The Human Pathogen Streptococcus pyogenes Releases Lipoproteins as Lipoprotein-rich Membrane Vesicles
2015; Elsevier BV; Volume: 14; Issue: 8 Linguagem: Inglês
10.1074/mcp.m114.045880
ISSN1535-9484
AutoresMassimiliano Biagini, Manuela Garibaldi, Susanna Aprea, Alfredo Pezzicoli, Francesco Doro, Marco Becherelli, Anna Rita Taddei, Chiara Tani, Simona Tavarini, Marirosa Mora, Giuseppe Teti, Ugo D’Oro, Sandra Nuti, Marco Soriani, Immaculada Margarit, Rino Rappuoli, Guido Grandi, Nathalie Norais,
Tópico(s)Inflammasome and immune disorders
ResumoBacterial lipoproteins are attractive vaccine candidates because they represent a major class of cell surface-exposed proteins in many bacteria and are considered as potential pathogen-associated molecular patterns sensed by Toll-like receptors with built-in adjuvanticity. Although Gram-negative lipoproteins have been extensively characterized, little is known about Gram-positive lipoproteins. We isolated from Streptococcus pyogenes a large amount of lipoproteins organized in vesicles. These vesicles were obtained by weakening the bacterial cell wall with a sublethal concentration of penicillin. Lipid and proteomic analysis of the vesicles revealed that they were enriched in phosphatidylglycerol and almost exclusively composed of lipoproteins. In association with lipoproteins, a few hypothetical proteins, penicillin-binding proteins, and several members of the ExPortal, a membrane microdomain responsible for the maturation of secreted proteins, were identified. The typical lipidic moiety was apparently not necessary for lipoprotein insertion in the vesicle bilayer because they were also recovered from the isogenic diacylglyceryl transferase deletion mutant. The vesicles were not able to activate specific Toll-like receptor 2, indicating that lipoproteins organized in these vesicular structures do not act as pathogen-associated molecular patterns. In light of these findings, we propose to name these new structures Lipoprotein-rich Membrane Vesicles. Bacterial lipoproteins are attractive vaccine candidates because they represent a major class of cell surface-exposed proteins in many bacteria and are considered as potential pathogen-associated molecular patterns sensed by Toll-like receptors with built-in adjuvanticity. Although Gram-negative lipoproteins have been extensively characterized, little is known about Gram-positive lipoproteins. We isolated from Streptococcus pyogenes a large amount of lipoproteins organized in vesicles. These vesicles were obtained by weakening the bacterial cell wall with a sublethal concentration of penicillin. Lipid and proteomic analysis of the vesicles revealed that they were enriched in phosphatidylglycerol and almost exclusively composed of lipoproteins. In association with lipoproteins, a few hypothetical proteins, penicillin-binding proteins, and several members of the ExPortal, a membrane microdomain responsible for the maturation of secreted proteins, were identified. The typical lipidic moiety was apparently not necessary for lipoprotein insertion in the vesicle bilayer because they were also recovered from the isogenic diacylglyceryl transferase deletion mutant. The vesicles were not able to activate specific Toll-like receptor 2, indicating that lipoproteins organized in these vesicular structures do not act as pathogen-associated molecular patterns. In light of these findings, we propose to name these new structures Lipoprotein-rich Membrane Vesicles. Bacterial lipoproteins (Lpps)1 are a subset of membrane proteins that are covalently modified with a lipidic moiety at their N-terminal cysteine residue. It is commonly reported that Lpps of Gram-positive bacteria are processed by two key enzymes; the prolipoprotein diacylglyceryl transferase (Lgt) and the lipoprotein signal peptidase (Lsp). The Lgt enzyme recognizes a so-called lipobox motif in the C-terminal region of the signal peptide of a premature lipoprotein and transfers a diacylglyceryl moiety to the cysteine residue of the lipobox (1.von Heijne G. The structure of signal peptides from bacterial lipoproteins.Protein Eng. 1989; 2: 531-534Crossref PubMed Scopus (201) Google Scholar), (2.Sutcliffe I.C. Harrington D.J. Pattern searches for the identification of putative lipoprotein genes in Gram-positive bacterial genomes.Microbiology. 2002; 148: 2065-2077Crossref PubMed Scopus (141) Google Scholar). Subsequently, the Lsp enzyme cleaves the signal peptide resulting in a mature Lpp (3.Hussain M. Ichihara S. Mizushima S. Mechanism of signal peptide cleavage in the biosynthesis of the major lipoprotein of the Escherichia coli outer membrane.J. Biol. Chem. 1982; 257: 5177-5182Abstract Full Text PDF PubMed Google Scholar), (4.Sankaran K. Wu H.C. Lipid modification of bacterial prolipoprotein. Transfer of diacylglyceryl moiety from phosphatidylglycerol.J. Biol. Chem. 1994; 269: 19701-19706Abstract Full Text PDF PubMed Google Scholar). Nevertheless, recent reports have suggested that N-acylation occurs in bacteria that lack the Gram-negative homologous apolipoprotein N-acyltransferase (Lnt) gene responsible for this modification (5.Kurokawa K. Lee H. Roh K.B. Asanuma M. Kim Y.S. Nakayama H. Shiratsuchi A. Choi Y. Takeuchi O. Kang H.J. Dohmae N. Nakanishi Y. Akira S. Sekimizu K. Lee B.L. The triacylated ATP binding cluster transporter substrate-binding lipoprotein of staphylococcus aureus functions as a native ligand for toll-like receptor 2.J. Biol. Chem. 2009; 284: 8406-8411Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 6.Vidal-Ingigliardi D. Lewenza S. Buddelmeijer N. Identification of essential residues in apolipoprotein N-acyl transferase, a member of the CN hydrolase family.J. Bacteriol. 2007; 189: 4456-4464Crossref PubMed Scopus (40) Google Scholar), and that Lpp N-terminal could also be modified with an acetyl group in some Gram-positive (7.Kurokawa K. Ryu K.H. Ichikawa R. Masuda A. Kim M.S. Lee H. Chae J.H. Shimizu T. Saitoh T. Kuwano K. Akira S. Dohmae N. Nakayama H. Lee B.L. Novel bacterial lipoprotein structures conserved in low-GC content gram-positive bacteria are recognized by Toll-like receptor 2.J. Biol. Chem. 2012; 287: 13170-13181Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Lpps have been described as virulence factors because they play critical roles in membrane stabilization, nutrient uptake, antibiotic resistance, bacterial adhesion to host cells, protein maturation and secretion and many of them still have unknown function (8.Kovacs-Simon A. Titball R.W. Michell S.L. Lipoproteins of bacterial pathogens.Infect Immun. 2011; 79: 548-561Crossref PubMed Scopus (302) Google Scholar). Several studies have suggested that bacterial Lpps are pathogen-associated molecular patterns (PAMPs) sensed by the mammalian host through Toll-like receptor 2 (TLR2) heterodimerized with TLR1 or TLR6 to induce innate immunity activation and to control adaptive immunity (9.Alexopoulou L. Thomas V. Schnare M. Lobet Y. Anguita J. Schoen R.T. Medzhitov R. Fikrig E. Flavell R.A. Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice.Nat. Med. 2002; 8: 878-884Crossref PubMed Scopus (371) Google Scholar, 10.Ozinsky A. Underhill D.M. Fontenot J.D. Hajjar A.M. Smith K.D. Wilson C.B. Schroeder L. Aderem A. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors.Proc. Natl. Acad. Sci. U.S.A. 2000; 97: 13766-13771Crossref PubMed Scopus (1681) Google Scholar, 11.Takeuchi O. Kawai T. Muhlradt P.F. Morr M. Radolf J.D. Zychlinsky A. Takeda K. Akira S. Discrimination of bacterial lipoproteins by Toll-like receptor 6.Int. Immunol. 2001; 13: 933-940Crossref PubMed Scopus (1008) Google Scholar, 12.Takeuchi O. Sato S. Horiuchi T. Hoshino K. Takeda K. Dong Z. Modlin R.L. Akira S. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins.J. Immunol. 2002; 169: 10-14Crossref PubMed Scopus (1077) Google Scholar). TLR2 plays a critical role in the host response to the Gram-positive bacteria Staphylococcus aureus (13.Pietrocola G. Arciola C.R. Rindi S. Di Poto A. Missineo A. Montanaro L. Speziale P. Toll-like receptors (TLRs) in innate immune defense against Staphylococcus aureus.Int. J. Artif Organs. 2011; 34: 799-810Crossref PubMed Scopus (56) Google Scholar) and Streptococcus agalactiae (14.Henneke P. Dramsi S. Mancuso G. Chraibi K. Pellegrini E. Theilacker C. Hubner J. Santos-Sierra S. Teti G. Golenbock D.T. Poyart C. Trieu-Cuot P. Lipoproteins are critical TLR2 activating toxins in group B streptococcal sepsis.J. Immunol. 2008; 180: 6149-6158Crossref PubMed Scopus (109) Google Scholar). Although TLR2 has been considered a receptor for various structurally unrelated PAMPs, recent studies have suggested that, via their lipid moiety, bacterial Lpps function as the major, if not the sole, ligand molecules responsible for TLR2 activation (15.Hashimoto M. Tawaratsumida K. Kariya H. Kiyohara A. Suda Y. Krikae F. Kirikae T. Gotz F. Not lipoteichoic acid but lipoproteins appear to be the dominant immunobiologically active compounds in Staphylococcus aureus.J. Immunol. 2006; 177: 3162-3169Crossref PubMed Scopus (198) Google Scholar). Although Gram-negative Lpps have been widely studied, little information is available for Gram-positive Lpps (16.Hutchings M.I. Palmer T. Harrington D.J. Sutcliffe I.C. Lipoprotein biogenesis in Gram-positive bacteria: knowing when to hold 'em, knowing when to fold 'em.Trends Microbiol. 2009; 17: 13-21Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar) and the ways they are released into the bacterial extracellular compartment and reach the host immune system remain unclear. We focused our attention on Lpps release by Streptococcus pyogenes. This Gram-positive bacterium is an important human pathogen that causes a wide range of diseases from superficial and self-limiting infection, e.g. pharyngitis and impetigo, to more systemic or invasive diseases like necrotizing fasciitis and septicemia (17.Langlois D.M. Andreae M. Group A streptococcal infections.Pediatr. Rev. 2011; 32: 423-429Crossref PubMed Scopus (30) Google Scholar). Understanding the role of bacterial Lpps in mediating innate and acquired immunity can be instrumental for the therapy and prophylaxis of human S. pyogenes infections. In this study, we showed that in S. pyogenes Lpps are released into the growth medium within vesicle-like structures in minute amounts. Conditions weakening the bacterial cell wall, such as the addition of sublethal concentrations of penicillin to the bacterial growth medium enhanced this phenomenon and allowed the recovery of sufficient material to enable an in-depth characterization. Proteomic analysis of the vesicles revealed that they were almost exclusively constituted of Lpps. A total of 28 Lpps were identified, representing more than 72% of the Lpps predicted from the genome of the strain under investigation. In addition, multiple transmembrane domain proteins were not found in abundance associated to the vesicles, indicating that vesicles were not representative of the bacterial membrane. We defined these vesicles as Lipoprotein-rich Membrane Vesicles (LMVs). Common characteristics are shared between the LMVs and the ExPortal described for the first time by Rosch and Caparon (18.Rosch J.W. Caparon M.G. The ExPortal: an organelle dedicated to the biogenesis of secreted proteins in Streptococcus pyogenes.Mol. Microbiol. 2005; 58: 959-968Crossref PubMed Scopus (83) Google Scholar). This asymmetric and distinct membrane microdomain has been reported to be enriched in anionic phospholipids and acts in promoting the biogenesis of secreted proteins by coordinating interactions between nascent unfolded secretory proteins and the accessory factors required for their maturation (19.Kline K.A. Kau A.L. Chen S.L. Lim A. Pinkner J.S. Rosch J. Nallapareddy S.R. Murray B.E. Henriques-Normark B. Beatty W. Caparon M.G. Hultgren S.J. Mechanism for sortase localization and the role of sortase localization in efficient pilus assembly in Enterococcus faecalis.J. Bacteriol. 2009; 191: 3237-3247Crossref PubMed Scopus (71) Google Scholar, 20.Rosch J.W. Hsu F.F. Caparon M.G. Anionic lipids enriched at the ExPortal of Streptococcus pyogenes.J. Bacteriol. 2007; 189: 801-806Crossref PubMed Scopus (49) Google Scholar, 21.Lyon W.R. Caparon M.G. Role for serine protease HtrA (DegP) of Streptococcus pyogenes in the biogenesis of virulence factors SpeB and the hemolysin streptolysin S.Infect. Immun. 2004; 72: 1618-1625Crossref PubMed Scopus (82) Google Scholar). An association between ExPortal and peptidoglycan synthesis has also been reported (22.Vega L.A. Port G.C. Caparon M.G. An association between peptidoglycan synthesis and organization of the Streptococcus pyogenes ExPortal.mBio. 2013; 4: e00485-00413Crossref PubMed Scopus (13) Google Scholar). Similarly, LMVs are enriched in anionic phosphatidylglycerol, enzymes involved in protein maturation/secretion and cell wall biogenesis, suggesting that LMVs might derive from the ExPortal. Finally, we showed that LMVs do not induce TLR2 activation, indicating that the Lpps did not act as PAMPs when integrated into the LMVs. M1–3348 S. pyogenes strain was provided by the Istituto Superiore di Sanità, Rome, Italy, M1-SF370 by ATCC, M6-S43 by Laboratory of Bacterial Pathogenesis and Immunology, Rockefeller University, New York, M28-HRO-K-06 by University of Rostock. Other strains were available in house. In-frame deletion mutant of M1–3348 S. pyogenes strain lacking the lgt gene (Δlgt) was constructed by splicing-by-overlapping-extension PCR. Briefly, in frame deleted gene product was amplified using the following specific primers: LGT-F1 tcgcggatccAATTATTGAAATTCAGAGATCTT, LGT-R2 AAATGTAACACCTGTTGGATTACTTACAAGAACTGCTGATAA, LGT-F3 TTATCGCAGTTCTTGTAAGTAATCCAACAGGTGTTACATTT, LGT-R4 tggcgagctcTGAATATTATCAAGTGCTGGT. The PCR product was cloned using BamHI and XhoI restriction sites in the temperature-sensitive vector pJRS233 (23.Perez-Casal J. Price J.A. Maguin E. Scott J.R. An M protein with a single C repeat prevents phagocytosis of Streptococcus pyogenes: use of a temperature-sensitive shuttle vector to deliver homologous sequences to the chromosome of S. pyogenes.Mol. Microbiol. 1993; 8: 809-819Crossref PubMed Scopus (187) Google Scholar). Transformation and allelic exchange was performed under selective pressure and drug sensitive colonies were screened by PCR for the absence of the target allele. S. pyogenes wild type strain and the respective isogenic Δlgt mutant were grown in TSB or CDM medium at 37 °C, in a rotary shaker, to reach OD600 = 0.4, whereas S. agalactiae was grown in THB medium. From liquid cultures, bacteria were either collected by 10 min centrifugation at 4000 × g, or bacteria were treated with penicillin by addition of the same volume of medium containing penicillin at the concentration of 0.7 μg/ml for 80 min, unless specified. Culture media of wild type and Δlgt strains were filtered through a 0.22-μm pore size filter (Millipore, Bedford, MA). The filtrates were subjected to high-speed centrifugation (200,000 × g for 90 min), and the pellets containing the vesicles were washed with PBS, centrifuged again at the same conditions and finally resuspended with PBS. Vesicles were fixed overnight in 2.5% (v/v) glutaraldehyde in PBS and then washed and resuspended in the same buffer. A drop of suspension was placed on Formvar/carbon-coated grids, and vesicles were adsorbed for 5 min. Grids were then washed with distilled water and blotted with a filter paper. For negative staining, grids were treated with 2% (w/v) uranyl acetate for 1 min, air-dried, and viewed with a JEM 1200 EX II transmission electron microscope (Jeol, Peabody, MA) operating at 80 kV. Vesicles were denatured for 10 min at 95 °C in Laemli buffer. 20 μg of proteins were loaded onto 4–12% (w/v) polyacrylamide gradient gels (Life Technologies, Carlsbad, CA). Gels were run in MOPS buffer (Life Technologies) and stained with Coomassie Blue R-250. Protein bands were excised from the gels, washed with 50 mm ammonium bicarbonate (Fluka Chemie AG, Buchs, Switzerland), MS-grade acetonitrile (Sigma-Aldrich, St. Louis, MO) (1:1, v/v), washed once with pure acetonitrile, and air-dried. Dried spots were digested for 18 h at 37 °C in 20 μl of 5 mm ammonium bicarbonate and 12 ng/μl sequencing grade modified trypsin (Promega, Madison, WI). After digestion, 0.6 μl were spotted onto a matrix PAC target (Prespotted AnchorChip 96, set for proteomics, Bruker Daltonics, Bremen, Germany) and air-dried. Spots were washed with 0.6 μl of 70% ethanol, 0.1% trifluoroacetic acid. Mass spectra were acquired on an Ultraflex MALDI-TOF/TOF mass spectrometer (Bruker Daltonics) in reflectron, positive mode in the mass range of 700–3500 m/z. Spectra were externally calibrated by using a combination of standards prespotted on the target. MS spectra were analyzed with FlexAnalysis (version 2.4, Bruker Daltonics) using default parameters and manually revised. Peptides were separated by nano LC on a nanoAcquity UPLC system (Waters, Milford, MA) connected to an ESI Q-TOF Premier mass spectrometer equipped with a nanospray source (Waters). Samples were loaded onto a nanoAcquity 1.7 μm BEH130 C18 column (75 μm x 25 mm; Waters) through a nanoAcquity 5 μm Symmetry C18 trap column (180 μm x 20 mm; Waters). Peptides were eluted with a 120 min gradient of a 2–40% of 98% acetonitrile, 0.1% formic acid solution at a flow rate of 250 nl/min. The eluted peptides were subjected to an automated data-dependent acquisition using the MassLynx software, version 4.1 (Waters) where an MS survey scan was used to automatically select multicharged peptides over the m/z ratio range of 300–2000 for further MS/MS fragmentation. Up to four different ions were individually subjected to MS/MS fragmentation following each MS survey scan. After data acquisition, individual MS/MS spectra were combined, smoothed, and centroided using ProteinLynxGLobal Server, version 2.5 (Waters) to obtain the peak list file. Protein identification was carried out from the generated peak list using the Mascot software (version 2.2.03, Matrix Science Inc., Boston, MA). Mascot was run on a custom database comprising public S. pyogenes database and internal annotated S. pyogenes genomes (56,403 sequences; 16,305,282 residues). Search parameters were as follows: cleavage by trypsin; missed cleavage, 1; oxidation (M) and deamidation (N,Q) as variable modification (mass tolerance, 100 ppm and 0.2 Da (for MALDI and ESI-Q-TOF analysis, respectively). Identifications were considered when the Mowse score (24.Perkins D.N. Pappin D.J. Creasy D.M. Cottrell J.S. Probability-based protein identification by searching sequence databases using mass spectrometry data.Electrophoresis. 1999; 20: 3551-3567Crossref PubMed Scopus (6772) Google Scholar) was significant according to Mascot output (equal or greater than 34 for the searches of this study). Peptide counts were defined as the number of unique peptides identified for a single protein with significant Mowse scores. Known contaminant signals (from keratins and trypsin) were manually excluded from MALDI spectra. Re-annotation of M1-SF370 genome, using Glimmer version 3.0.2 compared with the original annotation (25.Ferretti J.J. McShan W.M. Ajdic D. Savic D.J. Savic G. Lyon K. Primeaux C. Sezate S. Suvorov A.N. Kenton S. Lai H.S. Lin S.P. Qian Y. Jia H.G. Najar F.Z. Ren Q. Zhu H. Song L. White J. Yuan X. Clifton S.W. Roe B.A. McLaughlin R. Complete genome sequence of an M1 strain of Streptococcus pyogenes.Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 4658-4663Crossref PubMed Scopus (776) Google Scholar) was performed to find proteins eventually missed or not classified as Lpps because of errors in the assignment of the initial start codon. In silico predictions with different algorithms (PSORT (26.Nakai K. Horton P. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization.Trends Biochem. Sci. 1999; 24: 34-36Abstract Full Text Full Text PDF PubMed Scopus (1828) Google Scholar), LipoP (27.Juncker A.S. Willenbrock H. Von Heijne G. Brunak S. Nielsen H. Krogh A. Prediction of lipoprotein signal peptides in Gram-negative bacteria.Protein Sci. 2003; 12: 1652-1662Crossref PubMed Scopus (890) Google Scholar) DOLOP (28.Madan Babu M. Sankaran K. DOLOP – database of bacterial lipoproteins.Bioinformatics. 2002; 18: 641-643Crossref PubMed Scopus (102) Google Scholar), PredLipo (29.Bagos P.G. Tsirigos K.D. Liakopoulos T.D. Hamodrakas S.J. Prediction of lipoprotein signal peptides in Gram-positive bacteria with a Hidden Markov Model.J. Proteome Res. 2008; 7: 5082-5093Crossref PubMed Scopus (100) Google Scholar)) or bibliographic reference (30.Lei B. Liu M. Chesney G.L. Musser J.M. Identification of new candidate vaccine antigens made by Streptococcus pyogenes: purification and characterization of 16 putative extracellular lipoproteins.J. Infect. Dis. 2004; 189: 79-89Crossref PubMed Scopus (67) Google Scholar), as reported in Table I, were used to include all the possible Lpps. PSORTb version 3.0.2 was used for the prediction of protein cellular compartment (http://www.psort.org/psortb/) (31.Yu N.Y. Wagner J.R. Laird M.R. Melli G. Rey S. Lo R. Dao P. Sahinalp S.C. Ester M. Foster L.J. Brinkman F.S. PSORTb 3.0: improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes.Bioinformatics. 2010; 26: 1608-1615Crossref PubMed Scopus (1563) Google Scholar).Table IList of software and bibliographic reference used for Lpp predictionLipoprotein prediction toolsPublication yearPSORT 1999G+LPP 2002LipoP 2003Lei B et al. 2004DOLOP 2006PredLipo 2008Number of predicted Lpps292833333133CommentsFirst Version of PsortApplication of a revised version of Prosite PS0013Good performaces for Gram positive, although trained against Gram negativeManual revision of localization prediction from existing softwareAvailable linkPSORThttp://psort.hgc.jp/form.htmlLipoPhttp://www.cbs.dtu.dk/services/LipoP/DOLOPhttp://www.mrc-lmb.cam.ac.uk/genomes/dolop/PredLipohttp://biophysics.biol.uoa.gr/PRED-LIPO/ Open table in a new tab Western blot was carried out on 0.22-μm filtered total culture supernatant, ultracentrifuged supernatant (secreted proteins), and pellet from ultracentrifuged supernatant (vesicles). 200 ml of culture supernatant were filtered to remove residual bacterial cells. Fifteen microliters were collected for subsequent SDS-PAGE analysis. The remaining material was ultracentrifuged at 200,000 × g for 90 min. After ultracentrifugation, the pellet was resuspended in 200 μl of PBS. Fifteen microliters of the ultracentrifuged supernatant and the resuspended pellet were resolved by SDS-PAGE run in MOPS buffer and transferred onto nitrocellulose membrane (Bio-Rad, Hercules, CA). After membrane saturation in PBS containing 3% (w/v) powdered milk, the membranes were incubated, with mice polyclonal antisera (1:1000 dilution) in PBS containing 3% (w/v) powdered milk for 90 min at 37 °C. Mouse polyclonal antisera were raised from mouse immunized with recombinant forms of three Lpps: the putative protease maturation protein (SPy1390), the acid phosphatase (SPy1882) and the surface lipoprotein (SPy2000), available from our S. pyogenes vaccine discovery program (32.Bensi G. Mora M. Tuscano G. Biagini M. Chiarot E. Bombaci M. Capo S. Falugi F. Manetti A.G. Donato P. Swennen E. Gallotta M. Garibaldi M. Pinto V. Chiappini N. Musser J.M. Janulczyk R. Mariani M. Scarselli M. Telford J.L. Grifantini R. Norais N. Margarit I. Grandi G. Multi high-throughput approach for highly selective identification of vaccine candidates: the group a streptococcus case.Mol. Cell. Proteomics. 2012; 11M111.015693Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Membranes were washed three times with PBS containing 0.1% (v/v) Tween-20 and then incubated with sheep anti-mouse horseradish peroxidase-conjugated IgG (GE Healthcare, Little Chalfont, Buckinghamshire, UK) (1:7500 diluted) in PBS containing 3% (w/v) powdered milk. Signals from probed blot were developed with SuperSignal West Pico Chemiluminescent Substrate kit (Pierce, Rockford, IL) as described by the manufacturer. S. pyogenes LMVs were visualized by standard immunofluorescence procedures. Briefly, paraformaldehyde was added to the LMV preparation to a final concentration of 2% (v/v) and fixed for 20 min at room temperature onto POLYSINETM slides (Menzel-Glaser, Braunschweig, Germany). The slides were then washed and blocked with PBS containing 10% (v/v) normal goat serum and 3% (w/v) BSA (Sigma-Aldrich) for 30 min and incubated with a mouse polyclonal antiSPy1390 serum (1:500 dilution) and with 10-n-nonyl acridine orange (Sigma-Aldrich; 400 nm final concentration) diluted in PBS with 1% (w/v) BSA for 15 min at room temperature. The slides were then washed and stained with goat anti-mouse IgG Alexa Fluor 647-conjugated antibodies (Life Technologies, 1:1000 dilution) for 10 min at room temperature. ProLong Gold Antifade reagent (Life Technologies) was used to mount coverslips. The slides were analyzed with a Zeiss Observer LSM 710 confocal scanning microscope (Zeiss, Oberkochen, Germany). Lipids were extracted from S. pyogenes total extract obtained after mechanical lysis of the bacteria or from the purified LMVs following the Bligh and Dyer protocol (33.Bligh E.G. Dyer W.J. A rapid method of total lipid extraction and purification.Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (42828) Google Scholar) using a solution of water/chloroform/methanol (0.9/1/1; v/v/v). Dried lipids were resuspended in 100 μl of chloroform and 2 μl were loaded onto a TLC silica gel plates (Merk-Millipore, Billerica, MA). Lipids were vertically resolved in a TLC chamber saturated by a solution of chloroform/ethanol/water/triethylamine (35/35/7/35; v/v/v/v). Lipids were stained with a nebulization of 0.05% (w/v) primulin (Sigma) in 1:1 acetone/water (v/v) and visualized by UV lamp. Lipid standards (Sigma) were: PA, l-α-phosphatidic acid; PE, 3-sn-phosphatidylethanolamine; S, sphingomyelin; PC, l-α-phosphatidylcholine; PG, l-α-phosphatidyl-dl-glycerol; LC, l-α-lysophosphatidylcholine; PS, 1,2-diacyl-sn-glycero-3-phospho-l-serine. M1–3348 S. pyogenes strain grown in THB until midexponential phase was harvested and resuspended in 3 m guanidinium chloride, 25 mm Tris, pH 8.5 (lysis buffer), and mechanically disrupted in FastPrep® FP120 Bead Beater (Qbiogene, Inc., Carlsbad, CA) by seven cycles of 1 min. Unbroken cells and cellular debris were pelleted and discarded by 10 min of centrifugation at 4000 × g at 4 °C. The supernatant was then high-speed centrifuged at 200,000 × g for 3 h and the resulting pellet was analyzed by SDS-PAGE as reported above. The recombinant forms of the Lpps were cloned without the presequence and with a C-terminal His-tag as reported in Bensi et al. (32.Bensi G. Mora M. Tuscano G. Biagini M. Chiarot E. Bombaci M. Capo S. Falugi F. Manetti A.G. Donato P. Swennen E. Gallotta M. Garibaldi M. Pinto V. Chiappini N. Musser J.M. Janulczyk R. Mariani M. Scarselli M. Telford J.L. Grifantini R. Norais N. Margarit I. Grandi G. Multi high-throughput approach for highly selective identification of vaccine candidates: the group a streptococcus case.Mol. Cell. Proteomics. 2012; 11M111.015693Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). The recombinant proteins were purified to homogeneity and used to immunize mice as previously described (34.Rodriguez-Ortega M.J. Norais N. Bensi G. Liberatori S. Capo S. Mora M. Scarselli M. Doro F. Ferrari G. Garaguso I. Maggi T. Neumann A. Covre A. Telford J.L. Grandi G. Characterization and identification of vaccine candidate proteins through analysis of the group A Streptococcus surface proteome.Nat. Biotechnol. 2006; 24: 191-197Crossref PubMed Scopus (361) Google Scholar). Preparation of immune sera was performed as previously described (34.Rodriguez-Ortega M.J. Norais N. Bensi G. Liberatori S. Capo S. Mora M. Scarselli M. Doro F. Ferrari G. Garaguso I. Maggi T. Neumann A. Covre A. Telford J.L. Grandi G. Characterization and identification of vaccine candidate proteins through analysis of the group A Streptococcus surface proteome.Nat. Biotechnol. 2006; 24: 191-197Crossref PubMed Scopus (361) Google Scholar). Vesicles were washed twice with PBS, suspended in newborn calf serum (NCS, Sigma), incubated for 20 min at room temperature and dispensed into a 96-well plate (20 μl/well). Eighty μl of pre-immune or immune mouse sera, diluted in PBS containing 0.1% (w/v) BSA, were added to the bacterial suspension to a final dilution of 1:200 and incubated on ice for 30 min. After washing twice with 0.1% (w/v) BSA in PBS, bacteria were incubated on ice for 30 min in 10 ml of goat anti-mouse IgG, F(ab')2 fragment-specific-R, phycoerythrin-conjugated (Jackson Immunoresearch Laboratories Inc., West Grove, PA) diluted 100-fold in PBS containing 0.1% (w/v) BSA, 20% (v/v) NCS. After incubation, bacteria were washed with PBS containing 0.1% (w/v) BSA, suspended in 200 μl PBS and analyzed using a FACS Calibur cytometer (Becton Dickinson, Franklin Lakes, NJ) and Cell Quest Software (Becton Dickinson). HEK293-NF-kB-Luc cells (clone LP58), a cell line stably transfected with a reporter vector in which the luciferase gene is under the control of an NF-kB dependent promoter, were previously produced by Cell and Molecular Technologies (CMT Inc., Phillipsburg, NJ) for Chiron Corporation under a service contract. These cells were transfected using Lipofectamine 2000 (Life Technologies) with pcDNA3.1-Hygro-FLAG-hTLR2 plasmid encoding for human TLR2 containing a FLAG epitope at the N terminus and a hygromycin resistance gene for selection. Transfected cells were cultured in the presence of hygromycin (250 μg/ml) and individual resistant clones were picked, expanded, and tested for expression of luciferase upon stimulation with the TLR2 agonist PAM3CSK4. The best responding clone was then selected for experiments. For luciferase assay HEK293-FLAG-hTLR2-NF-kB-Luc cells (25 × 103 cells/well) were seeded into microclear 96-well flat bottom plates in 90 μl of complete me
Referência(s)