Portal de Periódicos da CAPES

Anthocyanins Induce Cholesterol Efflux from Mouse Peritoneal Macrophages

2005; Elsevier BV; Volume: 280; Issue: 44 Linguagem: Inglês

10.1074/jbc.m505047200

1083-351X

Min Xia, Mengjun Hou, Huilian Zhu, Jing Ma, Zhihong Tang, Qing Wang, Yan Li, Dong-Sheng Chi, Xiaoping Yu, Ting Zhao, Pinghua Han, Xiaodong Xia, Wenhua Ling,

Lipid metabolism and disorders

It is widely accepted that stimulation of reverse cholesterol transport, the efflux of excess cholesterol from peripheral tissues and transferring it to the liver for biliary excretion, is becoming an important component in reducing excess cholesterol deposition in atherosclerotic plaques. The ATP-binding cassette transporter has been identified as a key regulator of macrophage cholesterol efflux and apoAI-mediated reverse cholesterol transport. In vivo studies have documented anthocyanins, a large group of naturally phenolic compounds rich in plants, possess substantial capacities in improving plasma cholesterol levels. In this study, we investigated the potential role of anthocyanins in modulating cholesterol efflux from mouse peritoneal macrophages and macrophage-derived foam cells and the possible molecular mechanism linking ABCA1 to cholesterol efflux. Incubation of the mouse peritoneal macrophages and macrophage-derived foam cells with cyanidin-3-O-β-glucoside and peonidin-3-O-β-glucoside led to dose-dependent (1–100 μm) induction in cholesterol efflux and ABCA1 mRNA expression, and this effect could be blocked by the ABCA1 inhibitor 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, disodium salt, and a general inhibitor of gene transcription actinomycin D. Treatment of the macrophages with anthocyanins also activated peroxisome proliferator-activated receptor γ, liver X receptor α mRNA expression, and their mediated gene expression. Addition of geranylgeranyl pyrophosphate ammonium salt or GW9662 markedly inhibited the anthocyanin-induced increase of ABCA1 gene expression and apoAI-mediated cholesterol efflux. These data demonstrated that anthocyanin induces cholesterol efflux from mouse peritoneal macrophages and macrophage-derived foam cells and that stimulation of cholesterol efflux by anthocyanin is mediated, at least in part, by peroxisome proliferator-activated receptor γ-liver X receptor α-ABCA1 signaling pathway activation. It is widely accepted that stimulation of reverse cholesterol transport, the efflux of excess cholesterol from peripheral tissues and transferring it to the liver for biliary excretion, is becoming an important component in reducing excess cholesterol deposition in atherosclerotic plaques. The ATP-binding cassette transporter has been identified as a key regulator of macrophage cholesterol efflux and apoAI-mediated reverse cholesterol transport. In vivo studies have documented anthocyanins, a large group of naturally phenolic compounds rich in plants, possess substantial capacities in improving plasma cholesterol levels. In this study, we investigated the potential role of anthocyanins in modulating cholesterol efflux from mouse peritoneal macrophages and macrophage-derived foam cells and the possible molecular mechanism linking ABCA1 to cholesterol efflux. Incubation of the mouse peritoneal macrophages and macrophage-derived foam cells with cyanidin-3-O-β-glucoside and peonidin-3-O-β-glucoside led to dose-dependent (1–100 μm) induction in cholesterol efflux and ABCA1 mRNA expression, and this effect could be blocked by the ABCA1 inhibitor 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, disodium salt, and a general inhibitor of gene transcription actinomycin D. Treatment of the macrophages with anthocyanins also activated peroxisome proliferator-activated receptor γ, liver X receptor α mRNA expression, and their mediated gene expression. Addition of geranylgeranyl pyrophosphate ammonium salt or GW9662 markedly inhibited the anthocyanin-induced increase of ABCA1 gene expression and apoAI-mediated cholesterol efflux. These data demonstrated that anthocyanin induces cholesterol efflux from mouse peritoneal macrophages and macrophage-derived foam cells and that stimulation of cholesterol efflux by anthocyanin is mediated, at least in part, by peroxisome proliferator-activated receptor γ-liver X receptor α-ABCA1 signaling pathway activation. Atherosclerosis (AS) 2The abbreviations used are: AS, atherosclerosis; Cy-3-g, cyanidin-3-O-β-glucoside; Pn-3-g, peonidin-3-O-β-glucoside; ABCA1, ATP-binding cassette transporter A1; PPARγ, peroxisome proliferator-activated receptor γ; LXR, liver X receptor; apoAI, apolipoprotein AI; BSA, bovine serum albumin; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; PBS, phosphate-buffered saline; DIDS, 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, disodium salt; GGPP, geranylgeranyl pyrophosphate ammonium salt; Ros, rosiglitazone; ANOVA, analysis of variance; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LXRE, liver X receptor-response element; AcLDL, acylated LDL. is a multifactorial cardiovascular disease, and its pathogenesis is not fully demonstrated (1Zaman A.G. Helft G. Worthley S.G. Badimon J.J. Atherosclerosis. 2000; 149: 251-266Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 2Ross R. N. Engl. J. Med. 1999; 340: 115-126Crossref PubMed Scopus (19274) Google Scholar). Many studies (3Berliner J.A. Navab M. Fogelman A.M. Frank J.S. Demer L.L. Edwards P.A. Watson A.D. Lusis A.J. Circulation. 1995; 91: 2488-2496Crossref PubMed Scopus (1587) Google Scholar, 4Ross R. Nature. 1993; 362: 801-809Crossref PubMed Scopus (9988) Google Scholar) suggested that macrophages played critical pathogenic roles in the formation of atherosclerotic lesions. Fatty streaks of atherosclerosis contain large numbers of macrophage foam cells derived from circulating monocytes that adhere to activated endothelium and migrate into the artery wall (5Steinberg D. Parthasarathy S. Carew T.E. Khoo J.C. Witztum J.L. N. Engl. J. Med. 1989; 320: 915-924Crossref PubMed Google Scholar). These cells subsequently differentiate into macrophages that express the scavenger receptor A gene, as well as other scavenger receptors that mediate the uptake of large amounts of cholesterol (6Krieger M. Herz J. Annu. Rev. Biochem. 1994; 63: 601-637Crossref PubMed Scopus (1061) Google Scholar). As these receptors are not subject to negative regulation by high levels of intracellular cholesterol, massive accumulation of cholesterol esters can occur in macrophages, resulting in foam cell formation. This pathophysiological phenomenon is the typical character of the early stage in the development of AS. Now, it is widely accepted that the removal of excess free cholesterol from arterial cells is very important for maintaining cellular cholesterol homeostasis, decreasing the size of atherosclerotic plaque, and protecting against AS. Although there are multiple mechanisms involved in the efflux of cellular cholesterol, recent work (7Brooks-Wilson A. Marcil M. Clee S.M. Zhang L.H. Roomp K. van Dam M. Yu L. Brewer C. Collins J.A. Molhuizen H.O. Loubser O. Ouelette B.F. Fichter K. Ashbourne-Excoffon K.J. Sensen C.W. Scherer S. Mott S. Denis M. Martindale D. Frohlich J. Morgan K. Koop B. Pimstone S. Kastelein J.J. Hayden M.R. Nat. Genet. 1999; 22: 336-345Crossref PubMed Scopus (1505) Google Scholar) suggested that the ATP-binding cassette A1 (ABCA1) mediates this process. ABCA1 is a member of the ATP-binding cassette transporter family that is involved in the control of high density lipoprotein and apolipoprotein AI (apoAI)-mediated cholesterol efflux from macrophages (7Brooks-Wilson A. Marcil M. Clee S.M. Zhang L.H. Roomp K. van Dam M. Yu L. Brewer C. Collins J.A. Molhuizen H.O. Loubser O. Ouelette B.F. Fichter K. Ashbourne-Excoffon K.J. Sensen C.W. Scherer S. Mott S. Denis M. Martindale D. Frohlich J. Morgan K. Koop B. Pimstone S. Kastelein J.J. Hayden M.R. Nat. Genet. 1999; 22: 336-345Crossref PubMed Scopus (1505) Google Scholar, 8Lawn R.M. Wade D.P. Garvin M.R. Wang X. Schwartz K. Porter J.G. Seilhamer J.J. Vaughan A.M. Oram J.F. J. Clin. Investig. 1999; 104 (-R31): R25Crossref PubMed Scopus (654) Google Scholar, 9Oram J.F. Lawn R.M. Garvin M.R. Wade D.P. J. Biol. Chem. 2000; 275: 34508-34511Abstract Full Text Full Text PDF PubMed Scopus (475) Google Scholar). Mutation in the ABCA1 gene causes Tangier disease, which is marked by severe accumulation of cholesterol in macrophages and other tissues (10Bodzioch M. Orso E. Klucken J. Langmann T. Bottcher A. Diederich W. Drobnik W. Barlage S. Buchler C. Porsch-Ozcurumez M. Kaminski W.E. Hahmann H.W. Oette K. Rothe G. Aslanidis C. Lackner K.J. Schmitz G. Nat. Genet. 1999; 22: 347-351Crossref PubMed Scopus (1345) Google Scholar), suggesting that the ABCA1 gene plays an integral role in modulating cellular cholesterol transport (11Oram J.F. Vaughan A.M. Curr. Opin. Lipidol. 2000; 11: 253-260Crossref PubMed Scopus (241) Google Scholar). Expression of the ABCA1 gene is transcriptionally regulated. PPARγ was shown recently to induce the expression of the cholesterol transporter, ABCA1, in macrophages through a transcriptional cascade mediated by the nuclear receptor, liver X receptor (LXR) (12Chawla A. Boisvert W.A. Lee C.H. Laffitte B.A. Barak Y. Joseph S.B. Liao D. Nagy L. Edwards P.A. Curtiss L.K. Evans R.M. Tontonoz P. Mol. Cell. 2001; 7: 161-171Abstract Full Text Full Text PDF PubMed Scopus (1174) Google Scholar, 13Costet P. Luo Y. Wang N. Tall A.R. J. Biol. Chem. 2000; 275: 28240-28245Abstract Full Text Full Text PDF PubMed Scopus (851) Google Scholar, 14Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12097-12102Crossref PubMed Scopus (843) Google Scholar). Moreover, transplantation of PPARγ-null bone marrow into mice lacking low density lipoprotein receptor resulted in a significant increase in atherosclerotic lesion size. The implication of these findings is that PPARγ exerts anti-atherogenic effects by facilitating the removal of cholesterol from macrophages via cholesterol transporter proteins such as ABCA1. Parallel studies (12Chawla A. Boisvert W.A. Lee C.H. Laffitte B.A. Barak Y. Joseph S.B. Liao D. Nagy L. Edwards P.A. Curtiss L.K. Evans R.M. Tontonoz P. Mol. Cell. 2001; 7: 161-171Abstract Full Text Full Text PDF PubMed Scopus (1174) Google Scholar) demonstrated that the ligand of PPARγ leads to induction of LXRα and enhanced ABCA1 gene expression, and this induction was significantly less in macrophages from PPARγ knock-out mice. These combined findings illustrate a complex pathway of PPARγ-LXRα-ABCA1 in the cellular regulation of cholesterol transport. Anthocyanins are naturally occurring pigments in the plant kingdom, and they are widely distributed in nature. In vivo and in vitro studies suggested that anthocyanins have an array of health-promoting benefits besides anti-oxidative and anti-inflammatory actions; however, anthocyanins have received less attention. We have demonstrated previously that black rice pigment fraction attenuated atherosclerotic plaque formation in apolipoprotein E-deficient mice (15Xia M. Ling W.H. Ma J. Kitts D.D. Zawistowski J. J. Nutr. 2003; 133: 744-751Crossref PubMed Scopus (124) Google Scholar). We also have shown that black rice pigment fraction significantly ameliorated hypercholesterolemia and suppressed cholesterol accumulation in liver and aorta, implying the pigment has a great potential function in removal of cholesterol away from tissues. The anthocyanins rich in the black rice pigment may contribute to the cardiovascular health-promoting effects (15Xia M. Ling W.H. Ma J. Kitts D.D. Zawistowski J. J. Nutr. 2003; 133: 744-751Crossref PubMed Scopus (124) Google Scholar). This study was designed to investigate the effect of anthocyanin on ABCA1-mediated cholesterol efflux and to explore its possible mechanisms related to ABCA1 transporter and its regulation. Materials—Anthocyanin standards cyanidin-3-O-β-glucoside (Cy-3-g) and peonidin-3-O-β-glucoside (Pn-3-g) were purchased from Polyphenol AS (Sandnes, Norway). Defined fetal bovine serum was provided by HyClone (Logan, UT). RPMI 1640 culture medium was obtained from Invitrogen. Bovine serum albumin (BSA), penicillin/streptomycin, cholesterol standard (high pressure liquid chromatography grade), cholesterol oxidase, cholesterol esterase, peroxidase, p-hydroxyphenylacetic acid, apolipoprotein AI, 1α,2α-[3H]cholesterol (250 μCi), and actinomycin D were purchased from Sigma. The ABCA1 inhibitor-4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, disodium salt (DIDS), the PPARγ antagonist GW9662, and the LXRα antagonist geranylgeranyl pyrophosphate ammonium salt (GGPP) were purchased from Molecular Probes (Eugene, Oregon), Sigma, and Calbiochem, respectively. Isolation of Mouse Peritoneal Macrophages—To harvest mouse peritoneal macrophages, the pathogen-free NIH mice were sacrificed, and ice-cold phosphate-buffered saline (PBS) was injected into the peritoneal cavity of each mouse. This fluid was carefully collected and centrifuged at 3000 rpm. The supernatant was then withdrawn, and the cell pellet was resuspended in RPMI 1640 medium, allowed to adhere for 3 h, and then washed three times with pre-warmed PBS to remove nonadherent cells. The medium was then replaced with fresh RPMI 1640 medium supplemented with 10% fetal bovine serum (16Ottnad E. Parthasarathy S. Sambrano G.R. Ramprasad M.P. Quehenberger O. Kondratenko N. Green S. Steinberg D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1391-1395Crossref PubMed Scopus (139) Google Scholar). The cells were incubated for the specific times as indicated in the text and legends. LDL Preparation and Acetylated Modification—LDL was isolated from the fresh plasma of healthy subjects. Briefly, after density adjustment to 1.200 g/ml with sodium bromide (NaBr), the plasma was separated by preparative ultracentrifugation at 60,000 rpm for 5.5 h on a Beckman L-80 ultracentrifuge, using a type Ti 90 rotor (17Lougheed M. Moore-Edwin D.W. Scriven-David R.L. Steinbrecher U.P. Arteriosclerosis. 1999; 19: 1881-1890Crossref Scopus (61) Google Scholar). The LDL was collected, sterilized, and stored in the dark at 4 °C. Acetylation of LDL was performed by the addition of 4 aliquots each of 1 μl of acetic anhydride at 10-min intervals to 2 mg of LDL in 600 μl of ice-cold 50% saturated sodium acetate. LDL was aggregated by vortexing a 1 mg/ml solution at low speed for 15 s. The acylated LDL (AcLDL) was dialyzed against PBS overnight, and the protein concentration was determined after by a Lowry assay as described previously (18Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Cholesterol Loading and Efflux Assay—Adherent peritoneal macrophages were incubated in RPMI 1640 with 50 μg of protein/ml of AcLDL (containing or not [3H]cholesterol) (19Basu S.K. Goldstein J.L. Anderson G.W Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3178-3182Crossref PubMed Scopus (823) Google Scholar) at 37 °C for 24 h to induce macrophage foam cells. The cells were then washed in ice-cold PBS and incubated with Cy-3-g or Pn-3-g in medium containing 1.0 mg/ml BSA for the indicated time. After this incubation period, cells were washed three times in PBS, and apoAI-mediated cholesterol efflux studies were immediately performed by adding fresh medium with or without 10 μg/ml apoAI for 24 h. Since in macrophages the equilibrium between esterified and free cholesterol is not obtained even after an additional 24-h incubation period (20Kritharides L. Christian A. Stoudt G. Morel D. Rothblat G.H. Arterioscler. Thromb. Vasc. Biol. 1998; 18: 1589-1599Crossref PubMed Scopus (94) Google Scholar), the experiments were performed in the absence of equilibrium. At the end of this incubation, lipids of cells and media were separately extracted in chloroform and methanol, and then the samples were dried under nitrogen, and free cholesterol and total cholesterol were measured by enzymatic assays. Esterified cholesterol was measured as the difference between total and free cholesterol. Cellular proteins were collected by digestion in NaOH and were measured by using the Bradford method. The percent change of intracellular cholesterol amounts in the presence of apoAI relative to apoAI-free culture medium was determined as the percent counts in medium over counts in medium + cells. Each assay was performed in triplicate (21Chinetti G. Lestavel S. Bocher V. Remaley A.T. Neve B. Torra I.P. Teissier E. Minnich A. Jaye M. Duverger N. Brewer H.B. Fruchart J.C. Clavey V. Staels B. Nat. Med. 2001; 7: 53-58Crossref PubMed Scopus (1009) Google Scholar). In the experiments with [3H]cholesterol, we measured radioactivity by scintillation counting in centrifuged medium and in cellular lipids extracted with hexane/isopropyl alcohol. ApoAI-induced [3H]cholesterol efflux was measured as the fraction of total radiolabeled cholesterol appearing in the medium in the presence of apoAI after subtraction of values for apoAI-free medium. Cytotoxicity Tests—Cells were grown in microtiter plates and subjected to the experimental culture conditions and treatments as described for efflux experiments. 0.5 mg/ml MTT was added to each well and incubated for 4 h in the cell culture incubator. Solubilization buffer (10% SDS in 0.01 m HCl) was added to each well and incubated in a cell culture incubator overnight. Absorbance was measured at 550 nm on a microtiter plate reader. Percent MTT cleavage was determined as follows: (treatment value - media with vehicle value)/(0.1% Triton X-100 value - media with vehicle value) ×100 (22Denizot F. Lang R. J. Immunol. Methods. 1986; 89: 271-277Crossref PubMed Scopus (4322) Google Scholar). A lactate dehydrogenase release assay was performed according to the manufacturer's instructions (BioVision). Real Time PCR-based Quantitative Gene Expression Analysis—Oligonucleotide primers and TaqMan probes were designed by using Primer Express software 2.0 (PE Biosystems) and were synthesized by Takara Biotechnology Inc. Sequences of probes and primers were listed in TABLE ONE. Total RNA was extracted from the cultured cells using TRIzol reagent according to the protocol provided by the manufacturer (Invitrogen). Real time quantitative TaqMan PCR analysis was used to measure the relative levels of PPARγ, LXRα, and ABCA1 mRNA expression. The PCRs were performed according to the manufacturer's instructions (TaqMan Gold RT-PCR protocol, PE Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of 6-carboxyfluorescein (reporter dye) during the amplification cycle. Amplification of the murine GAPDH gene was performed in the same reaction on all samples tested as an internal control for variations in RNA amounts. Levels of the different mRNAs were subsequently normalized to GAPDH mRNA levels. The amplification was performed on ABI Prism 7000 TaqMan real time fluorescent thermal cycler (PerkinElmer Life Sciences). The thermal cycling conditions included 2 min at 93 °C, 1 min at 93 °C, and 1 min at 55 °C. Thermal cycling proceeded with 40 cycles.TABLE ONESequences of primers and probes for real time quantitative PCRGenesForward primer (5′ to 3′)Reverse primer (5′ to 3′)Probe (5′ to 3′)PPARγTCTTAACTGCCGGATCCACAAGCCCAAACCTGATGGCATTTCGGTTTCAGAAGTGCLXRαAGCGTCCATTCAGAGCAAGTGCTCGTGGACATCCCAGATCTCCAGGACAAAAAGCTTCABCA1TGGAAACTCACCCAGCAACAGGCAGGACAATCTGAGCAAAGTTGCCAGACGGAGCC Open table in a new tab Presence of ABCA1 on the Cell Surface—Cholesterol-loaded macrophages grown on a 35-mm Petri dish (MatTek Corp.) were rinsed, fixed for 15 min with paraformaldehyde (4%), and incubated successively in PBS supplemented with 10% normal serum for 20 min. Then the cells were incubated for 60 min at 37 °C with primary goat anti-human monoclonal ABCA1. After rinsing, the cells were incubated with fluorescein isothiocyanate-conjugated secondary antibody at 37 °C for 45 min. Finally, the cells were examined using a Zeiss Axiophot microscope (Zeiss LSM510, Carl Zeiss). Cells in all steps were rinsed with PBS. Replacement of the primary antibody with PBS, 10% normal serum was used to control the specificity of the immunolabeling of the cells (23Witting S.R. Maiorano J.N. Davidson W.S. J. Biol. Chem. 2003; 278: 40121-40127Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Scanned images were acquired using a laser-scanning spectral confocal microscope system. Cell Surface Binding of 125I-Labeled ApoAI—ApoAI binding to cells was performed as described previously (24Oram J.F. Wang Y.T. J. Biol. Chem. 2002; 277: 5692-5697Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). Pretreated cholesterol-loaded macrophages were chilled on ice and rinsed with cold PBS. 125I-ApoAI was exposed to the cells at 2 μg/ml in HEPES-buffered RPMI 1640/BSA media with or without a 50-fold excess of unlabeled apoAI (100 μg/ml). Cells were incubated on ice for 1 h and rinsed with cold PBS containing 0.1% BSA, then twice with PBS alone. Cells were solubilized in 0.1 n NaOH, and aliquots were taken for scintillation counting. Results are expressed as nanograms of 125I-apoAI per mg of cell protein after subtraction of values in the presence of unlabeled apoAI. Nuclear Protein Extraction and PPARγ Transcription Factor Activity Assay—Nuclear extracts of cells were prepared as described previously (25Marx N. Bourcier T. Sukhova G.K. Libby P. Plutzky J. Arterioscler. Thromb. Vasc. Biol. 1999; 19: 546-551Crossref PubMed Scopus (336) Google Scholar). Briefly, monolayers (2×106 cells) were harvested by scraping, washed in cold PBS, and incubated in two packed cell volumes of buffer A (10 mm HEPES (pH 8.0), 1.5 mm MgCl2, 10 mm KCl, 0.5 mm dithiothreitol, 200 mm sucrose, 0.5 mm phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin and aprotinin, and 0.5% Nonidet P-40) for 5 min at 4 °C. The nuclei were collected by microcentrifugation, rinsed once in buffer A, and resuspended in two-thirds packed cell volume of buffer C (20 mm HEPES (pH 7.9), 1.5 mm MgCl2, 420 mm NaCl, 0.2 mm EDTA, 0.5 mm phenylmethylsulfonyl fluoride, 1.0 mm dithiothreitol, 1.0 μg/ml leupeptin and aprotinin). Nuclei were incubated at 4 °C for 20 min and clarified by microcentrifugation for 5 min. The resulting supernatants were used as the nuclear fraction, and protein concentration was determined by the Bradford method (26Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216391) Google Scholar). PPARγ transcription factor activity was assayed by using enzyme-linked immunosorbent assay-based PPARγ transcription factor activity assay kit to detect and qualify transcription PPARγ factor activation (Active Motif Inc.). The measurement was done according to the protocol of the kit. This assay is specific for PPARγ activation, and it will not cross-react with PPARα or PPARβ. Transient Transfections and Reporter Gene Assays—LXR-response element (LXRE)-driven luciferase reporter vector (LXRE-tk-Luc) was kindly provided by David J. Mangelsdorf (University of Texas Southwestern Medical Center). For LXR activation studies, 0.75 μg of LXRE-driven luciferase reporter vector (LXRE-tk-Luc) and 0.75 μgof β-galactosidase control vector (Promega) were used. Six hours after transfection, cells were treated with Cy-3-g or Pn-3-g for 12 h. Luciferase and β-galactosidase activities were determined in cell lysate. The amount of luciferase activity was normalized for β-galactosidase and reported as relative light units. Anthocyanin Induces Cholesterol Efflux to ApoAI in Macrophages— As stated above, the previous study (15Xia M. Ling W.H. Ma J. Kitts D.D. Zawistowski J. J. Nutr. 2003; 133: 744-751Crossref PubMed Scopus (124) Google Scholar) has suggested the possible role of black rice pigment rich in anthocyanins in reverse cholesterol efflux. This relationship led us to hypothesize that anthocyanin might play a role in the cellular regulation of cholesterol efflux. Because of its relevance close to the atherosclerotic process, mouse peritoneal macrophages were selected for observation on cholesterol efflux in vitro. To examine the potential effect of anthocyanin on cholesterol efflux, the mouse peritoneal macrophages were loaded with 50 μg/ml AcLDL for 24 h to promote cholesteryl ester accumulation inducing the formation of macrophage-derived foam cells. After that the primary mouse macrophages (Fig. 1, A and B) and macrophage-derived foam cells (Fig. 1, C and D) were treated with 1, 10, and 100 μm Cy-3-g or Pn-3-g or with 100 nm Ros, the PPARγ ligand, for 24 h, respectively, and subsequently exposed to apoAI in order to promote cholesterol efflux. After 24 h, cholesterol efflux was measured by the change in cellular cholesterol levels from cells. Both Cy-3-g (Fig. 1, A and C) and Pn-3-g (Fig. 1, B and D) treatment reduced intracellular cholesterol concentrations in macrophages and macrophage-derived foam cells in a dose-dependent manner, and these two anthocyanins reduced the esterified cholesterol pool and free cholesterol levels substantially under these conditions. To demonstrate that the variation of intracellular lipids was not because of the action of anthocyanin on de novo cholesterol synthesis, we loaded mouse peritoneal macrophages with 250 μCi of [3H]cholesterol plus AcLDL (50 μg/ml) for 24 h and determined the apoAI-mediated efflux of cholesterol by measuring the appearance of cholesterol in the medium. Anthocyanin Cy-3-g, Pn-3-g, and Ros treatment in the cells loaded with cholesterol increased [3H]cholesterol release approximately from 1- to 2-fold, respectively, compared with untreated cells (Fig. 1E). These results indicate that Cy-3-g and Pn-3-g enhanced apoAI-mediated cholesterol efflux from mouse macrophages and macrophage-derived foam cells. Anthocyanins Cy-3-g and Pn-3-g exhibited similar effects on cholesterol efflux as PPARγ agonist rosiglitazone. Anthocyanin Treatment Does Not Cause Significant Toxicity in Macrophages—Because few studies had reported that anthocyanin caused cytotoxicity and the cells released cholesterol during death, we characterized whether the anthocyanin induction of cholesterol efflux is relevant to its toxicity on macrophages. To address this possibility, we used two different approaches: the MTT test to measure overall metabolic activity of the cell and a lactate dehydrogenase release assay to assess cellular membrane integrity. The results show that none of these tests revealed significant cytotoxicity (MTT and lactate dehydrogenase release) when cells were treated with 100 μm Cy-3-g or 100 μm Pn-3-g (results not shown). These data show that both Cy-3-g and Pn-3-g do not cause significant cytotoxicity, and anthocyanin-induced cholesterol efflux is not relevant to the cell cytotoxicity. Anthocyanin Induces ABCA1 Gene Expression—By having established that anthocyanin is a specific inducer of apoAI-mediated cholesterol efflux, we next determined the effects of anthocyanin on ABCA1 transporter gene expression, which controls the first steps of apoAI-mediated cholesterol efflux and reverses the cholesterol transport pathway. Treatment with 1–100 μm Cy-3-g or Pn-3-g enhanced ABCA1 gene expression in a dose-dependent manner in primary mouse peritoneal macrophages and macrophage-derived foam cells (Fig. 2A). Moreover, in macrophage-derived foam cells, we found that ABCA1 gene expression induced by 100 μm Cy-3-g or 100 μm Pn-3-g reached a high level at 24 h and then decreased (Fig. 2B). To address whether the induction of gene expression for ABCA1 by the anthocyanin was secondary to enhanced gene transcription, the macrophages were incubated with 100 μm Cy-3-g or 100 μm Pn-3-g or 100 nm Ros, respectively, in the presence of a general inhibitor of gene transcription actinomycin D. The addition of actinomycin D completely abolished the increase of ABCA1 mRNA expression in response to anthocyanins and the PPARγ agonist rosiglitazone (Fig. 2C). Anthocyanin Increases Cellular ABCA1 and Binding of ApoAI—Because previous studies (28Favari E. Zanotti I. Zimetti F. Ronda N. Bernini F. Rothblat G.H. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2345-2350Crossref PubMed Scopus (116) Google Scholar, 29Goff Le Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2155-2161Crossref PubMed Scopus (74) Google Scholar) have proposed that ABCA1 may be most active at the plasma membrane, presumably to allow interactions with extracellular apolipoproteins, which controls the rate of apoAI-mediated lipid efflux, the effects of anthocyanins on the cell membrane content of ABCA1 were determined. The confocal images showed a significantly increased degree of ABCA1 content (green) at the surfaces of the cells in the presence of anthocyanins versus untreated cells (Fig. 3, A–H). Next we tested the effect of anthocyanins on apoAI cell surface binding to ABCA1, which could account for the higher cholesterol efflux. Cholesterol-loaded macrophages were treated with 1, 10, and 100 μm Cy-3-g or Pn-3-g and 100 nm Ros for 24 h, and 125I-apoAI binding was measured. As shown in Fig. 4, binding was increased significantly after treatment with anthocyanins. Taken together, all these studies showed that anthocyanins increase the total membrane content of ABCA1 in macrophages, leading to more plasma membrane ABCA1 available for interactions with apoAI. Inhibition of ABCA1 Prevents Cholesterol Efflux Induced by Anthocyanins—To determine whether enhanced cholesterol efflux following ABCA1 activation requires an increase in transcription, cells were incubated with anthocyanin together with actinomycin D. The addition of actinomycin D completely prevented the increase of cholesterol efflux into medium (Fig. 5). DIDS is an inhibitor of the transport activities of ABCA1 and blocker of apoAI-mediated cholesterol efflux. When DIDS was added simultaneously with anthocyanins, it markedly reduced the apoAI-mediated efflux of tritiated cholesterol and completely abolished the positive effects of Cy-3-g and Pn-3-g on apoAI-mediated cholesterol efflux (Fig. 5). This finding strongly suggests that ABCA1 transporter is responsible for facilitating cholesterol efflux. Anthocyanin Induces LX