Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Arabidopsis GH3.12 (PBS3) Conjugates Amino Acids to 4-Substituted Benzoates and Is Inhibited by Salicylate

2009; Elsevier BV; Volume: 284; Issue: 15 Linguagem: Inglês

10.1074/jbc.m806662200

ISSN

1083-351X

Autores

Rachel A. Okrent, Matthew D. Brooks, Mary C. Wildermuth,

Tópico(s)

Plant Gene Expression Analysis

Resumo

Salicylate (SA, 2-hydroxybenzoate) is a phytohormone best known for its role as a critical mediator of local and systemic plant defense responses. In response to pathogens such as Pseudomonas syringae, SA is synthesized and activates widespread gene expression. In gh3.12/pbs3 mutants of Arabidopsis thaliana, induced total SA accumulation is significantly compromised as is SA-dependent gene expression and plant defense. AtGH3 subfamily I and II members have been shown to conjugate phytohormone acyl substrates to amino acids in vitro, with this role supported by in planta analyses. Here we sought to determine the in vitro biochemical activity and kinetic properties of GH3.12/avrPphB susceptible 3 (PBS3), a member of the uncharacterized AtGH3 subfamily III. Using a novel high throughput adenylation assay, we characterized the acyl substrate preference of PBS3. We found PBS3 favors 4-substituted benzoates such as 4-aminobenzoate and 4-hydroxybenzoate, with moderate activity on benzoate and no observed activity with 2-substituted benzoates. Similar to known GH3 enzymes, PBS3 catalyzes the conjugation of specific amino acids (e.g. Glu) to its preferred acyl substrates. Kinetic analyses indicate 4-aminobenzoate and 4-hydroxybenzoate are preferred acyl substrates as PBS3 exhibits both higher affinities (apparent Km = 153 and 459 μm, respectively) and higher catalytic efficiencies (kcat/Km = 0.0179 and 0.0444 μm–1 min–1, respectively) with these acyl substrates compared with benzoate (apparent Km = 867 μm, kcat/Km = 0.0046 μm–1 min–1). Notably, SA specifically and reversibly inhibits PBS3 activity with an IC50 of 15 μm. This suggests a general mechanism for the rapid, reversible regulation of GH3 activity and small molecule cross-talk. For PBS3, this may allow for coordination of flux through diverse chorismate-derived pathways. Salicylate (SA, 2-hydroxybenzoate) is a phytohormone best known for its role as a critical mediator of local and systemic plant defense responses. In response to pathogens such as Pseudomonas syringae, SA is synthesized and activates widespread gene expression. In gh3.12/pbs3 mutants of Arabidopsis thaliana, induced total SA accumulation is significantly compromised as is SA-dependent gene expression and plant defense. AtGH3 subfamily I and II members have been shown to conjugate phytohormone acyl substrates to amino acids in vitro, with this role supported by in planta analyses. Here we sought to determine the in vitro biochemical activity and kinetic properties of GH3.12/avrPphB susceptible 3 (PBS3), a member of the uncharacterized AtGH3 subfamily III. Using a novel high throughput adenylation assay, we characterized the acyl substrate preference of PBS3. We found PBS3 favors 4-substituted benzoates such as 4-aminobenzoate and 4-hydroxybenzoate, with moderate activity on benzoate and no observed activity with 2-substituted benzoates. Similar to known GH3 enzymes, PBS3 catalyzes the conjugation of specific amino acids (e.g. Glu) to its preferred acyl substrates. Kinetic analyses indicate 4-aminobenzoate and 4-hydroxybenzoate are preferred acyl substrates as PBS3 exhibits both higher affinities (apparent Km = 153 and 459 μm, respectively) and higher catalytic efficiencies (kcat/Km = 0.0179 and 0.0444 μm–1 min–1, respectively) with these acyl substrates compared with benzoate (apparent Km = 867 μm, kcat/Km = 0.0046 μm–1 min–1). Notably, SA specifically and reversibly inhibits PBS3 activity with an IC50 of 15 μm. This suggests a general mechanism for the rapid, reversible regulation of GH3 activity and small molecule cross-talk. For PBS3, this may allow for coordination of flux through diverse chorismate-derived pathways. Mutant screens in Arabidopsis have successfully identified many components of plant disease resistance pathways, with a number of these mutants exhibiting altered phytohormone synthesis, perception, or signaling (1Glazebrook J. Curr. Opin. Plant Biol. 2001; 4: 301-308Crossref PubMed Scopus (570) Google Scholar). The pbs3-1 ethyl methanesulfonate mutant was first isolated in a screen for enhanced susceptibility to avirulent Pseudomonas syringae pv. tomato DC3000, carrying the effector avrPphB, resistance to which is mediated by the plant resistance (R) gene RPS5 in Arabidopsis (2Warren R.F. Merritt P.M. Holub E. Innes R.W. Genetics. 1999; 152: 401-412PubMed Google Scholar). Our subsequent analysis with Roger Innes revealed that the pbs3-1 mutant is also more susceptible to virulent P. syringae strains, including P. syringae pv. maculicola ES4326, suggesting a more general role for PBS3 than in directly mediating effector-R gene interactions (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). Furthermore, in response to P. syringae pathovars, the pbs3-1 EMS mutant and the pbs3-2 T-DNA insertion line exhibited reduced total SA accumulation and expression of the SA-dependent pathogenesis-related gene PR1 (At2g14610) in comparison with wild type plants (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). The mutation in pbs3-1 was then mapped and cloned, and PBS3 2The abbreviations used are: PBS3, avrPphB susceptible 3 (GH3.12); AA, amino acid; BA, benzoate; 4-HBA, 4-hydroxybenzoate; FW, fresh weight; IAA, indole-3-acetate; JA, jasmonate; pABA, para-aminobenzoate; SA, salicylate; MeSA, methyl salicylate; SAG, SA glucoside; ICS1, isochorismate synthase 1; IPL, isochorismate pyruvate lyase; Q-TOF, quadrupole time of flight; MS/MS, tandem mass spectrometry; DTT, dithiothreitol; HPLC, high pressure liquid chromatography; 4-AEtBA, 4-aminoethylbenzoate; LC, liquid chromatography; INA, 2,6-dichloroisonicotinate. was found to be AtGH3.12 (At5g13320), a member of the AtGH3 multigene family (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). The first GH3 gene was characterized by Guilfoyle and co-workers (4Hagen G. Kleinschmidt A. Guilfoyle T. Planta. 1984; 162: 147-153Crossref PubMed Scopus (184) Google Scholar) as an early auxin-responsive gene from Glycine max. Homologs have since been identified in many other plant species and in bacteria (5Terol J. Domingo C. Talon M. Gene (Amst.). 2006; 371: 279-290Crossref PubMed Scopus (113) Google Scholar). The GH3 family is part of the broader acyl-adenylate/thioester-forming enzyme family, also called the firefly luciferase family (6Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (523) Google Scholar). This superfamily consists of enzymes that catalyze a variety of reactions with a common first step as follows: the transfer of AMP from ATP to the carboxylic acid group of an acyl substrate, forming an activated acyl-adenylate intermediate. GH3 enzymes are unique within this superfamily in that amino acid conjugation occurs in the absence of a thioester intermediate. Fig. 1 shows the reaction catalyzed by GH3 enzymes, with benzoate as the acyl substrate. To date, biochemical activity has only been demonstrated for select plant GH3 enzymes (discussed below). Furthermore, mechanistic analyses are hampered by the lack of sequence conservation between GH3 and other acyl-adenylase/thioester-forming superfamily members and no structural information for any GH3 family member. The known acyl substrate specificity of the 19 Arabidopsis AtGH3 proteins corresponds to their phylogenetic relationship (6Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (523) Google Scholar) that divides the family into three groups (supplemental Fig. S1). Group I includes JAR1, which catalyzes the formation of JA-Ile, an active form of the phytohormone jasmonate (JA) (7Staswick P.E. Tiryaki I. Plant Cell. 2004; 16: 2117-2127Crossref PubMed Scopus (789) Google Scholar). JA-Ile promotes the interaction of the F-box protein COI1 with JAZ JA repressor family members (8Thines B. Katsir L. Melotto M. Niu Y. Mandaokar A. Liu G. Nomura K. He S.Y. Howe G.A. Browse J. Nature. 2007; 448: 661-665Crossref PubMed Scopus (1672) Google Scholar). This interaction results in degradation of the JAZ repressor by the ubiquitin ligase-dependent 26 S proteasome followed by the activation of the associated JA-dependent responses (9Chini A. Fonseca S. Fernandez G. Adie B. Chico J.M. Lorenzo O. Garcia-Casado G. Lopez-Vidriero I. Lozano F.M. Ponce M.R. Micol J.L. Solano R. Nature. 2007; 448: 666-671Crossref PubMed Scopus (1599) Google Scholar, 10Yan Y. Stolz S. Chetelat A. Reymond P. Pagni M. Dubugnon L. Farmer E.E. Plant Cell. 2007; 19: 2470-2483Crossref PubMed Scopus (517) Google Scholar, 11Chung H.S. Koo A.J. Gao X. Jayanty S. Thines B. Jones A.D. Howe G.A. Plant Physiol. 2008; 146: 952-964Crossref PubMed Scopus (338) Google Scholar). Group II is composed of several proteins that catalyze the formation of auxin-amino acid conjugates (12Staswick P.E. Serban B. Rowe M. Tiryaki I. Maldonado M.T. Maldonado M.C. Suza W. Plant Cell. 2005; 17: 616-627Crossref PubMed Scopus (753) Google Scholar). Conjugation of indole-3-acetate (IAA) with Asp and Glu targets the phytohormone IAA for catabolism, whereas Ala and Leu conjugates of IAA appear to be inactive storage forms of IAA (13Woodward A.W. Bartel B. Ann. Bot. 2005; 95: 707-735Crossref PubMed Scopus (1604) Google Scholar). IAA directly binds to TIR1, the F-box subunit of SCFTIR1, enabling its interaction with the Aux/IAA family of auxin transcriptional repressors, degradation of the repressor, and activation of IAA-associated responses (14Dharmasiri N. Dharmasiri S. Estelle M. Nature. 2005; 435: 441-445Crossref PubMed Scopus (1532) Google Scholar, 15Kepinski S. Leyser O. Nature. 2005; 435: 446-451Crossref PubMed Scopus (1282) Google Scholar). In contrast, IAA-amino acid conjugates are too bulky to fit into the auxin binding pocket of TIR1 and do not promote complex formation between TIR1 and Aux/IAA repressors. 3M. Estelle, personal communication. Group III, which includes PBS3 (AtGH3.12), contains proteins for which the substrate specificity has not yet been reported, as these proteins were inactive on tested substrates (6Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (523) Google Scholar). The amino acid conjugation reaction catalyzed by characterized GH3 enzymes plays a critical role in plant hormone homeostasis and plant-microbe interactions (7Staswick P.E. Tiryaki I. Plant Cell. 2004; 16: 2117-2127Crossref PubMed Scopus (789) Google Scholar, 13Woodward A.W. Bartel B. Ann. Bot. 2005; 95: 707-735Crossref PubMed Scopus (1604) Google Scholar). Not only do plants regulate active phytohormone forms through amino acid conjugation, but some plant pathogens also manipulate phytohormone conjugation and response. For example, P. syringae pv. savastanoi encodes an IAA-AA synthetase that is required for full virulence on oleander (16Glass N.L. Kosuge T. J. Bacteriol. 1988; 170: 2367-2373Crossref PubMed Google Scholar). P. syringae pv. tomato DC3000 and P. syringae pv. maculicola ES4326 synthesize the phytotoxin coronatine, an analog of JA-Ile, that activates JA-Ile-dependent responses and is required for full virulence (17Brooks D.M. Hernandez-Guzman G. Kloek A.P. Alarcon-Chaidez F. Sreedharan A. Rangaswamy V. Penaloza-Vazquez A. Bender C.L. Kunkel B.N. Mol. Plant-Microbe Interact. 2004; 17: 162-174Crossref PubMed Scopus (169) Google Scholar). Notably, the HopW1-1 effector of P. syringae pv. maculicola ES4326 targets PBS3, altering host SA signal transduction pathways (18Lee M.W. Jelenska J. Greenberg J.T. Plant J. 2008; 54: 452-465Crossref PubMed Scopus (66) Google Scholar). Because PBS3 is a GH3 protein and pbs3 mutants exhibit SA-deficient phenotypes, we proposed that PBS3 acts upstream of SA, on SA, or on a compound that could compete with SA (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). In the last case, such a compound might bind to a metabolic or regulatory enzyme that normally binds SA (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). Here we systematically examine the acyl substrate and amino acid preference of PBS3 followed by determination of the kinetic and catalytic properties of PBS3. In addition, for the first time for any GH3 member, we assess the influence of putative inhibitors on enzymatic activity. The impact of each of the two point mutations in the lack of function pbs3-1 EMS mutant (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar) is also ascertained. Together, these findings provide a framework to explore the role of PBS3 in pathogen-induced SA accumulation and disease resistance. Furthermore, they support an underexplored and significant role for 4-substituted benzoates in plant-pathogen interactions. Materials and General Protocols-All specialty reagents and chemicals were purchased from Sigma unless otherwise specified. HPLC-grade solvents (EMD Biosciences) were employed in the HPLC analyses. TLC plates were silica gel 60 with F254 from EMD Biosciences. Commonly utilized protein and molecular biology reagents and protocols were prepared and used as described in Ref. 19Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York2005Google Scholar. AtPBS3 Cloning and Purification-The AtPBS3 coding sequence was amplified from cDNA isolated from Arabidopsis thaliana ecotype Col-0 and inserted into a pET-28a vector (Novagen) as an NdeI/BamHI fragment using forward primer 5′tcatgacatatgaagccaatcttcgata and reverse primer 5′cacgtggtgggatcctcaaatactgaagaatt. The resulting construct, pET-His-PBS3, contains an N-terminal histidine tag fused to the coding region of AtPBS3. Crude cell extracts were prepared from a 2-liter culture of Escherichia coli Rosetta2 (DE3) cells transformed with pET-His-PBS3 grown in TB media containing 0.2% glucose, 50 μg/ml kanamycin, and 30 μg/ml chloramphenicol. Cultures were grown at 37 °C to mid-log phase and shifted to 18 °C, and 0.1 mm isopropyl 1-thio-β-d-galactopyranoside was added to induce His-PBS3 synthesis. Cells were harvested after shaking overnight (∼25 g wet weight) and stored at –20 °C. His-PBS3 was then purified using nickel-nitrilotriacetic acid His-Bind resin (Novagen) according to manufacturer's directions. His-PBS3 was the only visible protein when 10 μg of this eluant was resolved by SDS-PAGE and visualized using Coomassie Blue. Thrombin (Novagen) was used to cleave the histidine tag. As His-PBS3 and thrombin-cleaved PBS3 displayed similar activity on a set of five acyl substrates, His-PBS3 was utilized unless specified. Protein concentrations were determined by a Bradford assay modified for 96-well plate format using Coomassie Blue G-250 (EM Biosciences) with bovine serum albumin as the standard. Aliquots of the purified recombinant PBS3 proteins (5.3–9.5 mg/ml in 100 mm Tris, pH 7.7, 10% glycerol, 1 mm DTT) were stored at –80 °C. The same batch of enzyme was used for each set of assays reported in a single figure or table, with assays repeated with enzyme from at least one other batch to confirm results. In all assays, the appropriate enzyme concentrations were utilized such that velocity was linear with increasing enzyme concentration. Generation and Purification of PBS3 Mutants-Amino acid substitutions were introduced into the pET-His-PBS3 plasmid using the QuikChange II site-directed mutagenesis kit (Stratagene) with forward primer 5′ccacgtgttgtttggtaatgaaggagtcgcttgataatgtttac and reverse primer 5′gtaaacattatcaagcgactccttcattaccaaacaacacgtgg to make the E502R mutation and forward primer 5′gatgtcgattcaaagacggatcgaccgggcctctcgagataagagtggtg and reverse primer 5′caccactcttatctcgagaggcccggtcgatccgtctttgaatcgacatc to make the I519T mutation. The double mutant was made using the pET-His-I519K plasmid with the E502R forward and reverse primers. The His-tagged single and double mutant proteins were purified as described for wild type PBS3, above. Adenylation Reaction-His-PBS3 adenylation activity was monitored spectrophotometrically at 340 nm by coupling the production of pyrophosphate to oxidation of NADH using pyrophosphate reagent (Sigma) (20O'Brien W.E. Anal. Biochem. 1976; 76: 423-430Crossref PubMed Scopus (62) Google Scholar). The reagent contained the coupling enzymes fructose-6-phosphate kinase, aldolase, triose-phosphate isomerase, glycerophosphate dehydrogenase, and appropriate substrates and cofactors, including NADH. The pyrophosphate reagent was reconstituted in 4 ml of double distilled H2O and used at a volume of 65 μl per 200-μl reaction. For the screen of substrates, reaction mixtures (200 μl) were in 45 mm imidazole, pH 7.4, and contained 5.0 mm MgCl2, 2.5 mm ATP, 1 mm DTT, 0.1–10 mm substrate, and 100 μg of His-PBS3 enzyme in addition to the pyrophosphate reagent. For determination of kinetic parameters for ATP, reactions contained 50 μg/ml His-PBS3 enzyme, pyrophosphate reagent, 1 mm DTT, and 10 mm acyl substrate. The concentration of ATP was varied while either (a) maintaining a 1.5:1 Mg2+ to ATP ratio or (b) with 10 mm MgCl2. Three replicates were performed for each substrate or concentration value. The reactions were initiated with the addition of substrate to a 96-well plate preheated to 30 °C and analyzed using a Spectromax Plus microplate spectrophotometer (Molecular Devices). The change in absorbance at 340 nm was measured every 10–15 s for at least 20 min and converted to velocity by least squares fitting of each curve using the accompanying program SOFTmax PRO 3.0 with manual assessment/confirmation of the linear range. The velocity of a no His-PBS3 control was subtracted; this velocity was on average 0.16 μm/min. An extinction coefficient of 6.22 μm–1 cm–1 for NADH was used to convert velocity values from milli-absorbance units/min to micromolar/min. Kinetic parameters were estimated by fitting initial velocity values to the Hanes equation (21Rudolph F.B. Fromm H.J. Methods Enzymol. 1979; 63: 138-159Crossref PubMed Scopus (83) Google Scholar). Amino Acid Conjugation Reaction (Full Reaction)-Reaction mixtures (200 μl) were in 50 mm Tris-HCl, pH 8.5, and contained 5.0 mm MgCl2, 2.5 mm ATP, 1.0 mm DTT, 1.0 mm acyl substrate, 1.0 mm amino acid, and 100 μg/ml His-PBS3 enzyme. Reactions were incubated at 30 °C for 2 h and monitored by TLC and/or HPLC. Reaction mixtures and standards were spotted on silica gel 60 F254 plates (EMD Biosciences) and developed in either 30:60:10 dichloromethane/ethyl acetate/formic acid or 8:1:1 isopropyl alcohol/ammonium hydroxide/water (for basic and hydrophilic amino acids). The method used to detect the conjugates varied by substrate. pABA conjugates were detected by staining TLC plates with vanillin reagent (6% (w/v) vanillic acid and 1% sulfuric acid in ethanol) and by visualizing TLC plates under short wavelength UV. 4-HBA, vanillic acid, and trans-cinnamic acid conjugates were detected by visualizing TLC plates under short wavelength UV light. BA conjugates were detected by HPLC using a UV detector at 233 nm. HPLC conditions are the same as those used in the Km determination (see below). SA was analyzed by TLC visualized under short wavelength UV light and by HPLC using a fluorescence detector (ex305/em407 nm); however, no spots or peaks associated with SA-conjugates were detected. Km Determinations-Reaction mixtures (200 μl) were in 50 mm Tris-HCl, pH 8.5, and contained 5.0 mm MgCl2, 5.0 mm ATP, 1 mm DTT, 10 mm glutamate, varying concentrations of 4-HBA, pABA, or BA, and 50 μg/ml His-PBS3 (reaction with 4-HBA) or 125 μg/ml His-PBS3 (reactions with pABA and BA). Acyl substrate concentrations ranged from 50 μm to 5 mm. Reactions were quenched every 2 min by diluting the reaction mixture 10-fold into 2.5% HCl. Samples were filtered through a 0.2-μm Millex-LG syringe filter (Millipore), and a 50-μl aliquot was injected into a Shimadzu SCL-10AVP series HPLC system equipped with a Shimadzu SPD-10AVP photodiode array detector and a Shimadzu RF-10AXL fluorescence detector. A 5-μm, 15 cm × 4.6-mm inner diameter Supelcosil LC-ABZPlus column (Supelco) preceded by a LC-ABZ-Plus guard column was pre-equilibrated in 5% acetonitrile with 25 mm potassium phosphate buffer (initial HPLC buffer), pH 2.5, at a flow rate of 1.0 ml/min. The elution program and detection method varied by substrate. For BA, the initial HPLC buffer was run for 10 min and then changed to 52% acetonitrile and 48% 25 mm potassium phosphate buffer over 12 min. Under these conditions, BA-Glu eluted at 15.5 min and BA at 19 min. Elution was monitored by UV absorbance at 233 nm. Authentic samples were used to generate calibration curves for BA (y = 0.0397x) and BA-Glu (TCI America; y = 0.0407x), with x in absorbance units and y in nanomolar compound. For pABA, pABA eluted at 7.5 min and pABA-Glu eluted at 5.0 min using the BA program. Elution was monitored by fluorescence at ex290/em340 nm. Authentic samples were used to generate calibration curves for pABA (y = 0.2585x) and pABA-Glu (y = 0.1045x), with x in fluorescence units and y in nanomolar compound). For 4-HBA, the initial HPLC buffer was run for 4 min and then changed to 52% acetonitrile and 48% 25 mm potassium phosphate buffer over 7 min. Elution was monitored by UV absorbance at 254 nm. An authentic sample of 4-HBA was used to generate a calibration curve (y = 0.0274x), and synthesized 4-HBA-Glu (see below) was used to generate a calibration curve (y = 0.0318x) with x in UV absorbance area units and y in nanomolar compound. Under these conditions, 4-HBA eluted at 9.7 min and 4-HBA-Glu eluted at 8.3 min. The reaction velocity with each substrate concentration was determined from a linear fit of four time points. Kinetic parameters were estimated by fitting initial velocity values to the Hanes equation as above, with data from at least six substrate concentrations. Nonlinear curve fitting using Synergy KaleidaGraph version 4.0 gave very similar results. Mass Spectrometry to Verify 4-HBA-Glu Formation-A 5-μm, 15-cm × 4.6-mm inner diameter Prevail C18 column (Alltech) preceded by a 7.5-cm × 4.6-mm guard column was pre-equilibrated in 5% acetonitrile with 25 mm formate buffer, pH 2.8 (initial HPLC buffer), at a flow rate of 1.0 ml/min. The initial buffer was run for 7 min and then changed to 52% acetonitrile over 15 min. The putative 4-HBA-Glu peak eluting at 11.3–11.9 min was collected and dried down under vacuum. This sample was rerun using our standard HPLC assay for verification. Samples for LC-MS analysis were resuspended in a 50:50 mixture of 25 mm ammonium formate and acetonitrile and analyzed using a Thermo Fisher Surveyor HPLC with a Phenomenex C18 2 × 150-mm column and a Thermo Fisher LCQ classic mass spectrometer at the Vincent Coates Foundation Mass Spectrometry Laboratory (Stanford University). LC-MS with electrospray ionization-positive ion analysis employed a C18 column with similar elution scheme. MS-MS fragmentation was performed on the putative dominant ion peak for further confirmation of compound identity. The sample was also analyzed by nanospray infusion on the Q-TOF mass spectrometer (Waters Micromass Q-TOF hybrid quadrupole time of flight) with MS-MS performed on 268.1 m/z. Synthesis of 4-HBA-Glu Standard-As 4-HBA-Glu is not commercially available, it was synthesized for calibration of the HPLC. Briefly, 4-acetoxybenzoic acid was converted to the acyl chloride and condensed with diethyl l-glutamate to form diethyl 4-acetoxybenzoyl-l-glutamate. The protecting groups were removed in base to yield 4-HBA-Glu as a white crystalline solid with 99% purity by HPLC. The structure was confirmed by 1H NMR and 13C NMR. See supplemental Method S1 for complete procedures and spectral data. Inhibition Studies-Inhibition of PBS3 amino acid conjugation was assessed with SA using our HPLC assay to monitor pABA-Glu formation. Reaction conditions were the same as for the Km experiment (above), with the addition of SA (5–600 μm). A pABA concentration equivalent to the Km (150 μm) was used. The adenylation assay was then used to measure the effect of potential inhibitors on adenylation velocity using pABA as the acyl substrate. Reaction mixtures (200 μl) were in 45 mm imidazole, pH 7.4, and contained 5.0 mm MgCl2, 5.0 mm ATP, 1 mm DTT, 150 μm pABA, 100 μg/ml His-PBS3 enzyme, 65 μl of pyrophosphate reagent reconstituted in 4.0 ml of double distilled H2O, and potential inhibitors. SA and MeSA were tested over a range of concentrations from 10 to 600 μm. We verified that the decreased velocity with SA was due to inhibition of PBS3 rather than of the coupled reactions by testing the effect of SA with PPi as a substrate; we observed no change in activity. Other potential inhibitors (INA, 2,4-DHBA, 3-HBA, IAA, and JA) were tested at 30 and 300 μm only. Potential Inhibition of ICS1-catalyzed SA Biosynthesis-To evaluate compounds as inhibitors of the AtICS1-catalyzed conversion of chorismate to isochorismate, a coupled spectrophotometric assay was used (22Strawn M.A. Marr S.K. Inoue K. Inada N. Zubieta C. Wildermuth M.C. J. Biol. Chem. 2007; 282: 5919-5933Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar). The conversion of chorismate to isochorismate was coupled to the oxidation of NADH through the coupling enzymes isochorismate pyruvate lyase (recombinant PchB), which converts isochorismate to pyruvate and SA, and lactic dehydrogenase (Sigma L1254), which converts pyruvate to lactate in an NADH-dependent fashion. The 200-μl reaction contained an effective chorismate concentration of 90 μm (apparent Km of AtICS1 for chorismate), 0.4 mm NADH, 0.833 μg/ml l-lactic dehydrogenase, 32.0 μg/ml PchB, and 10 μg/ml AtICS1 in 100 mm Tris, pH 7.7, with 10% glycerol, and 10 mm MgCl2. We assessed AtICS1 activity in duplicate for reactions with or without 200 μm 4-HBA, pABA, or pABA-Glu and for the appropriate no enzyme controls. We also performed these assays with 1 mm 4-HBA, pABA, or pABA-Glu. The Student's t test (α = 0.1) was used to evaluate whether any observed small changes in activity were statistically significant. Potential Inhibition of Isochorismate Pyruvate Lyase-To evaluate compounds as inhibitors of the isochorismate pyruvate lyase (IPL) reaction in which isochorismate is converted to SA, we employed a modified version of our coupled ICS spectrophotometric assay, described above. In this case, 50 μg/reaction of recombinant PchB was employed with 60 μm isochorismate, the approximate Km of our recombinant enzyme for isochorismate under our assay conditions. The reported apparent Km for purified P. aeruginosa PchB for isochorismate is 12.5 μm (23Gaille C. Kast P. Haas D. J. Biol. Chem. 2002; 277: 21768-21775Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). We assessed IPL activity in duplicate for reactions with or without 100 μm 4-HBA, pABA, or pABA-Glu and for the appropriate no enzyme controls. The Student's t test (α = 0.1) was used to evaluate whether any observed small changes in activity were statistically significant. Isochorismate was prepared and purified as in Ref. 22Strawn M.A. Marr S.K. Inoue K. Inada N. Zubieta C. Wildermuth M.C. J. Biol. Chem. 2007; 282: 5919-5933Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar. Determination of Acyl Substrates of PBS3-To explore the biochemical activity of PBS3, we overexpressed and purified recombinant His-tagged PBS3. We also developed a novel high throughput, 96-well format adenylation assay for use in determining putative acyl substrate(s) of PBS3. In this assay, the release of pyrophosphate, which occurs when the acyl substrate is adenylated to form the acyl substrate-AMP conjugate (Fig. 1), is coupled to the oxidation of NADH that can be measured spectrophotometrically (20O'Brien W.E. Anal. Biochem. 1976; 76: 423-430Crossref PubMed Scopus (62) Google Scholar). This allows for rapid kinetic assessment of the GH3 adenylation reaction that is not readily performed using standard radiolabeled PPi exchange assays. We report our findings using 1 mm acyl substrate to allow for comparison with previously reported GH3 acyl substrate surveys (6Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (523) Google Scholar, 12Staswick P.E. Serban B. Rowe M. Tiryaki I. Maldonado M.T. Maldonado M.C. Suza W. Plant Cell. 2005; 17: 616-627Crossref PubMed Scopus (753) Google Scholar). Assessments with 100 μm and/or 10 mm substrate were performed for substrates with moderate and low activity to ensure we had not missed the linear range of activity. We did not observed significant differences in the relative activities of PBS3 with these acyl substrates compared with our results using 1 mm substrate. The reduced accumulation of SA and expression of PR1 in response to P. syringae in pbs3 mutants suggested PBS3 might act upstream of SA, on SA, or on a compound that could compete with SA in binding (either as a substrate or modulator of activity) to an SA-binding metabolic or regulatory enzyme (3Nobuta K. Okrent R.A. Stoutemyer M. Rodibaugh N. Kempema L. Wildermuth M.C. Innes R.W. Plant Physiol. 2007; 144: 1144-1156Crossref PubMed Scopus (153) Google Scholar). Therefore, our initial screen consisted of three overlapping classes of commercially available compounds as follows: 1) phytohormones, including SA and the S

Referência(s)