Treatment of PC12 Cells with Nerve Growth Factor Induces Proteasomal Degradation of T-cadherin That Requires Tyrosine Phosphorylation of Its Cadherin Domain
2007; Elsevier BV; Volume: 282; Issue: 37 Linguagem: Inglês
10.1074/jbc.m700691200
ISSN1083-351X
AutoresShoumei Bai, Jharna Datta, Samson T. Jacob, Kalpana Ghoshal,
Tópico(s)Kruppel-like factors research
ResumoT-cadherin (T-Cad), a unique member of the cadherin family of proteins, plays an important role in cell adhesion and cell signaling. Recently, we demonstrated that T-Cad is transcriptionally repressed by DNA methyltransferase 3b during nerve growth factor (NGF)-induced neuronal differentiation of PC12 cells. Here, we show that T-Cad expression is also regulated at the post-translational level by the proteasomal pathway in these cells, which is facilitated upon NGF treatment. Pulse-chase experiments demonstrated that NGF treatment significantly reduced the half-life of T-Cad. Degradation of T-Cad was blocked upon treatment of PC12 cells with the proteasomal inhibitor ZLLL or lactacystin. Ectopic expression of Cdh1 (CDC20 homolog 1), one of the substrate recognition components of anaphase promoting complex (E3 ligase), stimulated T-Cad degradation. Deletion of CD1, one of the five extracellular cadherin domains (CD), promoted degradation of T-Cad, especially in the presence of NGF. On the contrary, deletion of CD2 stabilized this protein maximally. Ubiquitination of different deletion mutants indicates that T-Cad harbors multiple ubiquitination signals. Furthermore, genistein, a protein-tyrosine kinase inhibitor, impeded T-Cad degradation in PC12 cells, implicating requirement of tyrosine phosphorylation in this process. Mutation at tyrosine 327 (Y327F) markedly increased the half-life of T-Cad, suggesting that phosphorylation of this tyrosine residue located within CD2 is critical for this process. These results show that T-cadherin is subject to dual regulation during NGF-induced differentiation of PC12 cells, namely transcriptional repression mediated by Dnmt3b and post-translational degradation through the proteasomal pathway. These data, together with the inhibitory role of T-Cad in neurite outgrowth of PC12 cells upon NGF treatment, underscore the significance of its stringent regulation during this differentiation process. T-cadherin (T-Cad), a unique member of the cadherin family of proteins, plays an important role in cell adhesion and cell signaling. Recently, we demonstrated that T-Cad is transcriptionally repressed by DNA methyltransferase 3b during nerve growth factor (NGF)-induced neuronal differentiation of PC12 cells. Here, we show that T-Cad expression is also regulated at the post-translational level by the proteasomal pathway in these cells, which is facilitated upon NGF treatment. Pulse-chase experiments demonstrated that NGF treatment significantly reduced the half-life of T-Cad. Degradation of T-Cad was blocked upon treatment of PC12 cells with the proteasomal inhibitor ZLLL or lactacystin. Ectopic expression of Cdh1 (CDC20 homolog 1), one of the substrate recognition components of anaphase promoting complex (E3 ligase), stimulated T-Cad degradation. Deletion of CD1, one of the five extracellular cadherin domains (CD), promoted degradation of T-Cad, especially in the presence of NGF. On the contrary, deletion of CD2 stabilized this protein maximally. Ubiquitination of different deletion mutants indicates that T-Cad harbors multiple ubiquitination signals. Furthermore, genistein, a protein-tyrosine kinase inhibitor, impeded T-Cad degradation in PC12 cells, implicating requirement of tyrosine phosphorylation in this process. Mutation at tyrosine 327 (Y327F) markedly increased the half-life of T-Cad, suggesting that phosphorylation of this tyrosine residue located within CD2 is critical for this process. These results show that T-cadherin is subject to dual regulation during NGF-induced differentiation of PC12 cells, namely transcriptional repression mediated by Dnmt3b and post-translational degradation through the proteasomal pathway. These data, together with the inhibitory role of T-Cad in neurite outgrowth of PC12 cells upon NGF treatment, underscore the significance of its stringent regulation during this differentiation process. T-cadherin (truncated cadherin, T-Cad) 3The abbreviations used are:T-CadT-cadherinCHXcycloheximideCdh1CDC20 homolog 1CDcadherin domainAPC/Canaphase promoting complex/cyclosomeNGFnerve growth factorDnmtDNA methyltransferaseSCFSkp-Culin-F box proteinE1ubiquitin-activating enzymeE2ubiquitin carrier proteinE3biquitin-protein isopeptide ligase 3The abbreviations used are:T-CadT-cadherinCHXcycloheximideCdh1CDC20 homolog 1CDcadherin domainAPC/Canaphase promoting complex/cyclosomeNGFnerve growth factorDnmtDNA methyltransferaseSCFSkp-Culin-F box proteinE1ubiquitin-activating enzymeE2ubiquitin carrier proteinE3biquitin-protein isopeptide ligase is a unique member of cadherin family linked to the membrane through a glycosylphosphatidylinositol anchor (1Ranscht B. Dours-Zimmermann M.T. Neuron. 1991; 7: 391-402Abstract Full Text PDF PubMed Scopus (262) Google Scholar). Unlike most of the cadherin family of proteins, it lacks the cytoplasmic domain. The exact cellular function of this protein has not been completely elucidated. It is postulated that T-Cad may function as a signaling molecule, which is consistent with the relatively weak cell-cell adhesion mediated by T-Cad (1Ranscht B. Dours-Zimmermann M.T. Neuron. 1991; 7: 391-402Abstract Full Text PDF PubMed Scopus (262) Google Scholar). In smooth muscle cells and human umbilical vein endothelial cells T-Cad can negatively regulate cell adhesion, increase cell motility (2Ivanov D. Philippova M. Tkachuk V. Erne P. Resink T. Exp. Cell Res. 2004; 293: 207-218Crossref PubMed Scopus (66) Google Scholar), and co-segregate with signaling molecules such as G-protein and SRC family kinase, which implicates its role as an intracellular signaling molecule (3Philippova M.P. Bochkov V.N. Stambolsky D.V. Tkachuk V.A. Resink T.J. FEBS Lett. 1998; 429: 207-210Crossref PubMed Scopus (69) Google Scholar). T-Cad also functions as a negative regulator of axon growth, as evident from T-Cad-mediated inhibition of neurite outgrowth during NGF-induced PC12 cell differentiation (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar) and reduction in neurite extension of spinal motor neurons both as a substratum and as a soluble recombinant protein (5Fredette B.J. Miller J. Ranscht B. Development. 1996; 122: 3163-3171Crossref PubMed Google Scholar). T-cadherin cycloheximide CDC20 homolog 1 cadherin domain anaphase promoting complex/cyclosome nerve growth factor DNA methyltransferase Skp-Culin-F box protein ubiquitin-activating enzyme ubiquitin carrier protein biquitin-protein isopeptide ligase T-cadherin cycloheximide CDC20 homolog 1 cadherin domain anaphase promoting complex/cyclosome nerve growth factor DNA methyltransferase Skp-Culin-F box protein ubiquitin-activating enzyme ubiquitin carrier protein biquitin-protein isopeptide ligase T-Cad is differentially expressed in different neuronal populations and is regulated in a temporally and spatially restricted pattern during motor axon growth (6Fredette B.J. Ranscht B. J. Neurosci. 1994; 14: 7331-7346Crossref PubMed Google Scholar). It is discretely distributed in the region devoid of growth cone, which suggests a potential role of T-Cad in the regulation of specific neurite outgrowth. T-Cad level is also elevated in cardiac and vascular tissues where aryl hydrocarbon receptor ligands repress its expression (7Niermann T. Schmutz S. Erne P. Resink T. Biochem. Biophys. Res. Commun. 2003; 300: 943-949Crossref PubMed Scopus (34) Google Scholar). Interestingly, T-Cad can also function as a receptor for low-density lipoprotein and adiponection/Acrp30 (8Hug C. Wang J. Ahmad N.S. Bogan J.S. Tsao T.S. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 10308-10313Crossref PubMed Scopus (672) Google Scholar). Hormones and growth factors can also modulate T-Cad expression (9Bromhead C. Miller J.H. McDonald F.J. Gene (Amst.). 2006; 374: 58-67Crossref PubMed Scopus (25) Google Scholar). T-Cad gene is silenced by promoter hypermethylation in a variety of cancers (10Toyooka S. Toyooka K.O. Harada K. Miyajima K. Makarla P. Sathyanarayana U.G. Yin J. Sato F. Shivapurkar N. Meltzer S.J. Gazdar A.F. Cancer Res. 2002; 62: 3382-3386PubMed Google Scholar, 11Roman-Gomez J. Castillejo J.A. Jimenez A. Cervantes F. Boque C. Hermosin L. Leon A. Granena A. Colomer D. Heiniger A. Torres A. J. Clin. Oncol. 2003; 21: 1472-1479Crossref PubMed Scopus (80) Google Scholar), and is associated with poor prognosis of cervical cancer. We have recently identified T-Cad as a novel target of DNA methyltransferase 3b (Dnmt3b) in PC12 cells (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Dnmt3b represses T-Cad expression that requires histone deacetylation but is independent of de novo DNA methylation (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Furthermore, ectopic expression of T-Cad inhibits NGF-induced neurite outgrowth, which emphasizes the negative role of T-Cad in this differentiation process. Ubiquitin-proteasome system is a key player that regulates cellular protein level (for review, see Refs. 12Hershko A. Cell Death Differ. 2005; 12: 1191-1197Crossref PubMed Scopus (271) Google Scholar and 13Nakayama K.I. Nakayama K. Nat. Rev. Cancer. 2006; 6: 369-381Crossref PubMed Scopus (1119) Google Scholar). It requires multiple steps of enzyme catalysis involving E1, E2, and E3. In this ATP-dependent process involving a series of reactions, ubiquitin is transferred to a lysine residue of the target polypeptide to form a polyubiquitinated protein, which is degraded by the 26 S proteasome. This sequential action of enzymes allows different layers of regulation and precise co-operation among components of the protein complex. The substrate specificity of the proteasomal degradation resides in the E3 ligase that recognizes and catalyzes the addition of ubiquitin moiety to the substrate. One of the E3 ligase complexes, the anaphase promoting complex/cyclosome (APC/C) is coupled to cell cycle progression by targeting different cyclins and cell cycle-regulated proteins to degradation. The activity and substrate specificity of this complex was determined during cell cycle phase transition by interaction of APC/C with Cdc20 in early mitosis and Cdh1 (CDC20 homolog 1) in anaphase and G1. Its substrates include cyclins (e.g. cyclin B) and other cell cycle regulators (for review, see Refs. 12Hershko A. Cell Death Differ. 2005; 12: 1191-1197Crossref PubMed Scopus (271) Google Scholar and 13Nakayama K.I. Nakayama K. Nat. Rev. Cancer. 2006; 6: 369-381Crossref PubMed Scopus (1119) Google Scholar) as well as cell cycle-regulated proteins such as Dnmt1 (14Ghoshal K. Datta J. Majumder S. Bai S. Kutay H. Motiwala T. Jacob S.T. Mol. Cell. Biol. 2005; 25: 4727-4741Crossref PubMed Scopus (356) Google Scholar). The SCF (Skp-Culin-F box protein) complexes contain a core ubiquitin ligase composed of Cul1/Cdc53, Skp1, the Ring finger protein Rbx1/Roc1/Hrt1, and a member of the F-box family of proteins (for review, see Ref. 15Ang X.L. Wade Harper J. Oncogene. 2005; 24: 2860-2870Crossref PubMed Scopus (153) Google Scholar). The SCF ubiquitin ligase also has wide spectrum of substrates including Ikβ, Sic1, G1 cyclins, and other cell cycle-related proteins (16Jackson P.K. Eldridge A.G. Mol. Cell. 2002; 9: 923-925Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). The Cbl family composes single protein Ring finger E3 ligases. These family of proteins are coupled to tyrosine kinase signaling especially in the immune system (17Rao N. Miyake S. Reddi A.L. Douillard P. Ghosh A.K. Dodge I.L. Zhou P. Fernandes N.D. Band H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3794-3799Crossref PubMed Scopus (110) Google Scholar). Ubiqitin E3 ligases exhibit substrate specificity, which bestow the cells different layers of regulation of gene expression upon distinct stimuli. Here we show that T-Cad is also regulated at the post-translational level by degradation through the ubiquitin-proteasome system, which requires tyrosine phosphorylation and APC/Ccdh1 (E3) ligase. These results suggest that T-Cad is regulated at both RNA and protein levels, which is probably essential for NGF-induced neurite outgrowth in PC12 cells. ZLLL (MG132), chloroquine, cycloheximide, genistein, and anti-FLAG M2 antibody were purchased from Sigma and lactacystin was obtained from Toronto Research Chemicals, Inc. T-Cadherin antibodies (sc-7940) were from Santa Cruz Biotechnology. P(Tyr) antibodies (py20 and py99) were from Santa Cruz, and 4610 was from upstate Biotechnology. Ku-70(N3H10) antibody was from Neomarker. T-CadΔCD1—The cadherin domain 1 was eliminated by digestion of T-Cadflag-(45) with BstEII and EcoRV. The BstEII site was blunt-ended and ligated to the EcoRV site, resulting in in-frame deletion mutation. Nsp-ΔCD1—The EcoRV fragment from T-Cadflag bearing the N-terminal signal peptide was inserted in-frame with T-cadΔCA1. T-CadΔCD2–5—Cadherin domains 2–5 were eliminated by digestion of T-Cadflag with BstEII and BamHI, blunt-ended with Klenow, and religated. Nsp-ΔCD3–5—Cadherin domains 3–5 were eliminated by digestion of T-Cadflag with BglII followed by religation resulting in in-frame deletion mutation. T-CadY327F—Site-directed mutagenesis was performed by PCR with the following set of primers where the mutant bases are underlined: primer set 1: TGTATGTGGAAACCACGGATGC (UP-F) and TTCGATGATCAGTTCAAACTTGGGGTTTTC (UP-R); set 2: GAAAACCCCAAGTTTGAACTGATCATCGAA (Down-F) and CGGGATCCCAGACCTGACAATAAGCTGA (Down-R). PCR products of sets 1 and 2 were mixed at equal molar ratios and amplified with primers UP-F and Down-R to generate full-length T-Cad cDNA harboring the Y327F mutation. The PCR product was digested with BstEII and BamHI and cloned into the same site of T-Cadflag replacing the wild type sequence (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Growing of PC12 cells and transfection assays were performed as described (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Whole cell extracts were subjected to Western blot analysis as described earlier (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Quantitative analysis of the protein levels in Western blots was done using ImageQuant (GE Healthcare) software. The value of net intensity was used after background correction. The results are mean of three independent experiments. T-Cadflag expressing cells either untreated or treated with NGF for 2 days were lysed in RIPA buffer and immunoprecipitated with anti-FLAG antibody. The precipitated proteins were resolved on SDS-PAGE, transferred to nitrocellulose membrane, and subjected to Western blot analysis with anti-phosphotyrosine antibody as described (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). The membrane was reprobed with anti-FLAG M2 antibody (Sigma). In vivo labeling was done as described earlier (14Ghoshal K. Datta J. Majumder S. Bai S. Kutay H. Motiwala T. Jacob S.T. Mol. Cell. Biol. 2005; 25: 4727-4741Crossref PubMed Scopus (356) Google Scholar). T-Cadflag expressing PC12 cells untreated or treated with NGF for 2 days were washed in serum- and phosphate-free medium and incubated in the same medium for 1 h, followed by incubation with [32P]orthophosphate (0.5 mCi/ml) (MP Biochemicals) in phosphate-free medium containing dialyzed serum (fetal bovine serum or horse serum) for 4 h. The cells were washed with Tris-buffered saline, lysed in RIPA buffer, and subjected to immunoprecipitation with anti-FLAG antibody. The proteins pulled down were separated by SDS-PAGE, transferred to nitrocellulose membrane, and subjected to autoradiography using PhosphorImager analysis and Western blot analysis with anti-FLAG antibody. 32P-Signal was quantified using ImageQuant software (GE Healthcare). This experiment was done as described earlier (14Ghoshal K. Datta J. Majumder S. Bai S. Kutay H. Motiwala T. Jacob S.T. Mol. Cell. Biol. 2005; 25: 4727-4741Crossref PubMed Scopus (356) Google Scholar). T-Cadflag expressing PC12 cells either untreated or treated with NGF for 48 h were labeled with [35S]methionine (1 mCi/ml) (MP Biochemicals) for 1 h in methionine-free medium were washed with phosphate-buffered saline followed by incubation in the complete RPMI medium containing 2 mm methionine. The cells were harvested at 0, 2, 4, and 6 h and equal amounts of protein (250 μg) extracted in RIPA buffer from each group was immunoprecipitated with anti-FLAG antibody. More proteins (500 μg of NGF-treated) were used from NGF-treated cells to make a comparable 0-h T-Cad level. The precipitated proteins were separated by SDS-PAGE, transferred to a nitrocellulose membrane, and subjected to PhosphorImager analysis. The blot was also subjected to Western blot analysis with the same antibody. 35S-Signal was quantified using ImageQuant software. Whole cell extracts from T-Cad expressing cells or vector-transfected PC12 cells were immunoprecipitated with anti-FLAG or anti-ubiquitin antibody (Santa Cruz) as described (14Ghoshal K. Datta J. Majumder S. Bai S. Kutay H. Motiwala T. Jacob S.T. Mol. Cell. Biol. 2005; 25: 4727-4741Crossref PubMed Scopus (356) Google Scholar). The immune complex eluted in SDS-loading buffer was divided into two equal parts, separated in parallel, transferred to nitrocellulose membrane, and subjected to Western blot analysis with anti-FLAG or anti-ubiquitin antibody. T-Cadflag-expressing cells treated with NGF in the presence or absence of ZLLL were homogenized in buffer containing Tris-buffered saline (10 mm Tris-HCl, pH 7.4, 140 mm NaCl, 5 mm EDTA), 2 mm dithiothreitol, protease inhibitor mixture (Sigma), and centrifuged at 2,000 × g for 5 min to remove intact cells and nuclei. The supernatant was centrifuged at 100,000 × g for 90 min. The pellet (membrane) and supernatant (cytosol) fractions were then subjected to SDS-PAGE and Western blot analysis. Cells that are not treated with NGF were used as controls. Indirect immunofluorescence assay was performed as described (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 18Bai S. Ghoshal K. Datta J. Majumder S. Yoon S.O. Jacob S.T. Mol. Cell. Biol. 2005; 25: 751-766Crossref PubMed Scopus (87) Google Scholar). NGF-induced Differentiation of PC12 Cells Causes Rapid Decline in T-Cad Protein Level—We have previously shown that ectopic expression of T-Cad impedes NGF-induced neurite outgrowth in PC12 cells (4Bai S. Ghoshal K. Jacob S.T. J. Biol. Chem. 2006; 281: 13604-13611Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). To study the potential relationship between T-Cad levels and NGF-mediated neuronal differentiation, we studied the expression profile of T-Cad during this process. Real-time reverse transcriptase-PCR analysis showed that NGF exposure had no significant effect on T-Cad mRNA level after 24 h, which was reduced by only ∼40% after 48 h (Fig. 1A). In contrast, T-Cad protein levels rapidly decreased by ∼70% within the first 24 h and nearly 90% by 36 h (Fig. 1, B and C). These data suggested to us that T-Cad expression is regulated post-transcriptionally at the early stage of neurite outgrowth. Like the endogenous T-Cad protein, ectopic T-Cadflag also rapidly decreased with time (by ∼55 and 85% at 36 and 48 h, respectively) in PC12 cells in response to NGF treatment (Fig. 1, B and C). The relatively slow rate of depletion of the recombinant protein was probably due to its higher level compared with the endogenous protein. Transcription of ectopic T-Cadflag from the cytomegalovirus promoter was not suppressed by NGF (data not shown). Therefore, decreased levels of T-Cadflag upon NGF treatment further supports the notion that T-Cad is regulated at the protein level in the initial stages of NGF response. To confirm that the recombinant T-Cadflag was authentic T-Cad, we pulled down the ectopic protein expressed in PC12 cells with anti-FLAG antibody followed by Western blot analysis with T-Cad antibody. The result showed that ectopic T-Cad immunoprecipitated by anti-FLAG antibody was indeed T-Cad (Fig. 1D). Lack of T-Cad precipitation in vector-transfected cells showed the specificity of the anti-FLAG antibody. Anti-FLAG antibody showed specificity in precipitating and detecting ectopic T-Cad, whereas T-Cad antibody could not efficiently immunoprecipitate T-Cad. We, therefore, used anti-FLAG antibody in subsequent experiments to analyze T-Cad expression PC12 cells. NGF Treatment Facilitates Proteasomal Degradation of T-Cad in PC12 Cells—To determine whether NGF-induced down-regulation of T-Cad is a translational or post-translational event, we determined its half-life using a pulse-chase experiment. T-Cad expressing PC12 cells in the presence or absence of NGF were incubated with [35S]methionine for 1 h to label the newly synthesized proteins followed by chase with excess unlabeled methionine for different time periods. As expected, 35S-signal in T-Cad pulled down by anti-FLAG antibody decreased with time during the chase period indicating that T-Cad turned over rapidly in NGF-treated cells (Fig. 2, A, top panel, lanes 4–8, and B). In contrast, 35S-signal in control cells was more stable during the chase period indicating a longer half-life (Fig. 2A, top panel, lanes 1–4). The half-life of T-Cad was ∼2 h in NGF-treated cells (Fig. 2B). Western blot analysis showed that the total T-Cad level increased slightly with time especially in the 4- and 6-h cells during chase periods, in both groups (Fig. 2A, middle panel, compare lanes 3, 4, and 7, 8 with 1 and 5, respectively). This is perhaps due to its rapid synthesis in cells growing in the complete medium fortified with regular sera instead of dialyzed sera used for in vivo labeling with [35S]methionine. These results altogether demonstrate that NGF induces rapid degradation of T-Cad. We next monitored the effect of NGF on the level of endogenous T-Cad in PC12 cells. Because the antibody that detects T-Cad in immunoblot analysis could not immunoprecipitate it, we used cycloheximide (CHX) to study the degradation of presynthesized T-Cad degradation. CHX (10 μg/ml) abolished protein biosynthesis in PC12 cells (data not shown). Like T-Cadflag, endogenous T-Cad also degraded at a faster rate in differentiated PC12 cells (Fig. 2, C and D). T-Cad was almost completely degraded within 4 h of CHX treatment of cells exposed to NGF (Fig. 2, C and D), whereas the level of T-Cad remained in control cells were not significantly altered during this time period. This data shows that like T-Cadflag, endogenous T-Cad is rapidly degraded in the presence of NGF. To identify the proteolytic pathway involved in the rapid turnover of T-Cad, we treated the cells with lactacystin, a specific proteasomal inhibitor, in the presence or absence of NGF. T-Cad protein level was significantly elevated in both untreated (-NGF) and NGF treated (+NGF) cells after treatment with lactacystin for 24 h (Fig. 3, A and B). The recovery of T-Cad protein was, however, higher (∼2.7-fold) in NGF-treated cells compared with the control cells (1.8-fold). Treatment of cells with chloroquine, a lysosomal protease inhibitor, did not affect T-Cad level (Fig. 3, C and D). To confirm further that T-Cad is indeed degraded through the proteasomal pathway, the cells were treated with another potent proteasomal inhibitor, ZLLL. Pretreatment with ZLLL not only blocked T-Cad depletion but also elevated its level compared with control cells that are not exposed to NGF (Fig. 3E, compare lanes 5, 7 and 9 with lane 1). In fact, T-Cad accumulated linearly with time when protein degradation was blocked by ZLLL (Fig. 3, E and F, y = 7x + 79.53, RSQ = 0.98). These data, taken together, suggest that T-Cad is degraded by the proteasomal pathway, which is further enhanced by NGF treatment. T-Cad Is Ubiquitinated in PC12 Cells—Ubiqutination marks proteins for proteasomal degradation. It also serves as a signal for the endocytosis of membrane-bound proteins (19d'Azzo A. Bongiovanni A. Nastasi T. Traffic. 2005; 6: 429-441Crossref PubMed Scopus (199) Google Scholar). To determine whether T-Cad is ubiquitinated in vivo, cell extracts were prepared in buffer containing 1% SDS followed by heat inactivation of deubiquitinating enzymes. The cell extract was diluted and immunoprecipitated with anti-FLAG (for FLAG-tagged T-Cad) or anti-ubiquitin antibody followed by Western blot analysis of the pulled down proteins with each antibody (see Fig. 4A for schematic representation). Anti-FLAG antibody pulled-down T-Cad that was further enriched in cells treated with ZLLL (Fig. 4B, lanes 5 and 6). Ubiquitinated T-Cad was detected as the higher molecular weight ladder in cells treated with ZLLL (Fig. 4B, lane 6). Similarly, anti-FLAG antibody also detected proteins immunoprecipitated by anti-ubiquitin antibody in cells expressing T-Cad (Fig. 4B, lanes 9 and 10). As expected, the ubiquitinated ladder of T-Cad was robust in cells incubated with ZLLL compared with the untreated cells. Similarly, ubiquitinated T-Cad pulled by anti-FLAG antibody can only be detected by anti-ubiquitin antibody in cells treated with ZLLL (Fig. 4B, lane 16). The inability to detect ubiquitinated T-Cad in ZLLL-untreated cells supports the notion that ubiquitinated T-Cad is rapidly degraded to a level that is too low to be detected (Fig. 4B, lanes 5, 9, and 15). The enrichment of the polyubiquitinated T-Cad in cells treated with ZLLL further confirmed the involvement of proteasome in the turnover of T-Cad under normal physiological conditions. As expected, ubiquitin antibody also pulled down many other ubiquitinated proteins (Fig. 4B, lanes 17–20). T-Cad was not detected in the vector-transfected cells after immunoprecipitation with either anti-FLAG (Fig. 4B, lanes 3, 4, 13, and 14) or anti-ubiquitin (Fig. 4B, lanes 7 and 8) antibody, which confirmed the specificity of immunoprecipitation analysis. Ubiquitinated T-Cad Accumulates on the Plasma Membrane of PC12 Cells When Its Degradation Is Blocked by ZLLL—T-Cad is linked to the plasma membrane through the glycosylphosphatidylinositol anchor. To determine whether membrane-bound T-Cad is ubiquitinated or it needs to be internalized to the cytosol for ubiquitination and subsequent degradation, S-100 extracts from T-Cad expressing cells either untreated or treated with +ZLLL were fractionated to membrane and cytosol fractions. T-Cad was detected only in the membrane fractions, which was elevated markedly in ZLLL-treated cells (Fig. 4C, lanes 1, 3 and 5, 7). High molecular weight polyubiqutinated T-Cad was detected only in the membrane fraction of PC12 cells upon inhibition of proteasomal degradation especially after NGF treatment. These results suggest that the membrane-bound T-Cad is preferentially polyubiquitinated. APC/CCDH1, the E3 Ligase, Is Required for Proteasomal Degradation of T-Cad—Degradation of proteins by the ubiquitin-proteasome system involves multiple steps of enzyme catalysis (for review, see Refs. 12Hershko A. Cell Death Differ. 2005; 12: 1191-1197Crossref PubMed Scopus (271) Google Scholar, 13Nakayama K.I. Nakayama K. Nat. Rev. Cancer. 2006; 6: 369-381Crossref PubMed Scopus (1119) Google Scholar, and 20Bloom J. Pagano M. Cell Cycle. 2004; 3: 138-140Crossref PubMed Google Scholar). The substrate specificity of the proteasomal degradation resides in the E3 ligase, which recognizes the protein substrate and catalyzes the addition of ubiquitin to specific lysine moieties (21Buschhorn B.A. Peters J.M. Nat. Cell. Biol. 2006; 8: 209-211Crossref PubMed Scopus (18) Google Scholar). To identify the E3 ligase that mediates proteasomal turnover of T-Cad we initially focused on the Cbl family of proteins (Cbl-b or Cbl-c) (22Ettenberg S.A. Keane M.M. Nau M.M. Frankel M. Wang L.M. Pierce J.H. Lipkowitz S. Oncogene. 1999; 18: 1855-1866Crossref PubMed Scopus (101) Google Scholar), SCF E3 ligase complex (23Nakayama K.I. Nakayama K. Semin. Cell Dev. Biol. 2005; 16: 323-333Crossref PubMed Scopus (285) Google Scholar), APC/Ccdh1, and APC/Ccdc20 E3 ligase complexes (24Bashir T. Dorrello N.V. Amador V. Guardavaccaro D. Pagano M. Nature. 2004; 428: 190-193Crossref PubMed Scopus (398) Google Scholar) that can utilize membrane-associated protein substrates (25Kumar K.G. Tang W. Ravindranath A.K. Clark W.A. Croze E. Fuchs S.Y. EMBO J. 2003; 22: 5480-5490Crossref PubMed Scopus (156) Google Scholar, 26Davies G.C. Ettenberg S.A. Coats A.O. Mussante M. Ravichandran S. Collins J. Nau M.M. Lipkowitz S. Oncogene. 2004; 23: 7104-7115Crossref PubMed Scopus (73) Google Scholar, 27Sadot E. Simcha I. Iwai K. Ciechanover A. Geiger B. Ben-Ze'ev A. Oncogene. 2000; 19: 1992-2001Crossref PubMed Scopus (62) Google Scholar). For this purpose, T-Cad was co-transfected with expression vectors for Cbl variants (22Ettenberg S.A. Keane M.M. Nau M.M. Frankel M. Wang L.M. Pierce J.H. Lipkowitz S. Oncogene. 1999; 18: 1855-1866Crossref PubMed Scopus (101) Google Scholar), or Cdh1, Cdc20 (28Petersen B.O. Wagener C. Marinoni F. Kramer E.R. Melixetian M. Lazzerini Denchi E. Gieffers C. Matteucci C. Peters J.M. Helin K. Genes Dev. 2000; 14: 2330-2343Crossref PubMed Scopus (231) Google Scholar), or Cul1 (29Pan Z.Q. Kentsis A. Dias D.C. Yamoah K. Wu K. Oncogene. 2004; 23: 1985-1997Crossref PubMed Scopus (339) Google Scholar), the polypeptides involved in substrate recognition by these E3 ligase complexes. Western blot analysis showed that relative to the vector-transfected cells, the T-Cad level decreased by ∼7
Referência(s)