Portal de Periódicos da CAPES

A Novel Chloride Channel in Drosophila melanogaster Is Inhibited by Protons

2005; Elsevier BV; Volume: 280; Issue: 16 Linguagem: Inglês

10.1074/jbc.m411759200

1083-351X

Katrin Schnizler, Beate Saeger, Carsten K. Pfeffer, Alexander Gerbaulet, Ulrich Ebbinghaus‐Kintscher, Christoph Methfessel, Eva-Maria Franken, K. Raming, Christian H. Wetzel, Arunesh Saras, H. Pusch, Hanns Hatt, Günter Gisselmann,

Nicotinic Acetylcholine Receptors Study

A systematic analysis of the Drosophila genome data reveals the existence of pHCl, a novel member of ligand-gated ion channel subunits. pHCl shows nearly identical similarity to glutamate-, glycine-, and histamine-gated ion channels, does however not belong to any of these ion channel types. We identified three different sites, where splicing generates multiple transcripts of the pHCl mRNA. The pHCl is expressed in Drosophila embryo, larvae, pupae, and the adult fly. In embryos, in situ hybridization detected pHCl in the neural cord and the hindgut. Functional expression of the three different splice variants of pHCl in oocytes of Xenopus laevis and Sf9 cells induces a chloride current with a linear current-voltage relationship that is inhibited by extracellular protons and activated by avermectins in a pH-dependent manner. Further, currents through pHCl channels were induced by a raise in temperature. Our data give genetic and electrophysiological evidence that pHCl is a member of a new branch of ligand-gated ion channels in invertebrates with, however, a hitherto unique combination of pharmacological and biophysical properties. A systematic analysis of the Drosophila genome data reveals the existence of pHCl, a novel member of ligand-gated ion channel subunits. pHCl shows nearly identical similarity to glutamate-, glycine-, and histamine-gated ion channels, does however not belong to any of these ion channel types. We identified three different sites, where splicing generates multiple transcripts of the pHCl mRNA. The pHCl is expressed in Drosophila embryo, larvae, pupae, and the adult fly. In embryos, in situ hybridization detected pHCl in the neural cord and the hindgut. Functional expression of the three different splice variants of pHCl in oocytes of Xenopus laevis and Sf9 cells induces a chloride current with a linear current-voltage relationship that is inhibited by extracellular protons and activated by avermectins in a pH-dependent manner. Further, currents through pHCl channels were induced by a raise in temperature. Our data give genetic and electrophysiological evidence that pHCl is a member of a new branch of ligand-gated ion channels in invertebrates with, however, a hitherto unique combination of pharmacological and biophysical properties. Ligand-gated ion channels (LGICs) 1The abbreviations used are: LGIC, ligand-gated ion channel; GABA, γ-aminobutyric acid; GABAA, GABA type A; RT, reverse transcription; EGFP, enhanced green fluorescent protein. 1The abbreviations used are: LGIC, ligand-gated ion channel; GABA, γ-aminobutyric acid; GABAA, GABA type A; RT, reverse transcription; EGFP, enhanced green fluorescent protein. mediate the fast inhibitory and excitatory responses of neuronal and muscle cells to neurotransmitters. A universal feature of the type of “Cys-loop” class of LGIC is a common topology of four membrane-spanning segments (M1–M4) and a huge N-terminal extracellular domain with a hyperconservated cysteinebridge motive (1Karlin A. Akabas M.H. Neuron. 1995; 15: 1231-1244Abstract Full Text PDF PubMed Scopus (563) Google Scholar). In vertebrates this “Cys-bridge” family of phylogenetically related genes codes for cation channels activated by acetylcholine and serotonin or for anion channels activated by GABA and glycine (1Karlin A. Akabas M.H. Neuron. 1995; 15: 1231-1244Abstract Full Text PDF PubMed Scopus (563) Google Scholar). In addition, glutamate- and serotonin-gated anion channel genes are known in invertebrates (2Cully D.F. Vassilatis D.K. Liu K.K. Paress P.S. Van der Ploeg L.H. Schaeffer J.M. Arena J.P. Nature. 1994; 371: 707-711Crossref PubMed Scopus (574) Google Scholar, 3Ranganathan R. Cannon S.C. Horvitz H.R. Nature. 2000; 408: 470-475Crossref PubMed Scopus (182) Google Scholar). Recently, genes for histamine-gated chloride channels and GABA-gated cation channels were identified in invertebrates (4Gisselmann G. Plonka J. Pusch H. Hatt H. Br. J. Pharmacol. 2004; 142: 409-413Crossref PubMed Scopus (76) Google Scholar, 5Zheng Y. Hirschberg B. Yuan J. Wang A.P. Hunt D.C. Ludmerer S.W. Schmatz D.M. Cully D.F. J. Biol. Chem. 2002; 277: 2000-2005Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 6Gisselmann G. Pusch H. Hovemann B.T. Hatt H. Nat. Neurosci. 2002; 5: 11-12Crossref PubMed Scopus (114) Google Scholar, 7Beg A.A. Jorgensen E.M. Nat. Neurosci. 2003; 6: 1145-1152Crossref PubMed Scopus (125) Google Scholar). The molecular basis of further channel types like acetylcholine-gated chloride channels in invertebrates is, however, still unknown (8Kehoe J. McIntosh J.M. J. Neurosci. 1998; 18: 8198-8213Crossref PubMed Google Scholar). Information from the Drosophila melanogaster genome sequencing project allows identifying all members of the superfamily of ligand-gated ion channels occurring in this species by bioinformatic analysis of new homologous genes. The summarized data obtained from several published bioinformatic analyses (5Zheng Y. Hirschberg B. Yuan J. Wang A.P. Hunt D.C. Ludmerer S.W. Schmatz D.M. Cully D.F. J. Biol. Chem. 2002; 277: 2000-2005Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 6Gisselmann G. Pusch H. Hovemann B.T. Hatt H. Nat. Neurosci. 2002; 5: 11-12Crossref PubMed Scopus (114) Google Scholar, 9Xue H. J. Mol. Evol. 1998; 47: 323-333Crossref PubMed Scopus (32) Google Scholar, 10Witte I. Kreienkamp H.J. Gewecke M. Roeder T. J. Neurochem. 2002; 83: 504-514Crossref PubMed Scopus (51) Google Scholar) show that the group of ligand-gated “chloride” channels consists of 12 genes that are coding for GABA, histamine, and glutamate receptors or new, homologous ion channel types. Four members of this group cannot be directly assigned to the GABA, glutamate, or histamine branches and thus code for putative new types of ligand-gated chloride channels with yet unknown function. In a systematic expression approach of these predicted novel types of ion channels in Xenopus oocytes, it was found that none of the typical neurotransmitters activated these novel types of channels (6Gisselmann G. Pusch H. Hovemann B.T. Hatt H. Nat. Neurosci. 2002; 5: 11-12Crossref PubMed Scopus (114) Google Scholar). Therefore, we extended the molecular biological analysis of the mRNA and found that the gene CG6112 encodes for transcripts that undergo extensive splicing. The functional expressions of these splice variants in Xenopus oocytes and Sf9 cells revealed a unique combination of pharmacological and biophysical properties. Computer Analysis—The pHCl clones were sequenced using the LI-COR 4200 laser fluorescent sequencing system (MWG Biotech, Ebersberg, Germany), Fluorescence Labeled Cycle Sequencing Kit (Amersham Biosciences), and infrared fluorescence-labeled primers (MWG) as described before (11Saeger B. Schmitt-Wrede H.P. Dehnhardt M. Benten W.P. Krucken J. Harder A. Samson-Himmelstjerna G. Wiegand H. Wunderlich F. FASEB J. 2001; 15: 1332-1334Crossref PubMed Scopus (73) Google Scholar). The sequences were analyzed with SAPS (12Brendel V. Bucher P. Nourbakhsh I.R. Blaisdell B.E. Karlin S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2002-2006Crossref PubMed Scopus (341) Google Scholar), ScanPROSITE, Prot-Param, and Predict Protein (13Appel R.D. Bairoch A. Hochstrasser D.F. Trends Biochem. Sci. 1994; 19: 258-260Abstract Full Text PDF PubMed Scopus (512) Google Scholar). The programs FASTA (14Pearson W.R. Lipman D.J. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2444-2448Crossref PubMed Scopus (9363) Google Scholar), BLITZ (15Smith T.F. Waterman M.S. J. Mol. Biol. 1981; 147: 195-197Crossref PubMed Scopus (7066) Google Scholar), BLASTN (16Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69694) Google Scholar), and TBLASTN (17Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59437) Google Scholar) were used to search EMBL and Swiss-Prot data bases. pHCl splice variants and similar sequences identified by FASTA were aligned by ClustalW (18Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55405) Google Scholar). Detection of pHCl Splice Variants in Different Drosophila Stages by RT-PCR—Total RNA of D. melanogaster imagos, pupae, larvae III, and eggs was isolated by the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol for animal tissues. DNA was removed by on-column digestion during RNA purification with the Qiagen RNase-Free DNase Set, whereas the RNA was bound to the silica-gel membrane. The OneStep RT-PCR System (Qiagen) was used to transcribe 1 μg of total RNA at 30 min, 50 °C and 15 min, 95 °C; subsequently, PCR amplification was performed for 35 cycles of 1 min, 94 °C; 1 min, 60 °C; and 2 min, 72 °C with final extension at 72 °C for 10 min employing splice variant-specific primer pairs (0.6 μm). As a negative control RT-PCR and PCR amplification was performed without template, and as a second control 1 μg of total RNA was used in a PCR amplification with gene-specific primers but without prior RT-PCR step. Detection of variants A–C were as follows: variant A, a 296-bp fragment with HT-F1 plus HT-R2 or 550 bp with HT-F2 plus HT-R2, variant B: 499 bp with HT-F2 plus HT-R2, variant C: 620 bp with HT-F1 plus HT-R2. (The locations of the primers are in Fig. 1A: ▸, HT-F1 and HT-F2; ◂, HT-R1 and HT-R2). Primers used were: HT-R1, 5′-CTCCGATCCTGCTTAGTACTGCTGG-3′; HT-R2, 5′-TTACGAAAATCCTTTATAGTGTACAAAG-3′; HT-F1, 5′-GTTGCCTACAGGTCGAGTTGACA-3′; and HT-F2, 5′-CGTGCCAGCTAGATCGATGATAG-3′. Preparation of Plasmid DNA for Xenopus laevis Oocyte Microinjection—The plasmids pCT19189A–C, which contain PCR products of the different pHCl splice variants generated with the primer pair AATTTGATGAGTCCAGTTCGGATAAGG and GCTTAATTTTACGAAAATCC, originated from the systematic expression screening approach described previously (6Gisselmann G. Pusch H. Hovemann B.T. Hatt H. Nat. Neurosci. 2002; 5: 11-12Crossref PubMed Scopus (114) Google Scholar). The cDNAs were cloned into the blunt-ended XbaI site of the expression vector pSMyc (19Wellerdieck C. Oles M. Pott L. Korsching S. Gisselmann G. Hatt H. Chem. Senses. 1997; 22: 467-476Crossref PubMed Scopus (57) Google Scholar). This vector construct facilitates expression of a fusion protein consisting of the N-terminal membrane import sequence of the guinea pig serotonin receptor (20Lankiewicz S. Lobitz N. Wetzel C.H.R. Rupprecht R. Gisselmann G. Hatt H. Mol. Pharmacol. 1998; 53: 202-212Crossref PubMed Scopus (86) Google Scholar) followed by a myc tag and then by the pHCl channel beginning at amino acid 39. Such constructs have been proven useful for the functional expression of ligand gated ion channels in heterologous systems and can substitute for the missing endogenous membrane import sequence (21Gisselmann G. Galler A. Friedrich F. Hatt H. Bormann J. Eur.J. Neurosci. 2002; 16: 69-80Crossref PubMed Scopus (9) Google Scholar). Plasmid DNA used for microinjection was prepared using an endotoxin-free Qiagen Maxiprep kit (Qiagen, Hilden, Germany) dissolved in water to yield 1 μg/μl and frozen in aliquots until use for injection. Whole Mount in Situ Hybridization with D. melanogaster Embryos— Antisense and sense RNA probes were labeled with digoxigenin-UTP (DIG-RNA-labeling kit SP6/T7, Roche Applied Science) by in vitro transcription using SP6 or T7 RNA-polymerase. The vector pCR BluntII TOPO (Invitrogen) containing the complete ORF of pHCl-A was linearized with HindIII (antisense) or EcoRV (sense) and served as the template. RNA probes were hydrolyzed at 60 °C under alkaline conditions (0.2 m sodium carbonate, pH 10.2) to yield probes with a length under 500 nucleotides. In situ hybridization on embryos was performed according to the method of Tautz and Pfeifle (22Tautz D. Pfeifle C. Chromosoma. 1989; 98: 81-85Crossref PubMed Scopus (2088) Google Scholar). Briefly, embryos were collected 9–12 h old. The embryos were then dechorionated for 3 min with 50% sodium hypochloride bleach (Sigma) and washed several times with 1× phosphate-buffered saline, fixed with a solution containing equal parts F-phosphate-buffered saline (4% formaldehyde in 1× phosphate-buffered saline, filtered), and heptane for 20 min with frequent shaking. Embryos were devitelinized with equal parts heptane and methanol for 2 min with vigorous shaking and allowing embryos to settle, followed by three times washing with 100% methanol and storage in 100% methanol at 4 °C. After rehydration for several times with 1× PBT (pH 7.4, 130 mm NaCl, 7 mm Na2HPO4, 3 mm NaH2PO4, 0.1% Tween 20 (v/v)) and first fixation with 1× F-PBT (4% paraformaldehyde in 1× PBT) for 20 min while shaking embryos were washed and shaken 3 × 5 min in 1× PBT. First fixation was followed by digestion with proteinase K (25 μg/ml in 1× PBT) for 1 min. Reaction was stopped by inactivating proteinase K (ICN Biomedicals) with 2 mg/ml glycine in 1× PBT for 3 min at RT while shaking. After several washings (1 × 30 s, 2 × 5 min with 1× PBT) embryos were fixed for a second time (refixation) with 1× F-PBT for 20 min and followed by thorough washings while shaking (5 × 5 min with 1× PBT, 1 × 20 min with 1:1 PBT: prehybridization buffer). Embryos were incubated thereafter for 1 h at 50 °C in prehybridization buffer (50% formamide, 5× SSC, 50 μg/ml heparin, 0.1% Tween 20) without shaking and then overnight incubation at 50 °C in hybridization buffer containing the linearized and freshly denaturized digoxigenin-labeled probe (50, 100, and 200 ng/ml). The embryos were washed several times: 5 × 15 min in prehybridization buffer at 50 °C without shaking, 1 × 20 min while shaking at room temperature with prehybridization buffer, 1 × 20 min while shaking at room temperature with 1:1 PBT:prehybridization buffer, 2 × 10 min while shaking at room temperature with 1× PBT. The embryos were treated for 1 h with 1% blocking solution (Roche Applied Science) in 1× PBT while rocking followed by incubation for 1–2 h with anti-digoxigenin-AP Fab fragments (1:2000, Roche Applied Science). Following eight 10-min washes in 1× PBT while shaking and two 10-min rinses in AP buffer (50 mm MgCl2, 100 mm NaCl, 100 mm Tris, pH 9.5, 1 mm levamisole, 0.1% Tween 20), the nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate color substrates (Roche Applied Science) were used to detect the hybridized probes. Reaction was stopped by several washes with 1× PBT while shaking. Embryos can be stored in 1× PBT buffer at 4 °C or be dehydrated step by step (1 × 5 min 40%, 70%, and 96% ethanol) while shaking and embedded in Canada balsam (Roth) or 100% glycerin (previous incubation in 70% glycerin in H2O for 24 h). Injection of cDNA into Xenopus Oocytes—Ovarian tissue was taken from anesthetized female Xenopus laevis (Nasco, Fort Atkinson, WI), and oocytes were released from the follicle tissue with collagenase (Sigma, 2 mg/ml). Stage V oocytes were selected by hand and plated individually into the conical wells of a 96-microtiter plate (Greiner, Frickenhausen, Germany) filled with modified Barth's medium containing (in mm): NaCl 88, NaHCO3 2.4, KCl 1, Ca(NO3)2 0.33, CaCl2 0.41, MgSO4 0.82, Tris/HCl 5 (pH 7.4, 200 mosmol/kg) (23Gurdon J.B. Wickens M.P. Methods Enzymol. 1983; 101: 370-386Crossref PubMed Scopus (195) Google Scholar). Oocytes were seeded with their animal (brown) pole facing up so that the nucleus is located just underneath the cell membrane (24Dumont J.N. J. Morphol. 1972; 136: 153-179Crossref PubMed Scopus (1419) Google Scholar). This facilitated intranuclear injection of cDNA that has been described before (25Ballivet M. Nef P. Couturier S. Rungger D. Bader C.R. Bertrand D. Cooper E. Neuron. 1988; 1: 847-852Abstract Full Text PDF PubMed Scopus (95) Google Scholar). We used a semi-automated system, the Roboocyte (Multi Channel Systems, Reutlingen, Germany) whose features have been described elsewhere (26Schnizler K. Kuster M. Methfessel C. Fejtl M. Receptors Channels. 2003; 9: 41-48Crossref PubMed Scopus (56) Google Scholar). Varying concentrations of cDNA between 40 and 100 ng/μl gave rise to reproducible expression levels and channel properties. After injection, cells were then incubated for 2–5 days at 19 °C in Barth's medium with gentamicin (50 μg/ml), and functionally expressing cells were identified with the Roboocyte. Two-electrode Voltage Clamp Experiments—Electrophysiological experiments on oocytes were carried out using the two-electrode voltage clamp method (27Stuhmer W. Methods Enzymol. 1992; 207: 319-339Crossref PubMed Scopus (261) Google Scholar). The standard extracellular superfusion solution was normal frog Ringer's solution containing (in mm): NaCl 115, KCl 2.5, CaCl2 1.8, HEPES 10 (pH 7.2, 240 mosmol/kg). Where stated the pH of the solutions was altered by addition of either NaOH or HCl and routinely checked before and during experiments. Functionally expressing oocytes were identified with the Roboocyte by clamping the oocytes to –80 mV and superfusion with a frog Ringer's solution of pH 9. Further electrophysiological and pharmacological experiments were carried out on a manual set up. Cells were penetrated with two microelectrodes filled with 3 m KCl, usually clamped to –80 mV with a voltage clamp amplifier (TEC01/02, npi, Tamm, Germany), and the membrane currents were recorded. If not stated differently, recordings were performed at a holding potential of –80 mV and a sampling rate of 20 Hz. Substances were delivered from two reservoirs reaching the cell 7 s after valve opening and exchanging the solution in the recording chamber within 2 s. Data acquisition and analysis were performed with Pulse+Pulsefit software (HEKA Elektronik GmbH, Lambrecht, Germany). All measurements were carried out at room temperature (23–28 °C) except those investigating temperature-dependent effects. For those, the glass-enclosed temperature sensor of a digital thermometer (Mawitherm, Germany) was positioned near the oocyte into the flowing stream of the extracellular solution. Cell Culture and Transfection of Sf9 Cells for Patch-clamping Experiments—Sf9 cells were grown at 26 °C in Sf-900 II SFM (serum-free medium) (Invitrogen) supplemented with 10 μg/ml gentamycin (Invitrogen). Semiconfluent cells were transfected in 24-well dishes (Nunc) on 12-mm glass coverslips by using the non-liposomal Fu-GENE 6 transfection reagent (Roche Applied Science) according to the manufacturer's instructions. For the transfection, 1 μg per dish of plasmids pIE1–3-pHCl-A, -B, or -C was used. Therefore the pCT19189A–C inserts were cloned SacII/NruI into the multicloning site of the insect expression vector pIE1–3 (Novagen). Efficiency of transfection, typically <20%, was checked by cotransfection of 0.5 μg of pIE1–3-EGFP. For this purpose, EGFP was taken from pEGFP-N1 (BD Biosciences Clontech, Palo Alto, CA) and cloned into the SacII/NotI site of pIE1–3. Electrophysiological experiments were done 24–48 h after transfection. Whole Cell Voltage Clamp Experiments on Sf9 Cells—Membrane currents of EGFP-expressing Sf9 cells cotransfected with one of the pHCl splice variants were recorded in the whole cell configuration of the patch clamp technique (28Hamill O.P. Marty A. Neher E. Sakmann B. Sigworth F.J. Pflugers Arch. 1981; 391: 85-100Crossref PubMed Scopus (15119) Google Scholar). Application of test substances and bath solutions of various pH were applied using the U-tube-reversed-flow technique (29Fenwick E.M. Marty A. Neher E. J. Physiol. 1982; 331: 577-597Crossref PubMed Scopus (579) Google Scholar) with an application time of 1–2 s at intervals of 1 min. The perfusion chamber had a volume of ∼0.5 ml and was continuously perfused (flow rate 3 ml/min) with external bath solution driven by gravity. The standard external bath solution contained (in mm): 150 NaCl, 4 KCl, 2 MgCl2, 2 CaCl2, 10 Hepes (pH 7.3 adjusted with 1 n NaOH, 320 mosmol/kg). The pipette solution contained (in mm): 150 KCl, 10 K-EGTA, 10 Hepes (pH 7.3 adjusted with 1 n KOH, 320 mosmol/kg). For pH-variation experiments, the external bath solution was adjusted to pH 6.1 with 1 n HCl. In the case of pH 8.6 Tris buffer was used instead of Hepes buffer. For chloride exchange experiments, the pipette solution contained (in mm): 120 KF, 30 KCl, 10 K-EGTA, 10 Hepes (pH 7.3 adjusted with 1 n KOH, 320 mosmol/kg). Microelectrodes were pulled from borosilicate glass capillaries (external diameter 1.6 mm, Hilgenberg, Malsfeld, Germany) on a Zeitz Puller. The resistance of the fire-polished pipettes was 4–7 megohms using the internal and external solutions described above. All experiments were carried out at room temperature (22–25 °C). Currents were measured with an L/M-EPC 7 patch clamp amplifier (HEKA Elektronik GmbH, Lambrecht, Germany). After the giga-seal formation, the EPC 7 circuitry was used to minimize the fast capacitance transients. No compensation was made for the series resistance after the whole cell configuration was obtained. The holding potential was –70 mV unless otherwise stated. The analog signals were low-pass (Bessel) filtered at 3.15 kHz (whole cell measurements) and digitized at 1 kHz. For recording and analysis the PClamp software (Axon Instruments, version 6.03) was used. Drugs—Stock solution in Me2SO were diluted to various concentrations into normal Ringer's solution of the following compounds: picrotoxin (50 mm), capsaicin (100 mm), fipronil (100 and 10 mm), ivermectin (10 mm), avermectin B1a (major component of ivermectin, 1 mm), histamine (100 mm), dopamine (10 mm), octopamine (100 mm), and glycine (100 mm). 1 and 2% Me2SO did not have a significant effect on the membrane current of pHCl-injected oocytes or Sf9 cells at pH 7.2. Statistics—Data are shown as mean ± S.D. Sequence Analysis of the Putative Novel Invertebrate LGIC— The genomic region around the gene CG6112 that encodes a putative novel type of invertebrate ligand-gated ion channel was examined for coding regions and deduced transcripts homologous to known Drosophila ligand-gated ion channel subunit sequences. This analysis led to a postulated mRNA sequence that was experimentally proved to exist by RT-PCR and sequencing. The longest transcript identified experimentally in this way encompasses nearly the complete open reading frame of the postulated transcript except for a few nucleotides at the 5′ end. The originally found cDNA was named pHCl according to the later identified features of the expressed channel (pH-sensitive chloride channel) has an open reading frame of 1464 nucleotides that predicts a protein of 487 amino acids (56 kDa). The extracellular N terminus consists of 277 amino acids in toto, starts with a signal peptide of 18 amino acids (30Nielsen H. Engelbrecht J. Brunak S. Von Heijne G. Protein Eng. 1997; 10: 1-6Crossref PubMed Scopus (4923) Google Scholar) followed by the conserved Cys-bridge (positions 195 and 209) and the four predicted transmembrane regions (M1-M4) conserved in ligand gated-chloride channels (Fig. 1A). A hydrophobicity plot detects three hydrophobic regions in the central part and one at the C-terminal part that fit to the location of M1–M4 in other LGICs (data not shown). The putative pore forming M2 region of pHCl is similar to the M2 region of other ligand-gated chloride channels, suggesting that the pHCl pore is chloride-selective also (Fig. 1B). As in other LGICs consensus sequences for putative N-glycosylation sites (positions 135, 180, 250, 263, and 336) and a protein kinase C-phosphorylation site (position 383) can also be detected (Fig. 1A). A putative orthologous gene exists in Anopheles gambiae; in addition to that, pHCl shows the greatest homology to invertebrate glutamate, teleosts, and mammalian glycine receptor subunits and exhibits a considerable amino acid identity with the D. melanogaster glutamategated (28%), the histamine-gated (23%), and the Rattus norvegicus α3-glycine-gated chloride channels (24%), respectively (Fig. 1A). However, a tree constructed of the known and postulated amino acid sequences of Drosophila LGICs shows that the pHCl protein does not fit into the GABA, glutamate, or histamine groups of LGIC and forms a sub-branch of its own (Fig. 2). Sequencing of the cloned cDNAs revealed the existence of several splice variants (pHCl-A, pHCl-B, and pHCl-C). We identified three sites of different splicing that can theoretically generate a variety of eight different splice variant combinations. In the N-terminal region (positions 68–92, Fig. 1A), a stretch of 25 amino acids is present (Variant 1, pHCl-A and pHCl-B) or lacking (pHCl-C) due to the presence or absence of an exon in the mRNA. In the region located at M1–M2, at the splicing site 2, pHCl-C differs at five positions due to the alternative use of an exon in the mRNA (Variant 2, Fig. 1A). In the cytoplasmic loop between M3 and M4, pHCl-A differs at a stretch of 17 amino at the splicing site 3. In the variants pHCl-B and pHCl-C, the stretch is absent due to the usage of different splice sites (positions 385–401, Fig. 1A). Localization and Stage-specific Expression of Splice Variants—To test if the mRNAs for these splice variants are expressed in a stage-specific expression pattern, we performed RT-PCR with splice variant-specific primer pairs (Fig. 3). In all tested developmental stages (egg, larvae, pupae, and adult fly) of Drosophila, the expression of the different variants pHCl-A, -B, and -C was detected with apparently no variations depending on the developmental stage and the type of the splice variant. To locate the expression of pHCl in different tissues qualitatively, whole mount in situ hybridization with 9- to 12-h old embryos and larvae I was performed (Fig. 4). Drosophila embryos as well as larvae I (Fig. 4, A–D) showed a strong expression of pHCl in the neural cord and a weaker expression in the hindgut (Fig. 4, B and C).Fig. 4Whole mount in situ hybridization with D. melanogaster embryos and larvae I. Antisense pHCl-A RNA probes labeled with digoxigenin-UTP detected high expression levels in the central nervous system/neural cord (A–D) together with a particular hybridization signal in the hindgut (B and C). The negative controls, sense pHCl-A RNA probes, showed no hybridization signals at all (E and F). Antisense probes: A, embryo lateral view; B, embryo dorsal; C, larvae I lateral; D, embryo ventral. Sense probes: E, embryo ventral; F, embryo lateral. Scale bar: 100 μm; nt: neural tube; hg: hindgut.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Electrophysiological Characterization of pHCl Homomers— Oocytes injected with cDNA of one of the pHCl splice variants (pHCl-A, pHCl-B, or pHCl-C) exhibit pH-sensitive currents that are not found in non-injected controls. Changing the pH of the extracellular solution from pH 7.2 to 5.8 strongly reduced the membrane current, whereas changing it to a more basic pH of 9.0 evoked a non-desensitizing membrane current in pHCl-A-expressing oocytes (Fig. 5A). The splice variants pHCl-B and pHCl-C showed the same qualitative dependence of the current on the extracellular pH when expressed in oocytes (data not shown). The pHCl-A splice variant expressed most reliably in Xenopus oocytes and the electrophysiological characterization was therefore concentrated on this splice variant. All three pHCl-splice variants could also be functionally expressed in Sf9 cells, respectively, and were activated by basic and inhibited by acidic extracellular pH (Fig. 5B). The membrane current of non-transfected Sf9 cells showed no sensitivity to the pH of the extracellular solution. As Fig. 6 shows, the membrane current in pHCl-A-expressing oocytes was half-maximal at pH 7.33 ± 0.16. In normal frog Ringer's solution, the membrane current of pHCl-A-expressing oocytes was significantly higher than that of non-injected controls indicating that an additional conductance exists at pH 7.2 due to expression of pHCl-A (–777 ± –594 nA (n = 58) versus –136 ± –133 nA (n = 28)). We also observed that oocytes kept in Barth's solution of pH 6.0 remained longer viable than those kept at pH 7.2.Fig. 6Dependence of the membrane current of pHCl-A-expressing oocytes on the pH of the extracellular solution. Current amplitudes were referred to the amplitude induced by changing the pH from 7.2 (normal frog Ringer's) to pH 8 after subtraction of the current measured at pH 5.83. Data points were fitted by I/Imax = 1/(1 + (EC50/x)n) yielding a half-maximal activation at a H+ concentration of 4.71 × 10–8 ± 7.58 × 10–9 mol, which corresponds to a pH of 7.33 ± 0.16 and a Hill coefficient of 1.07 ± 0.18 (n = 3–5 per data point).View Large Image Figure ViewerDownload Hi-res image Download (PPT) The current-voltage relationship of the additional membrane current in pHCl-A-expressing oocytes activated by enhancing the pH of the extracellular solution is slightly rectifying and has a reversal potential of –41 ± 5mV(n = 16) in normal frog Ringer's solution (Fig. 7). This is in the range of the reversal potential of –53 mV for chloride ions calculated by the Nernst equation assuming an intracellular chloride concentration of 15 mm. Reducing the extracellular chloride concentration to 36.3 and 12.1 mm shifts the reversal potential of the pH-induced current to more positive potentials (–28 ± 14 mV, n = 9 and –12 ± 17 mV, n = 9). To maintain a constant offset potential at the bath electrode we used agar bridges for measurements with low extracellular chloride concentrations. The deviation of the measured from the calculated reversal pote