GIPC Binds to the Human Lutropin Receptor (hLHR) through an Unusual PDZ Domain Binding Motif, and It Regulates the Sorting of the Internalized Human Choriogonadotropin and the Density of Cell Surface hLHR
2003; Elsevier BV; Volume: 278; Issue: 49 Linguagem: Inglês
10.1074/jbc.m306557200
ISSN1083-351X
AutoresTakashi Hirakawa, Colette Galet, Mikiko Kishi, Mario Ascoli,
Tópico(s)Erythrocyte Function and Pathophysiology
ResumoBy using a yeast two-hybrid screen we identified GIPC (GAIP-interacting protein C terminus), a protein with a type I PDZ domain as a novel human lutropin receptor (hLHR) binding partner. Pull-down and immunoprecipitation assays confirmed this interaction and showed that it is dependent on the PDZ domain of GIPC and the C-terminal tetrapeptide of the hLHR. To characterize the functional consequences of the GIPC-hLHR interaction, we used a small interfering RNA against GIPC to generate a clonal cell line that is deficient in GIPC. Studies with this cell line reveal that GIPC is partially responsible for the recycling of the hormone that is internalized by the hLHR and also for maintaining a relatively constant level of hLHR at the cell surface during hormone internalization. By using a yeast two-hybrid screen we identified GIPC (GAIP-interacting protein C terminus), a protein with a type I PDZ domain as a novel human lutropin receptor (hLHR) binding partner. Pull-down and immunoprecipitation assays confirmed this interaction and showed that it is dependent on the PDZ domain of GIPC and the C-terminal tetrapeptide of the hLHR. To characterize the functional consequences of the GIPC-hLHR interaction, we used a small interfering RNA against GIPC to generate a clonal cell line that is deficient in GIPC. Studies with this cell line reveal that GIPC is partially responsible for the recycling of the hormone that is internalized by the hLHR and also for maintaining a relatively constant level of hLHR at the cell surface during hormone internalization. The trafficking of G protein-coupled receptors (GPCRs) 1The abbreviations used are: GPCRG protein-coupled receptorLHRlutropin receptorhCGhuman choriogonadotropinrrathhumanGSTglutathione S-transferasehCGhuman choriogonadotropinsiRNAsmall interfering RNAFITCfluorescein isothiocyanatewtwild type.1The abbreviations used are: GPCRG protein-coupled receptorLHRlutropin receptorhCGhuman choriogonadotropinrrathhumanGSTglutathione S-transferasehCGhuman choriogonadotropinsiRNAsmall interfering RNAFITCfluorescein isothiocyanatewtwild type. appears to be largely mediated by phosphorylation and/or ubiquitination of their intracellular domains (1.Marchese A. Benovic J.L. J. Biol. Chem. 2001; 276: 45509-45512Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar, 2.Tanowitz M.B. von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 3.Whistler J.L. Tsao P. von Zastrow M. J. Biol. Chem. 2001; 276: 34331-34338Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 4.Cao T.T. Deacon H.W. Reczek D. Bretscher A. von Zastrow M. Nature. 1999; 401: 286-290Crossref PubMed Scopus (561) Google Scholar, 5.Marchese A. Chen C. Kim Y.-M. Benovic J.L. Trends Biochem. Sci. 2003; 28: 369-376Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar) and/or by their association with trafficking proteins such as the non-visual arrestins (6.Shenoy S.K. McDonald P.H. Kohout T.A. Lefkowitz R.J. Science. 2001; 294: 1307-1313Crossref PubMed Scopus (704) Google Scholar, 7.Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar), N-ethylmaleimide-sensitive factor (8.Cong M. Perry S.J. Hu L.A. Hanson P.I. Claing A. Lefkowitz R.J. J. Biol. Chem. 2001; 276: 45145-45152Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar), ezrin-radixin-moesin-binding phosphoprotein-50/sodium-hydrogen exchange regulatory factor (EBP50/NHERF, see Ref. 4.Cao T.T. Deacon H.W. Reczek D. Bretscher A. von Zastrow M. Nature. 1999; 401: 286-290Crossref PubMed Scopus (561) Google Scholar), sorting nexins (9.Wang Y. Zhou Y. Szabo K. Haft C.R. Trejo J. Mol. Biol. Cell. 2002; 13: 1965-1976Crossref PubMed Scopus (109) Google Scholar), or GPCR-associated sorting protein (see Ref. 10.Whistler J.L. Enquist J. Marley A. Fong J. Gladher F. Tsuruda P. Murray S.R. von Zastrow M. Science. 2002; 297: 615-620Crossref PubMed Scopus (266) Google Scholar). Little is known, however, about the identity of the GPCR residues that mediate trafficking, about the specificity of the proteins involved in sorting, and about common structural and/or functional features that may characterize these sorting proteins. G protein-coupled receptor lutropin receptor human choriogonadotropin rat human glutathione S-transferase human choriogonadotropin small interfering RNA fluorescein isothiocyanate wild type. G protein-coupled receptor lutropin receptor human choriogonadotropin rat human glutathione S-transferase human choriogonadotropin small interfering RNA fluorescein isothiocyanate wild type. We have taken advantage of the high degree of amino acid sequence homology and divergent post-endocytotic fates of the rat (r) and human (h) lutropin receptor (LHR) to identify motifs present in the C-terminal tail of the LHR that are involved in the sorting of one of the internalized LHR ligands (i.e. human choriogonadotropin (hCG)) to a recycling or a degradation pathway (11.Ascoli M. Fanelli F. Segaloff D.L. Endocr. Rev. 2002; 23: 141-174Crossref PubMed Scopus (500) Google Scholar, 12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar, 13.Galet C. Min L. Narayanan R. Kishi M. Weigel N.L. Ascoli M. Mol. Endocrinol. 2003; 17: 411-422Crossref PubMed Scopus (32) Google Scholar). Based on these findings we hypothesized the following: (a) the hCG internalized by the hLHR is sorted to a recycling pathway by virtue of the ability of the hLHR to bind to intracellular proteins(s) that promote recycling; (b) that the interaction of the hLHR with these putative proteins is mediated by one or more of the recycling motifs identified previously; and (c) that the hCG internalized by the rLHR is sorted to a degradation pathway because the rLHR lacks these motifs. Because these putative sorting motifs are located in the extreme C-terminal tail of the hLHR but absent in the corresponding region of the rLHR, we sought to identify these putative proteins by using these regions of the hLHR and rLHR as "bait" in a differential yeast two-hybrid screen of a 293 cell library (the cell line where all trafficking experiments have been conducted). The studies presented here describe the identification of a ubiquitous protein that binds to the hLHR and is involved in the post-endocytotic trafficking of the internalized hCG and in maintaining the levels of cell surface hLHR during endocytosis of the bound hormone. Yeast Two-hybrid Screen—The Matchmaker™ two-hybrid system 2 (Clontech Laboratories, Palo Alto, CA) was used according to the protocols provided by the manufacturer. By using PCR-based strategies, we subcloned the C-terminal 42 residues of the hLHR (i.e. residues 657-699) into the EcoRI/BamHI sites of the pAS2-1 vector to generate a fusion protein with the GAL4 DNA binding domain. This plasmid was used as bait to screen a human kidney 293 cells cDNA library constructed in the pACT2 vector to generate fusion products with the GAL4 activation domain. This library was also purchased from Clontech. Plasmids and Cells—Full-length cDNAs encoding for the hLHR and rLHR (14.Minegishi T. Nakamura K. Takakura Y. Miyamoto K. Hasegawa Y. Ibuki Y. Igarashi M. Biochem. Biophys. Res. Commun. 1990; 172: 1049-1054Crossref PubMed Scopus (241) Google Scholar, 15.McFarland K.C. Sprengel R. Phillips H.S. Kohler M. Rosemblit N. Nikolics K. Segaloff D.L. Seeburg P.H. Science. 1989; 245: 494-499Crossref PubMed Scopus (800) Google Scholar) were subcloned into pcDNAI/Neo (rLHR) or pcDNA 3.1 (hLHR), respectively, for expression. The preparation and characterization of myc-rLHR-wt- (in pcDNAI/Neo) and myc-hLHR-wt (in pcDNA 3.1)-modified forms of the LHR containing the Myc epitope at the N terminus have also been described (16.Fabritz J. Ryan S. Ascoli M. Biochemistry. 1998; 37: 664-672Crossref PubMed Scopus (40) Google Scholar, 17.Min L. Ascoli M. Mol. Endocrinol. 2000; 14: 1797-1810Crossref PubMed Scopus (59) Google Scholar). The different mutants of the rLHR and hLHR used here were constructed by standard PCR strategies using the myc-rLHR-wt or myc-hLHR-wt as templates. An expression vector (pFLAG-CMV from Sigma) coding for an N-terminal FLAG-tagged version of human GIPC (18.Liu T.F. Kandala G. Setaluri V. J. Biol. Chem. 2001; 276: 35768-35777Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) was kindly provided by Dr. V. Setaluri (Wake Forest University). A bacterial expression vector (pGEX-3X) coding for a GST fusion protein of the full-length EBP50 (19.Short D.B. Trotter K.W. Reczek D. Kreda S.M. Bretscher A. Boucher R.C. Stutts M.J. Milgram S.L. J. Biol. Chem. 1998; 273: 19797-19801Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar, 20.Reczek D. Bretscher A. J. Biol. Chem. 1998; 273: 18452-18458Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar) was kindly donated by Dr. A. Bretscher (Cornell University, Ithaca, NY). A bacterial expression vector coding for a GST fusion protein of human GIPC was prepared by amplifying the full-length GIPC sequence from the FLAG-GIPC vector described above followed by subcloning into the EcoRI/BamHI sites of the pGEX-5x1 vector. The GST fusion protein of human GIPC lacking its PDZ domain (designated GIPC(ΔPDZ)) was prepared by deletion of the nucleotides coding for amino acid residues 125-225. This was done by standard PCR strategies using the full-length GIPC GST fusion construct described above as a template. GST fusion proteins were prepared as described elsewhere (19.Short D.B. Trotter K.W. Reczek D. Kreda S.M. Bretscher A. Boucher R.C. Stutts M.J. Milgram S.L. J. Biol. Chem. 1998; 273: 19797-19801Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar, 20.Reczek D. Bretscher A. J. Biol. Chem. 1998; 273: 18452-18458Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). An oligonucleotide corresponding to inverted copies of nucleotides 240-260 (AAGGAGCTGTATGGCAAGATT) of the human GIPC mRNA separated by a 6-nucleotide spacer (GAGTACTG) and containing SalI and XbaI sites was synthesized commercially and subcloned into the SalI and XbaI sites of the pSupressor2 vector from Imgenex® according to their instructions. This siRNA expression vector was then used to transfect 293 cells (see below) to prepare a clonal line of GIPC-deficient 293 cells (see below). Human kidney 293T cells are a derivative of 293 cells that express the SV40T antigen (21.Margolskee R. McHenry-Rinde B. Horn R. BioTechniques. 1993; 15: 906-911PubMed Google Scholar) and were provided to us by Dr. Marlene Hosey (Northwestern University, Chicago, IL). These cells were maintained in Dulbecco's modified Eagle's medium containing 10 mm HEPES, 10% newborn calf serum, and 50 μg/ml gentamicin, pH 7.4, and used for all the transient transfection assays. Cells were plated in gelatin-coated 35-mm wells and transiently transfected with 0.5 μg of plasmid DNA, using the calcium phosphate methods of Chen and Okayama (22.Chen C. Okayama H. Mol. Cell. Biol. 1987; 7: 2745-2752Crossref PubMed Scopus (4799) Google Scholar), when 70-80% confluent. After an overnight incubation with the transfection mixture, the cells were washed and used 24 h later. Human embryonic kidney 293 cells were obtained from the American Type Culture Collection (CRL 1573). They were maintained and transfected as described above, but they were used only to obtain clonal lines of stably transfected cells expressing the GIPC siRNA vector described above or a control vector that confers G418 resistance. Clonal lines of transfected cells were obtained by selection with 700 μg/ml G418 as described elsewhere (23.Hipkin R.W. Wang Z. Ascoli M. Mol. Endocrinol. 1995; 9: 151-158Crossref PubMed Google Scholar). The desired lines were selected based on the expression of endogenous GIPC as measured by Western blots using a rabbit polyclonal antibody to GIPC (18.Liu T.F. Kandala G. Setaluri V. J. Biol. Chem. 2001; 276: 35768-35777Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) kindly provide to us by Dr. V. Setaluri of Wake Forest University. GST Pull-down Assays—The interactions between the Myc-tagged forms of the LHR and mutants thereof with GIPC, EBP50, and derivatives were determined by measuring the ability of detergent lysates prepared from transiently transfected cells to bind to the indicated GST fusion proteins. Lysates of cells expressing the Myc-tagged LHR constructs were prepared and partially purified on a wheat germ agglutinin-agarose column as described elsewhere (16.Fabritz J. Ryan S. Ascoli M. Biochemistry. 1998; 37: 664-672Crossref PubMed Scopus (40) Google Scholar, 24.Hipkin R.W. Sánchez-Yagüe J. Ascoli M. Mol. Endocrinol. 1992; 6: 2210-2218Crossref PubMed Scopus (59) Google Scholar), except that the lysis buffer contained 1% Nonidet P-40 and 60 mm octyl glucoside. Aliquots of lysates containing equivalent amounts of receptors were incubated with 25 μg of the appropriate GST fusion proteins bound to glutathione-agarose and washed as described previously (19.Short D.B. Trotter K.W. Reczek D. Kreda S.M. Bretscher A. Boucher R.C. Stutts M.J. Milgram S.L. J. Biol. Chem. 1998; 273: 19797-19801Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar, 20.Reczek D. Bretscher A. J. Biol. Chem. 1998; 273: 18452-18458Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar). The bound proteins were eluted by incubating the resin at 37 °C for 30 min followed by vigorous vortexing for 15 min at room temperature. The eluted samples were resolved on SDS gels and electrophoretically blotted as described elsewhere (24.Hipkin R.W. Sánchez-Yagüe J. Ascoli M. Mol. Endocrinol. 1992; 6: 2210-2218Crossref PubMed Scopus (59) Google Scholar). Blots were visualized using a monoclonal antibody to the Myc epitope (9E10) followed by a secondary antibody coupled to horseradish peroxidase. The complexes were directly visualized in the blots by using a combination of the Super Signal West Femto Maximum Sensitivity system of detection (Pierce) and a Kodak digital imaging system. Co-immunoprecipitation Assays—These assays were done using a co-transfection/cross-linking/co-immunoprecipitation approach recently developed in this laboratory (25.Min L. Galet C. Ascoli M. J. Biol. Chem. 2002; 277: 702-710Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 26.Kishi H. Krishnamurthy H. Galet C. Bhaskaran R.S. Ascoli M. J. Biol. Chem. 2002; 277: 21939-21946Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 27.Krishnamurthy H. Galet C. Ascoli M. Mol. Cell. Endocrinol. 2003; 204: 127-140Crossref PubMed Scopus (34) Google Scholar). Briefly, transiently transfected cells were stabilized by cross-linking with dithiobis(succinimidylpropionate). The transfected myc-hLHR or FLAG-GIPC was immunoprecipitated from cell lysates using a monoclonal antibody to the Myc epitope (9E10) or a monoclonal antibody to the FLAG epitope (M2) and resolved on SDS gels. The gels were electrophoretically blotted, and the blots were incubated with anti-FLAG (M2) or anti-Myc (9E10) monoclonal antibodies covalently coupled to horseradish peroxidase as described elsewhere (25.Min L. Galet C. Ascoli M. J. Biol. Chem. 2002; 277: 702-710Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 26.Kishi H. Krishnamurthy H. Galet C. Bhaskaran R.S. Ascoli M. J. Biol. Chem. 2002; 277: 21939-21946Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 27.Krishnamurthy H. Galet C. Ascoli M. Mol. Cell. Endocrinol. 2003; 204: 127-140Crossref PubMed Scopus (34) Google Scholar). The complexes were directly visualized using a combination of the Super Signal West Femto Maximum Sensitivity system of detection (Pierce) and a Kodak digital imaging system. Fate of the Internalized hCG—Transiently transfected cells were allowed to internalize 125I-hCG during a 2-h incubation at 37 °C with a saturating concentration of hormone (52 nm). After washing to remove the free hormone, the surface-bound 125I-hCG was released by a brief exposure of the cells to an isotonic pH 3 buffer (12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar, 28.Ascoli M. J. Biol. Chem. 1982; 257: 13306-13311Abstract Full Text PDF PubMed Google Scholar, 29.Nakamura K. Ascoli M. Mol. Pharmacol. 1999; 56: 728-736PubMed Google Scholar, 30.Krishnamurthy H. Kishi H. Shi M. Galet C. Bhaskaran R.S. Hirakawa T. Ascoli M. Mol. Cell. Endocrinol. 2003; 204: 127-140Crossref PubMed Scopus (38) Google Scholar). This was defined as t = 0, and the cells (which now contain only internalized 125I-hCG) were incubated for an additional 2 h at 37 °C in medium containing an excess of non-radioactive hCG (4 μg/ml). These conditions facilitate the detection of the recycled hormone by preventing the reassociation of the recycled and released hCG with the receptor (30.Krishnamurthy H. Kishi H. Shi M. Galet C. Bhaskaran R.S. Hirakawa T. Ascoli M. Mol. Cell. Endocrinol. 2003; 204: 127-140Crossref PubMed Scopus (38) Google Scholar). At the end of this second incubation the medium was saved, and the cells were washed with cold medium. They were then briefly exposed again to the isotonic pH 3 buffer to release and measure any of the internalized hormone that had recycled back to the surface. The acid-stripped cells were solubilized with NaOH to measure residual radioactivity that remained internalized. Finally, the saved medium was precipitated with 10% trichloroacetic acid to determine the amount of degraded and undegraded 125I-hCG released (12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar, 28.Ascoli M. J. Biol. Chem. 1982; 257: 13306-13311Abstract Full Text PDF PubMed Google Scholar, 29.Nakamura K. Ascoli M. Mol. Pharmacol. 1999; 56: 728-736PubMed Google Scholar, 30.Krishnamurthy H. Kishi H. Shi M. Galet C. Bhaskaran R.S. Hirakawa T. Ascoli M. Mol. Cell. Endocrinol. 2003; 204: 127-140Crossref PubMed Scopus (38) Google Scholar). Down-regulation of the Cell Surface LHR—293T cells transiently transfected with the myc-hLHR-wt or mutants thereof were washed twice with phosphate-buffered saline (137 mm NaCl, 2.7 mm KCl, 1.4 mm KH2PO4, 4.3 mm Na2HPO4), pH 8, and then biotinylated for 30 min at room temperature by incubation with a freshly prepared solution (0.5 mg/ml) of sulfo-NHS-LC-Biotin, (Pierce) as described before (17.Min L. Ascoli M. Mol. Endocrinol. 2000; 14: 1797-1810Crossref PubMed Scopus (59) Google Scholar). After biotinylation, the cells were washed once with Dulbecco's modified Eagle's medium containing 10 mm HEPES and 10% newborn calf serum and incubated for 5 min in the same medium to quench the excess unreacted biotin. Cells were then washed once with cold assay medium (Waymouth's MB752/1 supplemented with 1 mg/ml bovine serum albumin, 20 mm HEPES, and 50 μg/ml gentamicin, pH 7.4). Some cells were saved on ice and processed immediately (t = 0 samples), whereas others were incubated in 1 ml of warm assay medium containing 52 nm hCG for 6 h at 37 °C. At the indicated times, the cells were placed on ice and lysed as described before (17.Min L. Ascoli M. Mol. Endocrinol. 2000; 14: 1797-1810Crossref PubMed Scopus (59) Google Scholar). The receptors were immunoprecipitated with the 9E10 antibody (17.Min L. Ascoli M. Mol. Endocrinol. 2000; 14: 1797-1810Crossref PubMed Scopus (59) Google Scholar). The immunoprecipitates were resolved on SDS gels and electrophoretically transferred to polyvinylidene difluoride membranes (31.Quintana J. Hipkin R.W. Ascoli M. Endocrinology. 1993; 133: 2098-2104Crossref PubMed Scopus (39) Google Scholar). The blots were revealed using streptavidin conjugated to horseradish peroxidase. The complexes were finally visualized and quantitated using the Super Signal West FEMTO Maximum Sensitivity system of detection from Pierce and a Kodak digital imaging system as described elsewhere (17.Min L. Ascoli M. Mol. Endocrinol. 2000; 14: 1797-1810Crossref PubMed Scopus (59) Google Scholar). This image capture system is set up to alert us when image saturation occurs and to prevent us from measuring the intensity of such images. Confocal Microscopy—Confocal microscopy experiments were accomplished as described recently (13.Galet C. Min L. Narayanan R. Kishi M. Weigel N.L. Ascoli M. Mol. Endocrinol. 2003; 17: 411-422Crossref PubMed Scopus (32) Google Scholar, 25.Min L. Galet C. Ascoli M. J. Biol. Chem. 2002; 277: 702-710Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Briefly, 293T cells were plated in eight-chamber coverslip culture vessels coated with polylysine (Biocoat from BD Biosciences). They were transfected (in a total volume of 400 μl) with 100 ng of the expression vector for the myc-hLHR-wt or cotransfected with 100 ng of the expression vector for the myc-hLHR-wt and 10 ng of the expression vector for the FLAG-GIPC. Two days after the transfection the myc-hLHR was visualized by incubating the cells for 1 h at room temperature with an anti-Myc monoclonal antibody (9E10) diluted 1/100 in phosphate-buffered saline containing 5 mg/ml bovine serum albumin, and the endogenous or transfected GIPC were visualized using the polyclonal GIPC antibody diluted 1/500 in the same buffer. After washing three times, the cells were incubated for another hour at room temperature with a 1/100 dilution of Cy™5-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories) or with a 1/2000 dilution of FITC-conjugated anti-rabbit IgG (Sigma). Finally, the cells were washed three or four times, dried, and mounted as described previously (13.Galet C. Min L. Narayanan R. Kishi M. Weigel N.L. Ascoli M. Mol. Endocrinol. 2003; 17: 411-422Crossref PubMed Scopus (32) Google Scholar, 25.Min L. Galet C. Ascoli M. J. Biol. Chem. 2002; 277: 702-710Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). The Cy™5-labeled receptors and the FITC-labeled GIPC were visualized with a Bio-Rad confocal microscope at the Central Microscopy Facility of the University of Iowa. An oil 60× objective was used, and the iris opening was 2 to 2.2 for each color filter. Hormones and Supplies—Purified hCG (CR-127, ∼13,000 units/mg) was purchased from Dr. A. Parlow of the National Hormone and Pituitary Agency of the NIDDK. Recombinant human hCG was kindly provided by Ares Serono. Partially purified hCG (∼3,000 units/mg) was purchased from Sigma, and it was used only to correct for nonspecific binding. 125I-hCG was prepared as described previously (32.Ascoli M. Puett D. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 99-102Crossref PubMed Scopus (123) Google Scholar). Cell culture supplies and reagents were obtained from Corning Glass and Invitrogen, respectively. All other chemicals were obtained from commonly used suppliers. Yeast Two-hybrid Screening—Screening of ∼107 independent colonies of a human 293 cell library with a fragment corresponding to the last 42 residues of the C-terminal tail of the hLHR resulted in the identification of 13 positive clones. Four of these clones coded for regions of human GIPC (33.De Vries L. Lou X. Zhao G. Zheng B. Farquhar M.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12340-12345Crossref PubMed Scopus (185) Google Scholar, 34.Rousset R. Fabre S. Desbois C. Bantignies F. Jalinot P. Oncogene. 1998; 16: 643-654Crossref PubMed Scopus (163) Google Scholar) that overlap extensively with the single PDZ domain of this protein (Fig. 1). Because clone 4 coded only for the PDZ domain of GIPC, these data suggest that the interaction of the hLHR and GIPC occurs through the PDZ domain of GIPC. Structural Determinants That Influence the Formation of the GIPC·hLHR Complex—The association of GIPC with the hLHR was next documented in vitro using extracts of 293T cells transiently transfected with the myc-hLHR-wt or mutants thereof and a GST fusion protein of the full-length human GIPC. As expected, lysates of 293T cells expressing the myc-hLHR-wt reveal the presence of 85- and 68-kDa bands (Fig. 2A) that represent the mature cell surface receptor and its immature intracellular precursor, respectively (11.Ascoli M. Fanelli F. Segaloff D.L. Endocr. Rev. 2002; 23: 141-174Crossref PubMed Scopus (500) Google Scholar). With the exception of hLHR-E698A, which was expressed only as the 68-kDa precursor, all other mutants tested were expressed as the 85- and 68-kDa bands, and their levels of expression were similar to that of the hLHR-wt (Fig. 2A). 2The reasons for the inability of the hLHR-E698A to be processed properly were not investigated.Fig. 2B shows that the hLHR-wt can bind to GST-GIPC. A C-terminal truncation that deletes the C-terminal Cys699 or progressive truncations that delete the C-terminal tetrapeptide (YTEC) of the hLHR greatly inhibit or completely abolish the formation of the hLHR·GIPC complex. The importance of each of these four residues was also documented by alanine-scanning mutagenesis performed in the context of the full-length hLHR. As shown in Fig. 2B, the individual mutation of each of these four residues also inhibited or abolished the formation of the hLHR·GIPC complex. Fig. 3B confirms the initial observations made with the yeast two-hybrid screen by showing that deletion of the PDZ domain of GIPC (residues 125-225, see Fig. 1) abolishes the formation of the hLHR·GIPC complex. Because we (12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar) have previously noted a weak interaction between the hLHR-wt and EBP50, another PDZ-domain containing protein (35.Bretscher A. Curr. Opin. Cell Biol. 1999; 11: 109-116Crossref PubMed Scopus (329) Google Scholar), we also tested the binding of the hLHR-wt and hLHR-t695 to a GST-EBP50 fusion protein. The results presented in Fig. 3B with the hLHR-wt recapitulate the data published previously (12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar). Those obtained with hLHR-t695 show that the hLHR/EBP50 interaction also involves one or more of the last four residues of the hLHR. Fig. 4 also confirms and expands the initial observations made with the yeast two-hybrid screen by showing that GST-GIPC does not bind the rLHR-wt, a homologous protein that terminates in an ALTH sequence rather than the YTEC sequence present in the hLHR (see Fig. 4A). This figure also shows that grafting the C-terminal YTEC tetrapeptide of the hLHR into the rLHR induces the binding of the rLHR to GIPC but not to EBP50. In contrast, grafting the C-terminal tetrapeptide (DSLL) of the β2-adrenergic receptor to the rLHR promotes the binding of the rLHR to EBP50 as shown previously (12.Kishi M. Liu X. Hirakawa T. Reczek D. Bretscher A. Ascoli M. Mol. Endocrinol. 2001; 15: 1624-1635Crossref PubMed Scopus (38) Google Scholar) but does not promote the binding of the rLHR to GIPC (Fig. 4). Collectively, these data show that the GIPC/hLHR interaction involves binding of the C-terminal tetrapeptide of the hLHR to the single (type I) PDZ domain of GIPC. Moreover, the results obtained with EBP50 suggest that the hLHR may also interact weakly with other proteins that have type I PDZ domains. Association of the hLHR and GIPC in Transfected Cells—The association of the hLHR and GIPC was next documented in 293T cells transiently co-transfected with the myc-hLHR-wt and FLAG-GIPC. Immunoprecipitation of the myc-hLHR-wt followed by immunoblotting for FLAG-GIPC readily showed the formation of an hLHR·GIPC complex (Fig. 5, left panel). The data presented in the middle panel of Fig. 5 also show that the detection of this complex can be enhanced if the complex is stabilized by cross-linking the cells prior to lysis and immunoprecipitation of the receptor. Because the association of GST-GIPC with the hLHR was abolished by truncation of the hLHR at position 695 (see Figs. 2 and 3), we also tested for the presence of GIPC in receptor immunoprecipitates of cells co-transfected with the myc-hLHR-t695 and FLAG-GIPC. In agreement with the GST pull-down assays, these intact cell experiments revealed that the myc-hLHR-t695 does not associate with FLAG-GIPC (Fig. 5, right panel). In a complementary set of experiments, we co-transfected 293T cells with the myc-hLHR-wt and FLAG-GIPC and incubated them with or without a saturating concentration of agonist (hCG). The cells were then cross-linked, and the receptor or GIPC was immunoprecipitated with the appropriate antibodies, and the complementary binding partner was detected in each of the immunoprecipitates. These data (Fig. 6A) revealed that the formation of the GIPC·hLHR complex occurs independently of agonist stimulation. In four independent experiments, the ratio of GIPC to hLHR present in the immunoprecipitates was 0.78 ± 0.03 and 0.72 ± 0.13 (mean ± S.E.) in the control and hCG treated cells, respectively. The results summarized in Fig. 6B also show that GIPC binds to the mature cell surface LHR as well as its immature intracellular precursor. This latter conclusion is based on the finding that the 85- and 68-kDa species of the hLHR can be detected in FLAG-GIPC immunoprecipitates. The association of the transfected myc-hLHR-wt with endogenous GIPC was also documented by probing for the presence of endogenous GIPC in immunoprecipitates of 293T cells transfected with the myc-hLHR. These data show that endogenous GIPC co-immunoprecipitates with the transfected myc-hLHR-wt but not with the transfected myc-hLHR-t695 (Fig. 7). Examination of 293T cells by confocal microscopy (Fig. 8) revealed that the endogenous or transfected GIPC
Referência(s)