Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia
2010; Elsevier BV; Volume: 51; Issue: 9 Linguagem: Inglês
10.1194/jlr.m003392
ISSN1539-7262
AutoresSaša Štefanić, Cornelia Spycher, Laura Morf, Gemma Fabriàs, Josefina Casas, Elisabeth M. Schraner, Peter J. Wild, Adrian B. Hehl, Sabrina Sonda,
Tópico(s)Toxoplasma gondii Research Studies
ResumoSynthesis of glucosylceramide via glucosylceramide synthase (GCS) is a crucial event in higher eukaryotes, both for the production of complex glycosphingolipids and for regulating cellular levels of ceramide, a potent antiproliferative second messenger. In this study, we explored the dependence of the early branching eukaryote Giardia lamblia on GCS activity. Biochemical analyses revealed that the parasite has a GCS located in endoplasmic reticulum (ER) membranes that is active in proliferating and encysting trophozoites. Pharmacological inhibition of GCS induced aberrant cell division, characterized by arrest of cytokinesis, incomplete cleavage furrow formation, and consequent block of replication. Importantly, we showed that increased ceramide levels were responsible for the cytokinesis arrest. In addition, GCS inhibition resulted in prominent ultrastructural abnormalities, including accumulation of cytosolic vesicles, enlarged lysosomes, and clathrin disorganization. Moreover, anterograde trafficking of the encystations-specific protein CWP1 was severely compromised and resulted in inhibition of stage differentiation. Our results reveal novel aspects of lipid metabolism in G. lamblia and specifically highlight the vital role of GCS in regulating cell cycle progression, membrane trafficking events, and stage differentiation in this parasite. In addition, we identified ceramide as a potent bioactive molecule, underscoring the universal conservation of ceramide signaling in eukaryotes. Synthesis of glucosylceramide via glucosylceramide synthase (GCS) is a crucial event in higher eukaryotes, both for the production of complex glycosphingolipids and for regulating cellular levels of ceramide, a potent antiproliferative second messenger. In this study, we explored the dependence of the early branching eukaryote Giardia lamblia on GCS activity. Biochemical analyses revealed that the parasite has a GCS located in endoplasmic reticulum (ER) membranes that is active in proliferating and encysting trophozoites. Pharmacological inhibition of GCS induced aberrant cell division, characterized by arrest of cytokinesis, incomplete cleavage furrow formation, and consequent block of replication. Importantly, we showed that increased ceramide levels were responsible for the cytokinesis arrest. In addition, GCS inhibition resulted in prominent ultrastructural abnormalities, including accumulation of cytosolic vesicles, enlarged lysosomes, and clathrin disorganization. Moreover, anterograde trafficking of the encystations-specific protein CWP1 was severely compromised and resulted in inhibition of stage differentiation. Our results reveal novel aspects of lipid metabolism in G. lamblia and specifically highlight the vital role of GCS in regulating cell cycle progression, membrane trafficking events, and stage differentiation in this parasite. In addition, we identified ceramide as a potent bioactive molecule, underscoring the universal conservation of ceramide signaling in eukaryotes. Sphingolipids are a highly complex class of lipids in terms of structural diversity, metabolism, and cellular functions. While initially seen as inert structural components of eukaryotic cell membranes, there is now substantial evidence that sphingolipids play an important role in signal transduction. (For a recent review on bioactive sphingolipids, see Ref. 1Bartke N. Hannun Y.A. Bioactive sphingolipids: metabolism and function.J. Lipid Res. 2009; 50: S91-S96Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar.) Ceramide, a central molecule in the sphingolipid biosynthesis, plays a critical role as second messenger in cellular signaling that regulates antiproliferative processes, including apoptosis, cell differentiation, and cell cycle arrest in different cell types. Levels of ceramide, a highly bioactive molecule, must be tightly controlled by diverse, coordinated mechanisms, including ceramide degradation, phosphorylation, or sphingolipid metabolism. Glucosylceramide synthase (GCS), also defined as ceramide glucosyltransferase (CGT), metabolizes ceramide to glucosylceramide (GlcCer), a glycosylated form of ceramide that does not have antiproliferative activity. GCS plays a crucial role in cell survival after apoptotic stimuli, as demonstrated by the upregulation of GCS and GlcCer in some multidrug resistant tumor cells to counteract a chemotherapy-induced increase of ceramide (2Liu Y.Y. Han T.Y. Giuliano A.E. Cabot M.C. Ceramide glycosylation potentiates cellular multidrug resistance.FASEB J. 2001; 15: 719-730Crossref PubMed Scopus (255) Google Scholar, 3Lucci A. Cho W.I. Han T.Y. Giuliano A.E. Morton D.L. Cabot M.C. Glucosylceramide: a marker for multiple-drug resistant cancers.Anticancer Res. 1998; 18: 475-480PubMed Google Scholar). Conversely, decreased GCS activity by RNA interference or by pharmacological inhibition of GCS activity with PPMP (DL-threo-1-Phenyl-2-palmitoylamino-3-morpholino-1-propanol) leads to ceramide buildup and cytotoxicity (4Liu Y.Y. Han T.Y. Yu J.Y. Bitterman A. Le A. Giuliano A.E. Cabot M.C. Oligonucleotides blocking glucosylceramide synthase expression selectively reverse drug resistance in cancer cells.J. Lipid Res. 2004; 45: 933-940Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 5Bleicher R.J. Cabot M.C. Glucosylceramide synthase and apoptosis.Biochim. Biophys. Acta. 2002; 1585: 172-178Crossref PubMed Scopus (119) Google Scholar). Thus, GCS is considered a pivotal regulator of bioactive ceramide levels. Sphingolipid metabolism in pathogenic protozoa is the object of increasing interest as a source of promising chemotherapy targets. We recently showed that PPMP has a potent inhibitory effect on Giardia lamblia (6Sonda S. Stefanic S. Hehl A.B. A sphingolipid inhibitor induces a cytokinesis arrest and blocks stage differentiation in Giardia lamblia.Antimicrob. Agents Chemother. 2008; 52: 563-569Crossref PubMed Scopus (21) Google Scholar), a protozoan parasite that has undergone massive minimization during evolution (7Morrison H.G. McArthur A.G. Gillin F.D. Aley S.B. Adam R.D. Olsen G.J. Best A.A. Cande W.Z. Chen F. Cipriano M.J. et al.Genomic minimalism in the early diverging intestinal parasite Giardia lamblia.Science. 2007; 317: 1921-1926Crossref PubMed Scopus (604) Google Scholar) and that is a leading cause of intestinal infection worldwide (8Savioli L. Smith H. Thompson A. Giardia and Cryptosporidium join the 'Neglected Diseases Initiative'.Trends Parasitol. 2006; 22: 203-208Abstract Full Text Full Text PDF PubMed Scopus (605) Google Scholar). Both stages of the parasite's life cycle, namely, replicating trophozoites, which are responsible for pathogenesis, and environmentally resistant cysts, which are responsible for disease transmission, were affected by PPMP at concentrations that are not toxic for mammalian cells. The observed sensitivity to PPMP suggested that an active GCS may exist in the parasite; in addition, a GCS homolog, GL50803_11642, is annotated in the G. lamblia Genome Database (http://giardiadb.org), and its transcription has been reported to be regulated during the parasite's life cycle (9Hernandez Y. Shpak M. Duarte T.T. Mendez T.L. Maldonado R.A. Roychowdhury S. Rodrigues M.L. Das S. Novel role of sphingolipid synthesis genes in regulating giardial encystation.Infect. Immun. 2008; 76: 2939-2949Crossref PubMed Scopus (26) Google Scholar). Moreover, the predicted ORF GL50803_7598 contains a domain typical of the glycolipid transfer protein (GLTP) superfamily. While the precise cellular function of GLTP remains undefined, a proposed correlation between the presence of GLTP and GCS activity (10Mattjus P. Glycolipid transfer proteins and membrane interaction.Biochim. Biophys. Acta. 2009; 1788: 267-272Crossref PubMed Scopus (57) Google Scholar) further supports the presence of active GCS in the parasite. However, the synthesis of sphingolipids and of GlcCer in particular has not been demonstrated in the parasite so far. Lipid neosynthesis is limited in G. lamblia, and the parasite is thought to rely on lipids taken up from the environment, namely, the host intestinal content. Indeed, in vitro analyses showed negligible incorporation of lipid precursors, such as acetate and glycerol (11Jarroll E.L. Muller P.J. Meyer E.A. Morse S.A. Lipid and carbohydrate metabolism of Giardia lamblia.Mol. Biochem. Parasitol. 1981; 2: 187-196Crossref PubMed Scopus (83) Google Scholar), while robust incorporation of exogenous radiolabeled fatty acids (12Stevens T.L. Gibson G.R. Adam R. Maier J. Allison-Ennis M. Das S. Uptake and cellular localization of exogenous lipids by Giardia lamblia, a primitive eukaryote.Exp. Parasitol. 1997; 86: 133-143Crossref PubMed Scopus (36) Google Scholar, 13Blair R.J. Weller P.F. Uptake and esterification of arachidonic acid by trophozoites of Giardia lamblia.Mol. Biochem. Parasitol. 1987; 25: 11-18Crossref PubMed Scopus (16) Google Scholar, 14Gibson G.R. Ramirez D. Maier J. Castillo C. Das S. Giardia lamblia: incorporation of free and conjugated fatty acids into glycerol-based phospholipids.Exp. Parasitol. 1999; 92: 1-11Crossref PubMed Scopus (23) Google Scholar), phospholipids (14Gibson G.R. Ramirez D. Maier J. Castillo C. Das S. Giardia lamblia: incorporation of free and conjugated fatty acids into glycerol-based phospholipids.Exp. Parasitol. 1999; 92: 1-11Crossref PubMed Scopus (23) Google Scholar), ceramide, and gangliosides (15Hernandez Y. Castillo C. Roychowdhury S. Hehl A. Aley S.B. Das S. Clathrin-dependent pathways and the cytoskeleton network are involved in ceramide endocytosis by a parasitic protozoan, Giardia lamblia.Int. J. Parasitol. 2007; 37: 21-32Crossref PubMed Scopus (39) Google Scholar, 16Pope-Delatorre H. Das S. Irwin L.N. Uptake of [3H]-gangliosides by an intestinal protozoan, Giardia lamblia.Parasitol. Res. 2005; 96: 102-106Crossref PubMed Scopus (4) Google Scholar) could be demonstrated. In addition, uptake of fluorescent sphingolipid analogs, including ceramide and sphingomyelin, has been reported (12Stevens T.L. Gibson G.R. Adam R. Maier J. Allison-Ennis M. Das S. Uptake and cellular localization of exogenous lipids by Giardia lamblia, a primitive eukaryote.Exp. Parasitol. 1997; 86: 133-143Crossref PubMed Scopus (36) Google Scholar, 14Gibson G.R. Ramirez D. Maier J. Castillo C. Das S. Giardia lamblia: incorporation of free and conjugated fatty acids into glycerol-based phospholipids.Exp. Parasitol. 1999; 92: 1-11Crossref PubMed Scopus (23) Google Scholar, 15Hernandez Y. Castillo C. Roychowdhury S. Hehl A. Aley S.B. Das S. Clathrin-dependent pathways and the cytoskeleton network are involved in ceramide endocytosis by a parasitic protozoan, Giardia lamblia.Int. J. Parasitol. 2007; 37: 21-32Crossref PubMed Scopus (39) Google Scholar). Importantly, acyl chain desaturation (17Ellis J.E. Wyder M.A. Jarroll E.L. Kaneshiro E.S. Changes in lipid composition during in vitro encystation and fatty acid desaturase activity of Giardia lamblia.Mol. Biochem. Parasitol. 1996; 81: 13-25Crossref PubMed Scopus (38) Google Scholar), deacylation/reacylation, and head group exchange (18Das S. Castillo C. Stevens T. Phospholipid remodeling/generation in Giardia: the role of the Lands cycle.Trends Parasitol. 2001; 17: 316-319Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar) have been shown to occur in G. lamblia, indicating that the parasite can remodel the incorporated exogenous lipids to fulfill its own needs. In this study, we used a biochemical approach to address whether the synthesis of GlcCer occurs in G. lamblia and whether it can be inhibited by PPMP. In addition, we investigated the molecular mechanism of PPMP-mediated effects in more detail and identified ceramide as a key modulator of cellular processes in this parasite. Unless otherwise stated, all chemicals were purchased from Sigma and cell culture reagents from Gibco-BRL. Inhibitor stock solutions were prepared at the following concentrations: 10 mM DL-threo-1-Phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP), 14 mM fumonisin B1 (FB1), 5 mM myriocin (Myr), 250 mM L-cycloserine (L-cyc), 22.5 mM N-butyldeoxynojirimycin (NB-DNJ), 3 mM tunicamycin (TM), 16.6 mM nocodazole, and 20 mg/ml puromycin. Inhibitors were freshly diluted to the concentrations required for the individual experiment. Trophozoites of the Giardia lamblia strain WBC6 (ATCC catalog number 50803) were grown axenically as described (6Sonda S. Stefanic S. Hehl A.B. A sphingolipid inhibitor induces a cytokinesis arrest and blocks stage differentiation in Giardia lamblia.Antimicrob. Agents Chemother. 2008; 52: 563-569Crossref PubMed Scopus (21) Google Scholar). Harvested parasites were counted using the improved Neubauer chamber. New subcultures were obtained by inoculating 5 × 104 trophozoites from confluent cultures into new 11 ml culture tubes. Two-step encystation was induced as described previously (19Hehl A.B. Marti M. Kohler P. Stage-specific expression and targeting of cyst wall protein-green fluorescent protein chimeras in Giardia.Mol. Biol. Cell. 2000; 11: 1789-1800Crossref PubMed Scopus (85) Google Scholar, 20Gillin F.D. Boucher S.E. Rossi S.S. Reiner D.S. Giardia lamblia: the roles of bile, lactic acid, and pH in the completion of the life cycle in vitro.Exp. Parasitol. 1989; 69: 164-174Crossref PubMed Scopus (103) Google Scholar) by cultivating the cells for ∼44 h in medium without bile (pre-encysting medium) and subsequently in medium with higher pH and porcine bile (encysting medium). Drug treatment of trophozoites was performed on freshly inoculated subcultures. Parasites were allowed to adhere for 8 h and then incubated for additional 16 h with the inhibitors at the concentrations indicated in the figure legend of the individual experiments. Drug treatment of encysting cells was performed in two steps: 7 h drug incubation in pre-encysting medium and additional 16 h incubation in encysting medium. For replication and doublet formation assay, cells were harvested and counted as described above. For reversibility assay, freshly inoculated subcultures were incubated with the inhibitor for 16 h as described above, harvested, and washed to remove the drug. Collected parasites were then counted and reinoculated in absence of inhibitor for an additional 4 days, followed by counting. All constructs of giardial glucosylceramide synthase (GCS) (GL50803_11642) were based on the expression cassette C1-CWP for inducible expression under the control of the CWP1 promoter (19Hehl A.B. Marti M. Kohler P. Stage-specific expression and targeting of cyst wall protein-green fluorescent protein chimeras in Giardia.Mol. Biol. Cell. 2000; 11: 1789-1800Crossref PubMed Scopus (85) Google Scholar). For N-terminal tagging with the hemagglutinin (HA) epitope, full length GCS (aa 2–537) and variant without putative signal peptide (aa 23–537) coding regions were amplified by PCR and cloned in a vector containing the HA epitope tag upstream of the NsiI restriction site. For C-terminal tagging, the HA epitope tag was encoded on the antisense primer and the product cloned into an identical vector variant devoid of N-terminal HA-tag. Because the giardial GCS coding sequence contains an NsiI restriction site, a complementary SbfI restriction site was encoded on sense primers and used for ligation into the vectors. Stable chromosomal integration of the described constructs was performed using the pPacV-Integ expression vector (21Stefanic S. Morf L. Kulangara C. Regos A. Sonda S. Schraner E. Spycher C. Wild P. Hehl A.B. Neogenesis and maturation of transient Golgi-like cisternae in a simple eukaryote.J. Cell Sci. 2009; 122: 2846-2856Crossref PubMed Scopus (49) Google Scholar) using XbaI and PacI restriction sites. Oligonucleotides (5′-3′ orientation) used in this study were: GCS(2-537)-SbfI-s AGATCTCCTGCAGGACGGGTTGACTCTCTCCTTAGTG; GCS(23-537)-SbfI-s AGATCTCCTGCAGGCTGTCAACCGCATAAGTG; GCS-PacI-as CGTTAATT AATCAGTCGAGGGATTTTTTATTGGCCTG;GCS-HA-PacI-asCGTTAATTAATCACGCGT AGTCTGGGACATCGTATGGGTAGTCGAGGGATTTTTTATTGGCCTG. Plasmid vector DNA was linearized using SwaI restriction enzyme and 15 μg of digested plasmid DNA was electroporated (350V, 960µF, 800Ω) into trophozoites. Linearized plasmid targets the G. lamblia triose phosphate isomerase locus (GL50803_93938), and integration occurs by homologous recombination under selective pressure with the antibiotic puromycin (22Jimenez-Garcia L.F. Zavala G. Chavez-Munguia B. Ramos-Godinez Mdel P. Lopez-Velazquez G. Segura-Valdez Mde L. Montanez C. Hehl A.B. Arguello-Garcia R. Ortega-Pierres G. Identification of nucleoli in the early branching protist Giardia duodenalis.Int. J. Parasitol. 2008; 38: 1297-1304Crossref PubMed Scopus (39) Google Scholar). RNA was isolated from trophozoites or parasites allowed to encyst for 7 h using an RNAeasy kit (Qiagen, Stanford, CA) following the "Animal Cells Spin" protocol. Residual genomic DNA was removed with DNase 1 digestion according to the manufacturer's protocol. The integrity of the RNA was analyzed in a Bioanalyser (Agilent Technologies Inc., Palo Alto, CA) with "Eukaryote Total RNA Nano Series II" settings. For dual channel microarray analysis, extracted total RNA was processed using the "Amino Allyl MessageAmp™II a RNA Amplification Kit"(Ambion, Austin, TX) and labeled with N-hydroxysuccinimidyl ester-derivatized reactive dyes Cy™3 or Cy™5, according to the manufacturer's protocol. After purification, 2 μg each of Cy3 or Cy5 labeled aRNA were denatured, added to SlideHyb™ Buffer I (Ambion), and hybridized to G. lamblia microarrays version 1 (TIGR) in a Tecan HybStation at the Functional Genomics Centre, Zurich, Switzerland. The arrays are epoxy surface coated glass slides with ss-oligo (70 mers) containing 19,230 elements and covering the whole G. lamblia WBC6 strain genome. Before hybridization, slides were hydrated and blocked with 150 μl Tris-HCl-ethanolamine (0.1 M Tris, 50 mM ethanolamine, pH 9.0), for 30 min at 50°C. After washing, samples were injected and hybridized for 16 h at 42°C. Slides were scanned in an Agilent Scanner G2565AA, using laser lines 543 nm and 633 nm for excitation of Cy3 and Cy5, respectively. Spatial scanning resolution was 10 μm, single pass. The scanner output files were quantified using the Genespotter Software (MicroDiscovery GmbH, Berlin, Germany) with default settings and 2.5 μm radius. The median spot intensities were evaluated with the Web application MAGMA (23Rehrauer H. Zoller S. Schlapbach R. MAGMA: analysis of two-channel microarrays made easy.Nucleic Acids Res. 2007; 35: W86-W90Crossref PubMed Scopus (12) Google Scholar) and normalized using the print-tip-wise loess correction of the limma package (24Smith G.K. Limma: linear models for microarray data.in: Gentleman R. Carey V. Dudoit S. Irizarry R. Huber W. Bioinformatics and Computational Biology Solutions Using R and Bioconductor. Springer, New York2005: 397-420Crossref Google Scholar). Potential gene-specific dye-effects were estimated from self-self hybridizations. Differential expression of genes during encystation is reported as encystation-induced fold-change, as well as the P value for differential expression as estimated by the empirical Bayes model implemented in limma. Experiments were performed in biological triplicate. For semiquantitative real-time PCR, first strand cDNA synthesis was performed using ∼350 ng RNA and Omniscript reverse transcriptase (Qiagen), according to manufacturer's protocol. Amplification was performed in an iCycler iQ (Biorad, Hercules, CA) using 2 μl of 1:1000 diluted cDNA. To monitor possible contamination with residual genomic DNA, PCR amplification was performed on the extracted RNA and water. Primer pairs (5′-3′ orientation) used for amplification of actin (ACT), cyst wall protein 1 (CWP1), and GCS were ACT-s, ACATATGAGCTGCCAGATGG; ACT-as,TCGGGGAGGCCT GCAAAC; CWP1s,GGCGATATTCCCGAGTGCATGTG; CWP1as,GTGAGGCAGTACTCTA GT; GCS-s, GCAGACCAAGCCTAGCATC; and GCS-as, CCTTTACCACAGGCACTTTG. All reactions were run in triplicate. To assess the efficiency of the amplification reactions, standard curves for every primer pair and cDNA were generated from 6-fold serial dilutions in duplicate, using the iQ5 software. Expression levels of the genes were given as values in arbitrary units relative to the amount of the constitutively expressed housekeeping gene actin. For analysis of lipid synthesis in G. lamblia in presence of inhibitors, isolated parasites were pretreated with the selected compounds for 30 min at 37°C followed by labeling with 4 μCi/ml [3H]palmitic acid or [3H]serine for 3 h at 37°C in supplemented PBS (PBS containing 50 mM glucose, 9 mM l-cysteine, 1.7 mM ascorbic acid, pH 7.1) in presence of the compounds. Labeling with 20 μCi/ml [3H]glucose was performed in supplemented PBS without glucose addition. After extensive washing with PBS and 0.05% fat-free BSA in PBS, lipids were extracted according to (25Bligh E.G. Dyer W.J. A rapid method of total lipid extraction and purification.Can. J. Med. Sci. 1959; 37: 911-917Google Scholar). Extracted lipids were saponified by mild alkaline hydrolysis when required. Lipid aliquots were separated by high-performance, thin-layer chromatography (HPTLC) on Silica Gel 60 plates. Solvent systems used were the following: A, first dimension, chloroform:methanol:25% ammonium hydroxide:water (65:35:4:4); second dimension, chloroform:aceton:methanol:acetic acid:water (50:20:10:10:5); B, chloroform:methanol:25% ammonium hydroxide (65:25:4.5); C, chloroform:methanol:acetic acid:water (84:4.5:5:0.5) D, benzene:2-propanol:water (100:10:0.25). Radiolabeled bands were visualized using a tritium-sensitive screen (Perkin-Elmer, Boston, MA) in a Personal Molecular PhosphoImager FX (Biorad), identified according to comigrating standards (Avanti Polar Lipids, Alabaster, AL) visualized by iodine vapors and quantified using ImageQuant software (Amersham, Otelfingen, Switzerland). For ceramide glycanase digestion, samples were dissolved in 50 mM sodium acetate buffer pH 5.0 containing 0.1% (w/v) sodium cholate. Ceramide glycanase (Calbiochem) was added at 3.1 U/ml, and digestion was performed at 37°C for 24 h. Lipids were extracted and analyzed by TLC. For radioactivity incorporation analysis, parasites were labeled with radioactive precursors as described. Cell aliquots were solubilized with 0.1N NaOH or processed for lipid extraction; whole cell- or lipid-associated radioactivity was measured by liquid scintillation and normalized by protein content. Liquid chromatography-mass spectrometry (LC-MS) was carried out using lipids from G. lamblia trophozoites, with or without PPMP treatment, and 24 h encysted cells containing an average of 33% cysts, as described (26Munoz-Olaya J.M. Matabosch X. Bedia C. Egido-Gabas M. Casas J. Llebaria A. Delgado A. Fabrias G. Synthesis and biological activity of a novel inhibitor of dihydroceramide desaturase.ChemMedChem. 2008; 3: 946-953Crossref PubMed Scopus (62) Google Scholar). Briefly, cells were harvested, washed in PBS, and transferred to glass vials. Sphingolipid extracts, fortified with internal standards (N-dodecanoylsphingosine, N-dodecanoylglucosylsphingosine, and N-dodecanoylsphingosylphosphorylcholine, 0.5 nmol each), were prepared as described (27Merrill Jr, A.H. Sullards M.C. Allegood J.C. Kelly S. Wang E. Sphingolipidomics: high-throughput, structure-specific, and quantitative analysis of sphingolipids by liquid chromatography tandem mass spectrometry.Methods. 2005; 36: 207-224Crossref PubMed Scopus (473) Google Scholar) and analyzed. The liquid chromatography-mass spectrometer consisted of a Waters Aquity UPLC system connected to a Waters LCT Premier orthogonal accelerated time of flight mass spectrometer (Waters, Millford, MA), operated in positive electrospray ionization mode. Full scan spectra from 50 to 1500 Da were acquired, and individual spectra were summed to produce data points each 0.2 s. Mass accuracy and reproducibility were maintained by using an independent reference spray by the LockSpray interference. The analytical column was a 100 mm × 2.1 mm i.d., 1.7 μm C8 Acquity UPLC BEH (Waters). The two mobile phases were A: methanol:water:formic acid (74:25:1); B: methanol:formic acid (99:1), both also contained 5 mM ammonium formate. A linear gradient was programmed as follows: 0.0 min: 80% B; 3 min: 90% B; 6 min: 90% B; 15 min: 99% B; 18 min: 99% B; 20 min: 80% B. The flow rate was 0.3 mlmin−1. The column was held at 30°C. Quantification was carried out using the extracted ion chromatogram of each compound, using 50 mDa windows. The linear dynamic range was determined by injecting standard mixtures. Positive identification of compounds was based on the accurate mass measurement with an error <5 ppm and its LC retention time, compared with that of a standard (±2%). Lysotracker Blue-White (Molecular Probes) staining of live trophozoites was performed at 100 nM in supplemented PBS at 37°C for 1 h. Cells were then resuspended in PBS and directly imaged. For surface labeling, parasites were incubated with 6 µg/ml fluorescein-conjugated cholera toxin B subunit (Molecular Probes) in supplemented PBS for 60 min at 4°C and analyzed after fixation in 3% formaldehyde solution in PBS for 45 min on glass slides. For membrane endocytosis, parasite were incubated with cholera toxin for 30 min at 4°C, washed in PBS, incubated at 37°C for the time indicated in the figure legends, and imaged after fixation. Endocytosis was quantified by counting the percentage of cells stained in the endocytosis signature area at the center of the ventral disk. For immunolabeling, cells were harvested as described above, washed twice in ice-cold PBS, and fixed as before on glass slides. Fixed cells were permeabilized with 0.2% Triton X-100 in PBS for 20 min, blocked, and incubated with primary antibodies for 1 h. The primary antibodies used in this study were anti-clathrin heavy chain (CLH) mouse antiserum (28Marti M. Li Y. Schraner E.M. Wild P. Kohler P. Hehl A.B. The secretory apparatus of an ancient eukaryote: protein sorting to separate export pathways occurs before formation of transient Golgi-like compartments.Mol. Biol. Cell. 2003; 14: 1433-1447Crossref PubMed Scopus (66) Google Scholar), 1:2000 dilution; anti-protein disulfide isomerase 2 (PDI2) mouse antiserum, 1:1000 dilution; Cy3-conjugated anti-cyst wall protein 1 (CWP1) mouse monoclonal antibody (Waterborne, New Orleans, LA), 1:60 dilution; and Alexa488-conjugated anti-HA mouse monoclonal antibody (Roche Diagnostics GmbH, Manheim, Germany) 1:30 dilution. Fluorophore-conjugated secondary antibodies were purchased from Invitrogen (Basel, Switzerland) and used at 1:200 dilution. Microscopy analyses were performed on a Leica DM IRBE fluorescence microscope or on a Leica SP2 AOBS confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany), using the appropriate settings. Image stacks of optical sections were further processed using the Huygens deconvolution software package version 2.7 (Scientific Volume Imaging, Hilversum, The Netherlands). Three-dimensional reconstruction and surface rendering was done with the Imaris software suite (Bitplane, Zurich, Switzerland) using the surpass functions. Parasite were treated with PPMP or solvent for 16 h and collected as described. The cells were resuspended in 2.5% glutaraldehyde in 0.1M Na/K-phosphate, pH 7.4, and centrifuged at 3500 g for 20 min. After washing, pellets were postfixed with 1% osmium tetroxide in 0.1M Na/K-phosphate for 1 h, dehydrated in a graded ethanol series, transferred to acetone for embedding in epon, and polymerized at 60°C for 2.5 days. Ultrathin sections were stained with uranyl acetate and lead citrate and examined at an acceleration voltage of 100 kV in a Philips CM 12 transmission electron microscope (Eindhoven, The Netherlands) equipped with a low-scan CCD camera (Gatan, Pleasanton, CA). Protein content was determined using the Bio-Rad Protein Assay according to the instructions provided by the manufacturer. Bovine serum albumin was used for the standard curve. In mammalian cells, PPMP blocks the synthesis of GlcCer by occupying the catalytic site of GCS, the enzyme that transfers one glucose molecule to ceramide. PPMP treatment results in decreased cellular levels of GlcCer and accumulation of the ceramide precursor (29Rani C.S. Abe A. Chang Y. Rosenzweig N. Saltiel A.R. Radin N.S. Shayman J.A. Cell cycle arrest induced by an inhibitor of glucosylceramide synthase. Correlation with cyclin-dependent kinases.J. Biol. Chem. 1995; 270: 2859-2867Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). To determine whether G. lamblia is capable of GlcCer synthesis and whether PPMP inhibits GlcCer formation in the parasite, we metabolically labeled G. lamblia trophozoites and analyzed the extracted lipids by two-dimensional thin-layer chromatography (2D TLC). Labeling with the [3H]palmitic acid precursor showed that 10 μM PPMP, a concentration we previously showed to inhibit G. lamblia replication (6Sonda S. Stefanic S. Hehl A.B. A sphingolipid inhibitor induces a cytokinesis arrest and blocks stage differentiation in Giardia lamblia.Antimicrob. Agents Chemother. 2008; 52: 563-569Crossref PubMed Scopus (21) Google Scholar), strongly altered the lipid profile by either decreasing (Fig. 1A, spots A, B) or increasing (spots C, D) the abundance of labeled lipids or inducing the appearance of labeled species not visible in the untreated sample (spot E). Saponification of extracted lipids by mild alkaline hydrolysis to remove glycerol-based lipids revealed that lipid "A" was resistant to the treatment, thus supporting that it belongs to the sphingolipid class (Fig. 1B). In addition, 1D TLC of saponified samples showed that the predominant band comigrated with a GlcCer standard and its amount decreased upon PPMP treatment (Fig.
Referência(s)