. Deng J.M. Behringer R.R. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3758-3763Crossref PubMed Scopus (133) Google Scholar). Analysis of mammary tissue in postpartum Usf2–/– females revealed that USF2 plays a key role in normal mammary cell differentiation and lactation. 2D. Hadsell, unpublished results. Phosphorylation of USF1 by p38 kinase is a key step in the increased transcription of the tyrosinase gene in response to stress (12Galibert M.-D. Carreira S. Goding C.R. EMBO J. 2001; 20: 5022-5031Crossref PubMed Scopus (180) Google Scholar). The role of USF in normal growth regulation, together with the loss of USF activity in cancer cells, suggests that USF activity loss is linked to tumorigenesis and that deregulation of USF target genes in cancer cells contributes to the tumorigenic phenotype. USF has been implicated in the regulation of several genes involved in tumorigenesis, including cyclin B1 (13Cogswell J.P. Godlevski M.M. Bonham M. Bisi J. Babiss L. Mol. Cell. Biol. 1995; 15: 2782-2790Crossref PubMed Scopus (115) Google Scholar), BRCA2 (14Wu K. Jiang S.-W. Thangaraju M. Wu G. Couch F.J. J. Biol. Chem. 2000; 275: 35548-35556Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar), adenomatous polyposis coli (15Jaiswal A.S. Narayan S. J. Cell. Biochem. 2001; 81: 262-277Crossref PubMed Scopus (51) Google Scholar), and cathepsin D (16Xing W. Archer T.K. Mol. Endocrinol. 1980; 12: 1310-1321Crossref Scopus (62) Google Scholar). Here we report a key role for USF in expression of the mannose 6-phosphate/insulin-like growth factor 2 receptor (IGF2R) gene in normal mammary epithelial cells. Three near-consensus USF sites within the promoter of the IGF2R gene indicated that it would be transcriptionally regulated by USF, and the growth suppressive function of the IGF2R gene product was consistent with a role for USF in maintaining its expression. The IGF2R gene encodes a 2491-amino acid multifunctional membrane receptor that plays a vital role during embryonic growth (17Lau M.M.H. Stewart C.E.H. Liu Z. Bhatt H. Rotwein P. Stewart C.L. Genes Dev. 1994; 8: 2953-2963Crossref PubMed Scopus (475) Google Scholar). IGF2R binds the growth factor IGF2 and delivers it to lysosomes for degradation, thus suppressing IGF2 signaling (18Morgan D.O. Edman J.C. Standring D.N. Fried V.A. Smith M.C. Roth R.A. Rutter W.J. Nature. 1987; 329: 301-307Crossref PubMed Scopus (636) Google Scholar). In other functions, the IGF2R protein transfers lysosomal enzymes within the cell by binding to mannose 6-phosphate residues (19Kornfeld S. Annu. Rev. Biochem. 1992; 61: 307-330Crossref PubMed Scopus (936) Google Scholar) and binds a number of other ligands, including latent transforming growth factor-β, which is converted to its active form in a process that involves IGF2R binding (20Dennis P.A. Rifkin D.B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 580-584Crossref PubMed Scopus (460) Google Scholar). The IGF2R protein is ubiquitously expressed, although variations in the amounts of receptor have been noted during development, on experimental induction of diabetes in rats, and on hepatic fibrogenesis (21Keiss W. Hoeflich A. Yang Y. Groenbaek H. Flyvbuerg A. Growth Regul. 1996; 6: 66-72PubMed Google Scholar, 22De Bleser P.J. Scott C.D. Niki T. Xu G. Wisse E. Geerts A. Hepatology. 1996; 23: 1530-1537Crossref PubMed Google Scholar). In the mouse, IGF2R is expressed only from the maternal allele, whereas in adult humans, the IGF2R gene is not normally imprinted (23Barlow D.P. Stoger R. Herrmann B.G. Saito K. Schweifer N. Nature. 1991; 349: 84-87Crossref PubMed Scopus (722) Google Scholar, 24Kalscheuer V.M. Mariman E.C. Schepens M.T. Rehder H. Ropers H.-H. Nat. Genet. 1993; 5: 74-78Crossref PubMed Scopus (201) Google Scholar). In transgenic experiments, most mice lacking IGF2R die shortly after birth, a phenotype rescued by targeted deletion of either IGF2 or its signaling receptor, IGF1R (17Lau M.M.H. Stewart C.E.H. Liu Z. Bhatt H. Rotwein P. Stewart C.L. Genes Dev. 1994; 8: 2953-2963Crossref PubMed Scopus (475) Google Scholar, 25Ludwig T. Eggenschwiler J. Fisher P. D'Ercole A.J. Davenport M.L. Efstratiadis A. Dev. Biol. 1996; 177: 517-535Crossref PubMed Scopus (406) Google Scholar). A number of studies have implicated IGF2R loss in carcinogenesis. Mutations have been identified in the IGF2R gene in many cancers (26De Souza A.T. Hankins G.R. Washington M.K. Orton T.C. Jirtle R.L. Nat. Genet. 1995; 11: 447-449Crossref PubMed Scopus (334) Google Scholar, 27Zavras A.I. Pitiphat W. Wu T. Cartsos V. Lam A. Douglass C.W. Diehl S.R. Cancer Res. 2003; 63: 296-297PubMed Google Scholar, 28Hassan A.B. Am. J. Pathol. 2003; 162: 3-6Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 29Hankins G.R. DeSouza A.T. Bentley R.C. Patel M.R. Marks J.R. Inglehart J.D. Jirtle J.L. Oncogene. 1996; 12: 2003-2009PubMed Google Scholar, 30Souza R.F. Appel R. Yin J. Wang S. Smolinski K.N. Abraham J.M. Zou T.-T. Shi Y.-Q. Lei J. Cottrell J. Cymes K. Biden K. Simms L. Leggett B. Lynch P.M. Frazier M. Powell S.M. Harpaz N. Sugimura H. Young J. Meltzer S.J Nat. Genet. 1996; 14: 255-257Crossref PubMed Scopus (440) Google Scholar), and tumor cell growth is modified by changes in IGF2R expression (31O'Gorman D.B. Costello M. Weiss J. Firth S.M. Scott C.D. Cancer Res. 1999; 59: 5692-5694PubMed Google Scholar, 32Souza R.F. Wang S. Thakar M. Smolinski K.N. Yin J. Zou T.T. Kong D. Abraham J.M. Toretsky J.A. Meltzer S.J. Oncogene. 1999; 18: 4063-4068Crossref PubMed Scopus (70) Google Scholar). Outside of imprinting, the mechanisms controlling IGF2R levels and the contribution of transcriptional regulation to IGF2R expression are not well understood. Deletion analysis of the mouse Igf2r gene identified a 5′ region with two E boxes essential for promoter activity in liver cells (33Liu Z. Mittanck D.W. Kim S. Rotwein P. Mol. Endocrinol. 1995; 9: 1477-1487PubMed Google Scholar). In hepatic stellate cells, Igf2r expression was down-regulated by a repressor binding at an E box of the mouse promoter (34Weiner J.A. Chen A. Davis B.H. J. Biol. Chem. 1998; 273: 15913-15919Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). However, the identity of this repressor and other trans-acting factors of the IGF2R promoter are not known. Here we show that the USF proteins bind to multiple E boxes in the human IGF2R promoter and that these E boxes are essential for promoter activity. The role of USF at this promoter was investigated in a cell line with robust endogenous USF activity, the nontumorigenic human breast epithelial cell line MCF-10A. These experiments demonstrate that the human IGF2R gene is a target of USF2, but not of c-Myc. However, the IGF2R promoter is unresponsive to USF in two breast cancer cell lines, providing further evidence for disrupted USF transcriptional activity in cancer cells. Cell Culture—MCF-10A cells were grown in monolayers at 37 °C and 5% CO2 in 50% Dulbecco's modified Eagle's medium, 50% F-12 medium supplemented with 5% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 10 μg/ml insulin, 100 ng/ml cholera toxin, 0.5 μg/ml hydrocortisone, 20 ng/ml recombinant human epidermal growth factor, and 1.05 mm CaCl2. MCF-7 and MDA-MB-231 cells were cultured in monolayers in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Plasmids—PRL-SV40 (Promega), pRSV-Luc, pMLLuc, pU3MLLuc, pSG424, and pRc/CMV566, and expression vectors for A-USF, A-Max, USF1 (psvUSF1), USF2 (psvUSF2), and c-Myc (pSV-c-myc-1) have been described (9Qyang Y. Luo X. Lu T. Ismail P. Krylov D. Vinson C. Sawadogo M. Mol. Cell. Biol. 1999; 19: 1508-1517Crossref PubMed Scopus (148) Google Scholar, 10Luo X. Sawadogo M. Mol. Cell. Biol. 1996; 16: 1367-1375Crossref PubMed Scopus (118) Google Scholar). The various IGF2R-luciferase reporter plasmids were constructed by annealing in pairs and then ligating combinations of four pairs of overlapping oligonucleotides into pMLLuc digested with SmaI and HindIII. Wild-type (WT) IGF2R reporter, pABCLuc, was constructed with the following oligonucleotides: forward: CTGCGCTCACGTGACCCGGGCCTGGGAGGAGCCGGGGCGGGCGGGG (Igf2r1), GTCACCTGAACAAGGGAGTCACGTGAGCGGGGGGCGGGGGTGGG (Igf2r3), GGGGCGGTGCCGGGCGGCTGTCACGTGACGCGGTTCCGGGGCCGCCG (Igf2r5), and CTGCCGCTGTCGCTGTCGCCGAGCCCAGTCGAGCCGCGCTCACCTC (Igf2r7); reverse: TGACCCCCGCCCGCCCCGGCTCCTCCCAGGCCCGGGTCACGTGAGCGCAG (Igf2r2), CCCCCCCACCCCCGCCCCCCGCTCACGTGACTCCCTTGTTCAGG (Igf2r4), GCAGCGGCGGCCCCGGAACCGCGTCACGTGACAGCCGCCCGGCACCG (Igf2r6), and AGCTTGAGGTGAGCGCGGCTCGACTGGGCTCGGCGACAGCGACAGCG (Igf2r8). Various combinations of the CACGTG sequences (underlined) were changed to AGATCT in the promoter mutants. pMZFP1 was constructed by ligating the HindIII (end-filled)/BamHI insert from pABCLuc into the vector pSL1180 (Amersham Biosciences) digested with StuI and BglII. To construct pCBALuc, a Klenow DNA polymerase end-filled BamHI/HindIII fragment from pABCLuc containing the IGF2R promoter region was ligated to pRLSV40 (Promega) digested with BglII and HindIII and end-filled with Klenow DNA polymerase. Transient Transfections and Luciferase Assays—For experiments in which luciferase activities were measured, cells were seeded in 6-well plates at 2–2.5 × 105 cells per well 20–24 h prior to transfection. To each well, 6 μl of FuGENE 6 transfection reagent (Roche Applied Science) and up to 2 μg of plasmid DNA (in quantities noted for each experiment) were added to 94 μl of serum-free medium. 44–48 h after transfection, cells were scraped into 100 μl of lysis buffer (10Luo X. Sawadogo M. Mol. Cell. Biol. 1996; 16: 1367-1375Crossref PubMed Scopus (118) Google Scholar) or M-PER Mammalian Protein Extraction Reagent (Pierce). The lysates were spun 1 min in a microcentrifuge, and the supernatants were assayed for luciferase activities with a Monolight 2010 luminometer (Analytical Luminescence Laboratories) using the firefly luciferase assay buffer described previously (10Luo X. Sawadogo M. Mol. Cell. Biol. 1996; 16: 1367-1375Crossref PubMed Scopus (118) Google Scholar) or the Dual-Luciferase Reporter Assay system (Promega). Unless otherwise noted, each data point is an average of three or more independent transfections. Error bars represent one standard deviation. DNase I Footprinting—DNase I footprinting of recombinant USF and chemical sequencing G-reactions were carried out according to published protocols (35Sawadogo M. Roeder R.G. Cell. 1985; 43: 165-175Abstract Full Text PDF PubMed Scopus (720) Google Scholar). The 340-bp probe was singly labeled at the 5′ position of the top strand by digesting pMZFP1 with SalI in the presence of calf intestinal phosphatase, treating with polynucleotide T4 kinase and [γ-32P]ATP, and then cutting with XhoI. After agarose electrophoresis, the labeled fragment was captured and eluted from NA45 DEAE-cellulose membranes (Schleicher & Schuell). The expression and purification of recombinant USF1 and USF2 have been described previously (36Van Dyke M.W. Sirito M. Sawadogo M. Gene (Amst.). 1992; 111: 99-104Crossref PubMed Scopus (132) Google Scholar, 37Sirito M. Lin Q. Maity T. Sawadogo M. Nucleic Acids Res. 1994; 22: 427-433Crossref PubMed Scopus (292) Google Scholar). MCF-10A nuclear extracts (38Schreiber E. Matthias P. Muhler M.M. Schaffner W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3918) Google Scholar) were employed in footprinting with the same probe as for recombinant USF. The binding reactions for MCF-10A nuclear extract were carried out for 1 h at 30 °C in reaction buffer lacking magnesium, 20 mm HEPES, pH 7.9, 5 mm dithiothreitol, 5% glycerol, 120 μg/ml bovine serum albumin, and 0.025% Triton X-100, 100 ng of poly[d(GC)], and 200 ng of pBKS–. 105 mm NaCl was contributed by 6.6 μl of nuclear extract (from 2.0 × 105 cells) and 140 mm NaCl by 8.8 μl of nuclear extract (from 2.6 × 105 cells). Magnesium chloride (6 mm final) was added with the DNase I (0.0086 mg/ml final), and reactions were stopped and processed as described (35Sawadogo M. Roeder R.G. Cell. 1985; 43: 165-175Abstract Full Text PDF PubMed Scopus (720) Google Scholar). Western Blotting—Expression vectors for A-USF and A-Max also encoded the hemagglutinin (HA) epitope, permitting detection of these proteins by Western blotting. To detect USF1, USF2, c-Myc, A-USF, and A-Max, proteins from 10 μl of luciferase were resolved by SDS-PAGE, blotted onto nitrocellulose membranes, and probed with antibodies to HA (12CA5, Roche Applied Science), USF1 (C-20, sc229, Santa Cruz Biotechnology), USF2 (C-20, sc862, Santa Cruz Biotechnology), or c-Myc (N-262, sc764, Santa Cruz Biotechnology). Secondary antibody detection was by chemiluminescence (Pierce). Chromatin Immunoprecipitation (ChIP)—Cells in monolayer culture were cross-linked for 20 min by addition of formaldehyde to a final concentration of 1%. The cross-linking reaction was quenched by addition of glycine to give a final concentration of 0.25 mm. Cells were washed with phosphate-buffered saline, scraped from the dish, and then washed again in phosphate-buffered saline containing protease inhibitor mixture (10 μl/ml, Sigma P8340) and 10 mm phenylmethylsulfonyl fluoride. The resuspended cell pellet was incubated on ice for 10–30 min in lysis buffer (5 mm PIPES, pH 8.0, 0.085 m KCl, 0.5% Nonidet P-40) with protease inhibitors and centrifuged at 800 rpm for 20 min. The nuclear pellet was resuspended in nuclear lysis buffer (50 mm Tris, pH 8, 10 mm EDTA, 1% SDS) with protease inhibitors and sonicated to obtain DNA fragments of sizes 0.5–1 kb. After a spin of 14,000 rpm for 15 min at 4 °C, the chromatin extract supernatant was treated with pre-blocked staphylococcus A cells (6Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1997; 17: 2529-2537Crossref PubMed Scopus (139) Google Scholar) for 15 min at 4 °C and centrifuged again (14,000 rpm for 15 min). Anti-USF1 (C-20, sc229), anti-USF2 (N-18, sc861), or anti-Myc (N-262, sc764) antibodies (Santa Cruz Biotechnology) were added to this pre-cleared chromatin extract and incubated overnight at 4 °C with gentle rotation. A mock reaction with no added antibodies was carried out in parallel. Each reaction was incubated with 10 μl of pre-blocked staphylococcus A cells for 15 min at 4 °C followed by centrifugation at 14,000 rpm for 15 min and extensive washing of the pellet as described (7Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1999; 19: 8393-8399Crossref PubMed Scopus (147) Google Scholar). Supernatant of the mock reaction served as input and was processed in parallel with the immunoprecipitates. Pellets were incubated with elution buffer (50 mm NaHCO3, 1% SDS) at 25 °C for 15 min with gentle shaking. After a spin at 14,000 rpm for 15 min, the eluates were heated at 65 °C for 6 h to overnight in 300 mm sodium acetate containing RNase A to reverse cross-linking. DNA was isolated as described previously (7Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1999; 19: 8393-8399Crossref PubMed Scopus (147) Google Scholar) and analyzed by PCR. PCR primers for ChIP were as follows: IGF2R promoter (product size 164 bp): forward, 5′-CACCTGAACAAGGGAGTCACG-3′, and reverse, 5′-AAAGGCGGAGGTGGAGAC-3′; CDK4 promoter (product size 347 bp): forward, 5′-GTGGCCTAGGTTGCCATGGCAC-3′, and reverse, 5′-CTCACCAATGTGACCAGCTGCC-3′; and h-TERT intron 2 (product size 546 bp): forward, 5′-CCAGGTGTCCTTGGCGTTTG-3′, and reverse, 5′-GCAGAGCCCAGCCTAAGCAA-3′. Separation of Transfected and Nontransfected Cells—Transfected cells were selected by magnetic cell separation (MACSelect, Miltenyi Biotech). For this procedure, each 75-cm2 plate of MCF-10A cells was transfected with a mixture of 60 μl of FuGENE 6 (Roche Applied Science), 940 μl of serum-free medium, 2 μg of pA-USF or the control vector p566 and 10 μg of a plasmid encoding a truncated CD4 molecule (pMACS 4.1, Miltenyi Biotech). After 46 h, cells were washed and harvested in PBE (phosphate-buffered saline, 0.5% bovine serum albumin, and 2 mm EDTA), incubated with MACSelect 4 magnetic microbeads, and passed through the magnetic column according to the manufacturer's instructions. RNA Isolation and RT-PCR—Total RNA was isolated by adding TriPure Isolation Reagent (Roche Applied Science) to the separated cells and extracting RNA into an acidic aqueous phase according to the manufacturer's protocol. The quantity of total RNA recovered was measured spectrophotometrically at 260 nm. Relative message levels were determined by quantitative RT-PCR in a method adapted from earlier described protocols (39Latil A. Bièche I. Vidaud D. Lidereau R. Berthon P. Cussenot O. Vidaud M. Cancer Res. 2001; 61: 1919-1926PubMed Google Scholar, 40Roy R.N. Gerulath A.H. Cecutti A. Bhavnani B.R. Mol. Cell. Endocrinol. 1999; 153: 19-27Crossref PubMed Scopus (32) Google Scholar). cDNA was synthesized from 1 μg of total RNA by avian myeloblastosis virus-reverse transcriptase (RT) primed by random hexamers or by oligo(dT). A portion of each RT reaction was amplified in a PCR in the LightCycler PCR instrument (Roche Applied Science) using either the LightCycler-DNA Master SYBR Green I kit (Roche Applied Science) or Taq polymerase in commercial Taq reaction buffer (Promega). In the latter case, a dilution in dimethyl sulfoxide of SYBR Green I dye (Molecular Probes) was added to each 20-μl PCR. PCR primers were present at a concentration of 0.5 μm. After a denaturation step (30 s at 95 °C), reactions were cycled 40 times (95 °C for 0 s, 65 °C for 10 s, 72 °C for 8 s, and 85 °C for 3 s). The fluorescence was measured at 85 °C to minimize fluorescence from short, nonspecific products. Melting curves were obtained at the end of each PCR experiment to verify the production of specific products, and sizes of products from representative PCRs were checked by agarose gel electrophoresis. The real time fluorescence measurements permit detection of the threshold cycle number (Ct) corresponding to the exponential growth of PCR product. Ct is proportional to the log of the cDNA concentration. From Ct values of a series of dilutions of an external standard (cDNA from nontransfected MCF-10A cells), a standard curve was generated, and the Ct value of each unknown was used to calculate a transcript amount relative to the external standards. To control for differences in overall RT efficiency and variation in mRNA quality and amount, IGF2R and a reference gene, acidic ribosomal phosphoprotein P0 (RPLP0), were amplified from the same experimental RT reaction and the data expressed as a ratio of IGF2R to RPLP0. RPLP0 (product size 149 bp): forward primer, 5′-GGCGACCTGGAAGTCCAACT-3′, and reverse primer, 5′-CCATCAGCACCACAGCCTTC-3′; IGF2R (product size 220 bp): forward primer, 5′-GCTGACCACTTGCTGTAGGAGAAG-3′, and reverse primer, 5′-ATCCTCACTGTCCTGGTCATCCC-3′. USF-binding Sites Are Essential for IGF2R Promoter Function in Human Breast Epithelial Cells—The proximal human IGF2R promoter contains three E boxes that are near-consensus matches for the optimal USF-binding site. A comparison of these three E boxes (boxes A–C, Fig. 1A) with the 12-bp consensus binding site for transcription factor USF (5′-GGTCACGTGACC-3′) reveals that each contains not only the central CA(C/T)GTG motif shared by USF, Myc, and TFE3 bHLHzip family members (1Bendall A.S. Molloy P.L. Nucleic Acids Res. 1994; 22: 2801-2810Crossref PubMed Scopus (125) Google Scholar, 2Blackwell T.K. Huang J. Ma A. Kretzner L. Alt F.W. Eisenman R.N. Weintraub H. Mol. Cell Biol. 1993; 13: 5216-5224Crossref PubMed Scopus (333) Google Scholar, 6Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1997; 17: 2529-2537Crossref PubMed Scopus (139) Google Scholar, 41Hodgkinson C.A. Moore K.J. Nakayama A. Steingrimsson E. Copeland N.G. Jenkins N.A. Arnheiter H. Cell. 1993; 74: 395-404Abstract Full Text PDF PubMed Scopus (950) Google Scholar) but also flanking sequences that favor USF binding (1Bendall A.S. Molloy P.L. Nucleic Acids Res. 1994; 22: 2801-2810Crossref PubMed Scopus (125) Google Scholar, 6Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1997; 17: 2529-2537Crossref PubMed Scopus (139) Google Scholar, 7Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1999; 19: 8393-8399Crossref PubMed Scopus (147) Google Scholar) (Table I). In particular, the T and A flanking residues (boldface, Table I) favor strong binding by USF but not c-Myc (1Bendall A.S. Molloy P.L. Nucleic Acids Res. 1994; 22: 2801-2810Crossref PubMed Scopus (125) Google Scholar, 2Blackwell T.K. Huang J. Ma A. Kretzner L. Alt F.W. Eisenman R.N. Weintraub H. Mol. Cell Biol. 1993; 13: 5216-5224Crossref PubMed Scopus (333) Google Scholar, 6Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1997; 17: 2529-2537Crossref PubMed Scopus (139) Google Scholar, 7Boyd K.E. Farnham P.E. Mol. Cell. Biol. 1999; 19: 8393-8399Crossref PubMed Scopus (147) Google Scholar). Also present in the proximal IGF2R promoter is a fourth E box (site B′) lacking the central USF motif and potential binding sites for SP1 family members or other transcription factors that recognize GC-rich sequences. All four E boxes are well conserved in the human, opossum, and mouse IGF2R promoters, including the precise spacing between E boxes B′ and B (Fig. 1A).Table ISequence comparison of the human IGF2R promoter E boxes to the USF- and Myc-consensus binding sites and the adenovirus ML E box that binds both USF and c-MycSiteSequenceHuman IGFIIRSite AGcTCACGTGACCSite BAGTCACGTGAgCSite CTGTCACGTGACgSite B′GGTCACcTGAaCAdenovirus MLGGcCACGTGACCUSF consensusGGTCACGTGACCMyc/Max consensusCCACGTGG Open table in a new tab An earlier investigation of the mouse Igf2r promoter (33Liu Z. Mittanck D.W. Kim S. Rotwein P. Mol. Endocrinol. 1995; 9: 1477-1487PubMed Google Scholar) revealed multiple transcription start sites (shown in Fig. 1A) and identified the E box containing proximal region of the promoter as the minimal region for driving transcription. Two E boxes corresponding to sites B and C (Fig. 1A) were found essential for strong promoter activ
Referência(s)