Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Novel Pro-survival Functions of the Kruppel-like Transcription Factor Egr2 in Promotion of Macrophage Colony-stimulating Factor-mediated Osteoclast Survival Downstream of the MEK/ERK Pathway

2008; Elsevier BV; Volume: 283; Issue: 12 Linguagem: Inglês

10.1074/jbc.m709500200

ISSN

1083-351X

Autores

Elizabeth W. Bradley, Ming Ruan, Merry Jo Oursler,

Tópico(s)

Bone Metabolism and Diseases

Resumo

Determining the underlying mechanisms of macrophage colony-stimulating factor (M-CSF)-mediated osteoclast survival may be important in identifying novel approaches for treating excessive bone loss. This study investigates M-CSF-mediated MEK/ERK activation and identifies a downstream effector of this pathway. M-CSF activates MEK/ERK and induces MEK-dependent expression of the immediate early gene Egr2. Inhibition of either MEK1/2 or inhibition of Egr2 increases osteoclast apoptosis. In contrast, wild-type Egr2 or an Egr2 point mutant unable to bind the endogenous repressors Nab1/2 (caEgr2) suppresses basal osteoclast apoptosis and rescues osteoclasts from apoptosis induced by MEK1/2 or Egr2 inhibition. Mechanistically, Egr2 induces pro-survival Blc2 family member Mcl1 while stimulating proteasome-mediated degradation of pro-apoptotic Bim. In addition, Egr2 increased the expression of c-Cbl, the E3 ubiquitin ligase that catalyzes Bim ubiquitination. M-CSF, therefore, promotes osteoclast survival through MEK/ERK-dependent induction of Egr2 to control the Mcl1/Bim ratio, documenting a novel function of Egr2 in promoting survival. Determining the underlying mechanisms of macrophage colony-stimulating factor (M-CSF)-mediated osteoclast survival may be important in identifying novel approaches for treating excessive bone loss. This study investigates M-CSF-mediated MEK/ERK activation and identifies a downstream effector of this pathway. M-CSF activates MEK/ERK and induces MEK-dependent expression of the immediate early gene Egr2. Inhibition of either MEK1/2 or inhibition of Egr2 increases osteoclast apoptosis. In contrast, wild-type Egr2 or an Egr2 point mutant unable to bind the endogenous repressors Nab1/2 (caEgr2) suppresses basal osteoclast apoptosis and rescues osteoclasts from apoptosis induced by MEK1/2 or Egr2 inhibition. Mechanistically, Egr2 induces pro-survival Blc2 family member Mcl1 while stimulating proteasome-mediated degradation of pro-apoptotic Bim. In addition, Egr2 increased the expression of c-Cbl, the E3 ubiquitin ligase that catalyzes Bim ubiquitination. M-CSF, therefore, promotes osteoclast survival through MEK/ERK-dependent induction of Egr2 to control the Mcl1/Bim ratio, documenting a novel function of Egr2 in promoting survival. Although bone in young adults is continually resorbed and rebuilt in a balanced manner, unbalanced bone loss results from increased bone resorption without concomitant replacement with an equal amount of new bone. Osteoclastic bone resorption is governed primarily by the numbers of osteoclasts present at the site of bone remodeling and the activity of those osteoclasts (1Rodan G.A. Martin T.J. Science. 2000; 289: 1508-1514Crossref PubMed Scopus (1487) Google Scholar). Therefore, factors affecting osteoclastogenesis and osteoclast survival are key to regulating the amount of bone resorbed. Macrophage colony-stimulating factor (M-CSF) 2The abbreviations used are: M-CSFmacrophage colony-stimulating factorRANKLreceptor activator for nuclear factor-κB ligandMAPmitogen-activated proteinERKextracellular signal-regulated kinaseMEKMAP kinase/extracellular signal-regulated kinase kinaseαMEMα-minimum essential mediumRTreverse transcription. and receptor activator for nuclear factor-κB ligand (RANKL) are two cytokines both necessary and sufficient to mediate osteoclast differentiation from hematopoietic cells within the monocyte/macrophage lineage (2Takahashi N. Yamana H. Yoshiki S. Roodman G.D. Mundy G.R. Jones S.J. Boyde A. Suda T. Endocrinology. 1988; 122: 1373-1382Crossref PubMed Scopus (697) Google Scholar, 3Udagawa N. Takahashi N. Akatsu T. Sasaki T. Yamaguchi A. Kodama H. Martin T.J. Suda T. Endocrinology. 1989; 125: 1805-1813Crossref PubMed Scopus (446) Google Scholar). M-CSF binds to the receptor tyrosine kinase member c-fms, which then activates intracellular signaling through an autophosphorylation event (4Jaworowski A. Christy E. Yusoff P. Byrne R. Hamilton J.A. Biochem. J. 1996; 320: 1011-1016Crossref PubMed Scopus (29) Google Scholar). Although M-CSF is known to promote osteoclast survival, the mechanism by which M-CSF mediates survival is unknown. Mitogen-activated protein (MAP) kinases are specific protein kinases influencing cell proliferation, differentiation, and survival. All three MAP kinase pathways, namely the MEK/ERK, p38 MAPK, and c-Jun NH2-terminal kinase pathways, play roles in osteoclasts either in differentiation and/or in mediating osteoclast function and survival (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar, 6Li X. Udagawa N. Itoh K. Suda K. Murase Y. Nishihara T. Suda T. Takahashi N. Endocrinology. 2002; 143: 3105-3113Crossref PubMed Scopus (171) Google Scholar, 7Nakamura H. Hirata A. Tsuji T. Yamamoto T. J. Bone Miner. Res. 2003; 18: 1198-1205Crossref PubMed Scopus (83) Google Scholar, 8Miyazaki T. Katagiri H. Kanegae Y. Takayanagi H. Sawada Y. Yamamoto A. Pando M.P. Asano T. Verma I.M. Oda H. Nakamura K. Tanaka S. J. Cell Biol. 2000; 148: 333-342Crossref PubMed Scopus (343) Google Scholar, 9Sato S. Fujita N. Tsuruo T. J. Biol. Chem. 2004; 279: 33759-33767Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Thus, activation of these pathways is crucial in modulating bone resorption rates. Chemical inhibition of MEK1/2, which inhibits the phosphorylation of the MAP kinases ERK1/2, increases osteoclast apoptosis and leads to a loss of cell polarity (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar, 7Nakamura H. Hirata A. Tsuji T. Yamamoto T. J. Bone Miner. Res. 2003; 18: 1198-1205Crossref PubMed Scopus (83) Google Scholar). Once activated by MEK, ERK modulates cell cycle regulation and post-mitotic functions (10Johnson G.L. Lapadat R. Science. 2002; 298: 1911-1912Crossref PubMed Scopus (3542) Google Scholar). In osteoclasts, ERK activation has been demonstrated to influence survival (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar, 7Nakamura H. Hirata A. Tsuji T. Yamamoto T. J. Bone Miner. Res. 2003; 18: 1198-1205Crossref PubMed Scopus (83) Google Scholar, 9Sato S. Fujita N. Tsuruo T. J. Biol. Chem. 2004; 279: 33759-33767Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Although the MEK/ERK pathway influences osteoclast survival, the mechanism of activation and downstream effectors of this pathway remain unresolved. macrophage colony-stimulating factor receptor activator for nuclear factor-κB ligand mitogen-activated protein extracellular signal-regulated kinase MAP kinase/extracellular signal-regulated kinase kinase α-minimum essential medium reverse transcription. M-CSF promotes expression of the early gene response (Egr) family of transcription factors during macrophage differentiation (11Carter J.H. Tourtellotte W.G. J. Immunol. 2007; 178: 3038-3047Crossref PubMed Scopus (43) Google Scholar). This immediate early gene family is part of the Kruppel-like zinc finger transcription factor family and is comprised of Egr1, Egr2, Egr3, Egr4, and the Wilms' Tumor transcription factor. Egr1, Egr2, and Egr3 contain a repressor domain involved in binding of two corepressors, Nab1 and Nab2 (12Russo M.W. Sevetson B.R. Milbrandt J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6873-6877Crossref PubMed Scopus (252) Google Scholar, 13Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar). Although the zinc finger binding domains of the Egr family members are virtually identical, the remaining domains differ significantly, implying unique functions for each of these transcription factors (14O'Donovan K.J. Tourtellotte W.G. Millbrandt J. Baraban J.M. Trends Neurosci. 1999; 22: 167-173Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar). Egr1 up-regulation in prostate cancer cells is thought to promote cell growth and transformation through increased expression of cyclin D1 (15Xiao D. Chinnappan D. Pestell R. Albanese C. Weber H.C. Cancer Res. 2005; 65: 9934-9942Crossref PubMed Scopus (44) Google Scholar, 16Baron V. De Gregorio G. Krones-Herzig A. Virolle T. Calogero A. Urcis R. Mercola D. Oncogene. 2003; 22: 4194-4204Crossref PubMed Scopus (99) Google Scholar). However, Egr1 expression is either down-regulated or promotes apoptosis in other cancer cell lines (17Ke J. Gururajan M. Kumar A. Simmons A. Turcios L. Chelvarajan R.L. Cohen D.M. Wiest D.L. Monroe J.G. Bondada S. J. Biol. Chem. 2006; 281: 39806-39818Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar, 18Lim J.H. Park J.W. Min D.S. Chang J.S. Lee Y.H. Park Y.B. Choi K.S. Kwon T.K. Apoptosis. 2007; 12: 411-421Crossref PubMed Scopus (85) Google Scholar, 19Lucerna M. Pomyje J. Mechtcheriakova D. Kadl A. Gruber F. Bilban M. Sobanov Y. Schabbauer G. Breuss J. Wagner O. Bischoff M. Clauss M. Binder B.R. Hofer E. Cancer Res. 2006; 66: 6708-6713Crossref PubMed Scopus (61) Google Scholar), indicating cell-type specific responses. Egr2 expression has been primarily reported to promote apoptosis through transactivation of p53, FasL, Bak, and BNIP3 or suppress proliferation through PTEN expression (20Droin N.M. Pinkoski M.J. Dejardin E. Green D.R. Mol. Cell. Biol. 2003; 23: 7638-7647Crossref PubMed Scopus (59) Google Scholar, 21Unoki M. Nakamura Y. Oncogene. 2001; 20: 4457-4465Crossref PubMed Scopus (315) Google Scholar, 22Unoki M. Nakamura Y. Oncogene. 2003; 22: 2172-2185Crossref PubMed Scopus (84) Google Scholar). To date, a pro-survival role for Egr2 has not been reported in any cell type. Promotion of osteoclast apoptosis is triggered by an internal mechanism regulated by the release of cytochrome c from the mitochondria and subsequent caspase activation (23Oursler M.J. Bradley E.W. Elfering S.L. Giulivi C. Am. J. Physiol. Cell Physiol. 2005; 288: 156-168Crossref PubMed Scopus (33) Google Scholar). Cytochrome c release is controlled by the influence Bcl2 family proteins have on the stability of the mitochondrial membrane. The two main classes of Bcl2 family proteins are divided by their ability to either promote or inhibit apoptotic responses and their structural similarity. Family members with the most homology to Bcl2 antagonize apoptosis. These pro-survival Bcl2 members include Bcl2, BclxL, Mcl1, and Bclw. In contrast to Bcl2, there are also family members that promote apoptosis. The pro-apoptotic members include Bax, Bak, Bim, Bad, Bik, Blk, Hrk, Bid, Bok/Mtd, and Bcl-xS, a splice variant of BclxL (24Boyd J.M. Gallo G.J. Elangovan B. Houghton A.B. Malstrom S. Avery B.J. Ebb R.G. Subramanian T. Chittenden T. Lutz R.J. Oncogene. 1995; 11: 1921-1928PubMed Google Scholar, 25Hsu S.Y. Kaipia A. McGee E. Lomeli M. Hsueh A.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12401-12406Crossref PubMed Scopus (296) Google Scholar, 26Hegde R. Srinivasula S.M. Ahmad M. Fernandes-Alnemri T. Alnemri E.S. J. Biol. Chem. 1998; 273: 7783-7786Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 27Inohara N. Ding L. Chen S. Nunez G. EMBO J. 1997; 16: 1686-1694Crossref PubMed Scopus (332) Google Scholar, 28Inohara N. Ekhterae D. Garcia I. Carrio R. Merino J. Merry A. Chen S. Nunez G. J. Biol. Chem. 1998; 273: 8705-8710Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 29Minn A.J. Boise L.H. Thompson C.B. J. Biol. Chem. 1996; 271: 6306-6312Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 30O'Connor L. Strasser A. O'Reilly L.A. Hausmann G. Adams J.M. Cory S. Huang D.C. EMBO J. 1998; 17: 384-395Crossref PubMed Scopus (954) Google Scholar, 31Oltvai Z.N. Milliman C.L. Korsmeyer S.J. Cell. 1993; 74: 609-619Abstract Full Text PDF PubMed Scopus (5878) Google Scholar, 32Wang K. Yin X.M. Chao D.T. Milliman C.L. Korsmeyer S.J. Genes Dev. 1996; 10: 2859-2869Crossref PubMed Scopus (808) Google Scholar, 33Yang E. Zha J. Jockel J. Boise L.H. Thompson C.B. Korsmeyer S.J. Cell. 1995; 80: 285-291Abstract Full Text PDF PubMed Scopus (1897) Google Scholar). Members of the Bcl2 family participate in both hetero- and homodimerization. Although heterodimerization is not a requirement for the function for the pro-survival members, it is essential for the function of some members that promote apoptosis (34Yin X.M. Oltvai Z.N. Korsmeyer S.J. Nature. 1994; 369: 321-323Crossref PubMed Scopus (1221) Google Scholar). These members are localized within the cytosol and must form a dimer with another member located on a membrane to exert their action. Expression of Bcl2 promotes survival of osteoclasts, rescues cells from cycloheximide-induced apoptosis, and reduces caspase 9 activation (23Oursler M.J. Bradley E.W. Elfering S.L. Giulivi C. Am. J. Physiol. Cell Physiol. 2005; 288: 156-168Crossref PubMed Scopus (33) Google Scholar). In addition, Bim deficiency leads to increased bone density and increased osteoclast survival (35Akiyama T. Bouillet P. Miyazaki T. Kadono Y. Chikuda H. Chung U.I. Fukuda A. Hikita A. Seto H. Okada T. Inaba T. Sanjay A. Baron R. Kawaguchi H. Oda H. Nakamura K. Strasser A. Tanaka S. EMBO J. 2003; 22: 6653-6664Crossref PubMed Scopus (225) Google Scholar). However, endogenous responses mediated by activation of the MEK/ERK pathway leading to altered expression of pro-survival and/or pro-apoptotic Bcl2 family members has yet to be identified. Bim levels are regulated through degradation by the 26 S proteasome (36Ley R. Balmanno K. Hadfield K. Weston C. Cook S.J. J. Biol. Chem. 2003; 278: 18811-18816Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar), and events catalyzed by polyubiquitination are mediated by the E3 ligase c-Cbl in osteoclasts (35Akiyama T. Bouillet P. Miyazaki T. Kadono Y. Chikuda H. Chung U.I. Fukuda A. Hikita A. Seto H. Okada T. Inaba T. Sanjay A. Baron R. Kawaguchi H. Oda H. Nakamura K. Strasser A. Tanaka S. EMBO J. 2003; 22: 6653-6664Crossref PubMed Scopus (225) Google Scholar). The Cbl proteins, c-Cbl, Cbl-b, and Cbl-c, are RING-type E3 ubiquitin ligases (37Levkowitz G. Waterman H. Ettenberg S.A. Katz M. Tsygankov A.Y. Alroy I. Lavi S. Iwai K. Reiss Y. Ciechanover A. Lipkowitz S. Yarden Y. Mol. Cell. 1999; 4: 1029-1040Abstract Full Text Full Text PDF PubMed Scopus (836) Google Scholar, 38Joazeiro C.A. Wing S.S. Huang H. Leverson J.D. Hunter T. Liu Y.C. Science. 1999; 286: 309-312Crossref PubMed Scopus (916) Google Scholar). c-Cbl regulates protein-tyrosine kinase activity through receptor down-regulation, functions as an adaptor protein, and regulates signal transduction events involved in phosphatidylinositol 3-kinase and MAP kinase signaling (39Swaminathan G. Tsygankov A.Y. J. Cell. Physiol. 2006; 209: 21-43Crossref PubMed Scopus (236) Google Scholar). In addition to controlling levels of Bim, c-Cbl modulates osteoclast resorption, motility, and podosome formation through c-Src interactions and cytoskeletal regulation (40Tanaka S. Amling M. Neff L. Peyman A. Uhlmann E. Levy J.B. Baron R. Nature. 1996; 383: 528-531Crossref PubMed Scopus (252) Google Scholar, 41Sanjay A. Houghton A. Neff L. DiDomenico E. Bardelay C. Antoine E. Levy J. Gailit J. Bowtell D. Horne W.C. Baron R. J. Cell Biol. 2001; 152: 181-195Crossref PubMed Scopus (340) Google Scholar, 42Faccio R. Novack D.V. Zallone A. Ross F.P. Teitelbaum S.L. J. Cell Biol. 2003; 162: 499-509Crossref PubMed Scopus (150) Google Scholar). Given the role M-CSF plays in supporting osteoclast survival, the molecular signals through which M-CSF promotes survival were investigated. The work reported here shows that M-CSF transiently activates the MEK/ERK pathway to promote osteoclast survival. Activation of this pathway by M-CSF leads to expression of Egr1 and Egr2. The specific roles Egr1 and Egr2 play in regulation of osteoclast survival were examined. Egr1 did not function to promote osteoclast survival, whereas the findings reported here demonstrate a novel pro-survival function for Egr2 downstream of M-CSF-mediated MEK/ERK activation. In this report we also identify the mechanism of Egr2-promoted osteoclast survival. Egr2 function is required for expression of pro-survival Bcl2 family member Mcl1, whereas Egr2 also promotes proteasome-mediated degradation of proapoptotic Bim by regulating expression of the E3 ubiquitin ligase c-Cbl. Thus, Egr2 functions through a novel pro-survival mechanism in osteoclasts by increasing Mcl1 expression and increasing targeted degradation of Bim through up-regulation of c-Cbl. Unless otherwise noted, all chemical were purchased form Sigma-Aldrich. Osteoclast Differentiation—Mouse marrow osteoclast precursors were obtained from female Balb/c mice (The Jackson Laboratory, Bar Harbor, ME) as previously described (23Oursler M.J. Bradley E.W. Elfering S.L. Giulivi C. Am. J. Physiol. Cell Physiol. 2005; 288: 156-168Crossref PubMed Scopus (33) Google Scholar). Long bones of the hind limbs of 4-6-week-old mice were removed after sacrifice, and the marrow was flushed out with sterile phosphate-buffered saline. Marrow aspirates were plated at a density of 2.9 × 107 in 100-mm dishes in αMEM supplemented with 10% (v/v) fetal bovine serum (Hyclone, Logan, UT) and 25 ng/ml M-CSF (R&D Systems, Minneapolis, MN) for 24 h. Non-adherent cells were collected and plated in αMEM, 10% (v/v) fetal bovine serum at a density of 2 × 105 cells/cm in 24 well-plates and supplemented with 25 ng/ml M-CSF and 100 ng/ml recombinant RANKL. Cells were fed after 3 days in culture with αMEM containing 10% (v/v) fetal bovine serum, 25 ng/ml M-CSF, and 100 ng/ml recombinant RANKL. Once mature, osteoclasts were treated as per experimental design. Real-time RT-PCR—Osteoclasts were differentiated as above and serum-starved for 1 h in αMEM. After serum starvation, osteoclasts were harvested immediately for total RNA or cultured with 25 ng/ml M-CSF for the indicated period, rinsed with phosphate-buffered saline, and harvested for total RNA. Total RNA was harvested in TRIzol reagent (Invitrogen), and phenol/chloroform was extracted from which 1 μg of RNA was reverse-transcribed using oligo(dT) primers. The resulting cDNA samples were used in real-time RT-PCR analysis of Egr1 (gacgagttatcccagccaaa, ggcagaggaagacgatgaag), Egr2 (gaaggaacggaagagcagtg, atctcacggtgtcctggttc), Egr3 (agacgtggaggccatgtatc, gggaaaagattgctgtccaa), Mcl1 (gcagagcctgttgtgtgtgt, agtgaagagcacagggagga), Bim (ccctcctaggacctccattc, gcgacgtttgcactctaaca), c-Cbl (ttttgccgatgtgaaatcaa, ccatggagaatggagaggaa), and tubulin (ctgctcatcagcaagatcagag, gcattatagggctccaccacag) expression as outlined in Karst et al. (43Karst M. Gorny G. Galvin R.J. Oursler M.J. J. Cell. Physiol. 2004; 200: 99-106Crossref PubMed Scopus (139) Google Scholar). Expression of Egr1, Egr2, and Egr3 transcripts was normalized to tubulin transcript levels for each sample. -Fold changes for each sample as compared with time 0 were then calculated. Data are the result of three replicate biological samples. Each experiment was performed in triplicate. Western Blotting—Osteoclasts were differentiated as above and serum-starved in αMEM for 1 h. The MEK1/2 inhibitor UO126 was used at a concentration of 10 μm where indicated during serum starvation and subsequent treatments. The 26 S proteasome inhibitor MG-132 was used at a concentration of 42 nm as indicated during serum starvation and culture. After serum starvation, osteoclasts were either harvested immediately for Western blotting or cultured with 25 ng/ml M-CSF for the indicated time period, rinsed with phosphate-buffered saline, and harvested for Western blotting. Harvesting was accomplished by scraping into SDS sample buffer lacking β-mercaptoethanol and bromphenol blue. To ensure that equal cell protein was analyzed, total protein was quantified using the Bio-Rad Dc assay as per the manufacturer's instructions, and equal protein (60 μg) was loaded (Bio-Rad). Before loading, 1 μl of β-mercaptoethanol and bromphenol blue were added to each sample. Western blotting was carried out using antibodies directed against total and phospho-MEK1/2 (Ser-217/221), total and phospho-ERK1/2 (Thr-202/Tyr-204), Egr1, Bim, ubiquitin (Cell Signaling, Beverly, MA), Egr2 (Santa Cruz Biotechnology, Santa Cruz, CA), Nab2 (Active Motif, Carlsbad, CA), Mcl1 (Abcam, Cambridge, MA), c-Cbl (BD Transduction Laboratories), and tubulin (E7, Hybridoma Bank, Iowa State, IA) at a 1:1000 dilution and the corresponding secondary antibodies (Cell Signaling) at a 1:10,000 dilution with chemiluminescent detection using the Pierce femto reagent. Blots were stripped and reprobed for total protein expression using a Western blot Recycling Kit (Alpha Diagnostics, San Antonio, TX). Each experiment was carried out a minimum of three times. Bim Ubiquitination Assay—Osteoclasts were differentiated as above, serum-starved for 1 h, and either harvested in radioimmune precipitation assay buffer (Santa Cruz Biotechnology) containing sodium orthovanadate, phenylmethylsulfonyl fluoride, and a protease inhibitor mixture or incubated with 25 ng/ml M-CSF as indicated. After M-CSF treatment, osteoclasts were harvested in radioimmune precipitation assay buffer as above. A 500-μg sample of the resulting cell lysates was incubated with total Bim antibody for 15 min at 4 °C, after which a 60-μl aliquot of 50% protein A-agarose slurry was added and incubated with the samples overnight at 4 °C. A 60-μg sample of total cell lysate was saved for total tubulin levels as assayed by Western blotting. After overnight incubation, beads were pelleted and washed 2 times with each of 10 mm Tris, pH 8.0, 150 mm NaCl, 0.5% Nonidet P-40, 0.05% SDS; 10 mm Tris pH 8.0, 150 mm NaCl, 0.5% Nonidet P-40, 0.05% SDS, 0.5% dideoxycholate, and 10 mm Tris, pH 8.0, 150 mm NaCl, 0.05% SDS. SDS sample buffer containing bromphenol blue and β-mercaptoethanol was then added to the beads. Samples were boiled and pelleted. The resulting supernatant was used in a Western blot for ubiquitin and stripped and reprobed for total Bim. Apoptosis Detection—Mature osteoclasts were serum-starved for 60 min and treated with 25 ng/ml M-CSF for 8 h and fixed with 1% paraformaldehyde. Fixed osteoclasts were stained for 60 min with Hoechst 33258 diluted to 5 mg/ml in phosphate-buffered saline with 0.01% Tween 20 as described in Gingery et al. (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar). The cells were then tartrate-resistant acid phosphatase-stained as previously described and examined using fluorescent microscopy for apoptotic osteoclasts displaying strongly condensed nuclei (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar). For apoptosis and osteoclast cell number measurements, six replicate coverslips were plated and analyzed for each treatment. Each experiment was repeated three times, where n = 6 with representative data reported. Adenovirus Infections—Adenoviral constructs for Nab2, wild type, and caEgr1 were a kind gift from Dr. M. Ehrengruber (65Ehrengruber M.U. Muhlebach S.G. Sohrman S. Leutenegger C.M. Lester H.A. Davidson N. Gene. 2000; 258: 63-69Crossref PubMed Scopus (59) Google Scholar). The adenoviral construct for dominant negative MEK1 was received from L. F. Parada. Wild-type Egr2 virus was purchased from Vector Biolabs, Philadelphia, PA. An expression construct for caEgr2 containing an I268N transversion, a gift from Dr. J. Milbrandt, was used in a custom construction of the corresponding adenovirus (Vector Biolabs). Viruses were expanded and titered according to standard procedures as needed. Mature osteoclasts were infected with each indicated virus at a multiplicity of infection of 100 for 18 h before the experimental procedures. Statistical Analysis—Data obtained are the mean ± S.D. and are representative of three replicate experiments. The effect of treatment was compared with control values using Student's t test to assess significant differences using Microsoft Excel Apple software. M-CSF Transiently Activates the MEK/ERK Pathway to Promote Osteoclast Survival—Mature osteoclasts were serum-starved and treated with 25 ng/ml M-CSF for 0-30 min (Fig. 1A). A rapid increase in the phosphorylation of both MEK1/2 and ERK1/2 was induced by M-CSF. To determine whether blocking MEK could block M-CSF-mediated activation of this pathway, MEK activity was blocked through chemical inhibition of MEK1/2 by UO126 (Fig. 1B). M-CSF stimulated activation of ERK after 5 min, and chemical inhibition of MEK1/2 blocked ERK1/2 activation induced by M-CSF administration (Fig. 1B). Because these data confirmed M-CSF-mediated MEK/ERK activation, the influences of M-CSF-mediated activation of the MEK/ERK pathway on osteoclast survival were examined. To examine the role of MEK in M-CSF-mediated osteoclast survival, osteoclasts were treated with M-CSF in the presence of the MEK1/2 inhibitor, vehicle control, or no treatment. As documented previously, examination of nuclear condensation clearly delineated apoptotic osteoclasts (Fig. 1C) (5Gingery A. Bradley E. Shaw A. Oursler M.J. J. Cell. Biochem. 2003; 89: 165-179Crossref PubMed Scopus (160) Google Scholar). Using this basis, the percentage of apoptotic osteoclasts associated with each treatment were determined. M-CSF treatment sustained osteoclast survival under serum-free conditions as previously described (Fig. 1D) (44Fuller K. Owens J.M. Jagger C.J. Wilson A. Moss R. Chambers T.J. J. Exp. Med. 1993; 178: 1733-1744Crossref PubMed Scopus (313) Google Scholar). Blocking MEK1/2 activity through UO126 treatment abolished the pro-survival effects of M-CSF and increased osteoclast apoptosis (Fig. 1D). Thus, M-CSF-promoted osteoclast survival can be blocked through chemical inhibition of MEK1/2. The Immediate Early Genes Egr1 and Egr2 Are Induced by M-CSF-mediated Activation of the MEK/ERK Pathway—Because activation of the MEK/ERK pathway in response to M-CSF is crucial in supporting osteoclast survival, potential downstream targets of this pathway were next examined. The Egr (early gene response) family genes Egr1, Egr2, and Egr3 are induced by M-CSF during macrophage differentiation (11Carter J.H. Tourtellotte W.G. J. Immunol. 2007; 178: 3038-3047Crossref PubMed Scopus (43) Google Scholar). For this reason, Egr1, Egr2, and Egr3 were identified as candidate downstream effectors of the MEK/ERK pathway potentially involved in osteoclast survival. To explore this possibility, expression of the Egr transcription factors in response to M-CSF treatment of mature osteoclasts was evaluated. Mature osteoclasts were serum-starved and treated with M-CSF as indicated in Fig. 2. After M-CSF treatment, total RNA was harvested and analyzed by real-time RT-PCR for Egr1, Egr2, and Egr3 transcripts. As indicated in Fig. 2A, M-CSF treatment led to a robust and transient increase in Egr1 and Egr2 transcripts. A change in Egr3 transcript levels was not observed with M-CSF addition (data not shown). Because transcript levels of Egr1 and Egr2 were up-regulated by M-CSF, MEK-dependent protein expression of Egr1 and Egr2 downstream of M-CSF was tested. The addition of M-CSF after serum starvation increased expression of both Egr1 and Egr2 (Fig. 2B). This response was blocked through chemical inhibition of MEK1/2 (Fig. 2C). These data demonstrate that M-CSF treatment of mature osteoclasts leads to MEK-dependent expression of two Kruppel-like transcription factors, Egr1 and Egr2. Egr2 Function Suppresses Osteoclast Apoptosis—Given the rapid, transient MEK-dependent expression of these immediate early genes upon M-CSF treatment, potential roles for this gene family in suppression of osteoclast apoptosis were explored. To inhibit the function of all Egr family members, the Egr family corepressor Nab2, which binds to a specific repressor domain shared by Egr1, Egr2, and Egr3, was employed (12Russo M.W. Sevetson B.R. Milbrandt J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6873-6877Crossref PubMed Scopus (252) Google Scholar, 13Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Crossref PubMed Scopus (328) Google Scholar). We also determined if additive effects caused by MEK inhibition and Nab2 expression were evident, as this would imply separate mechanisms. An increase in osteoclast apoptosis with Nab2 expression as compared with vector infection was observed (Fig. 3A), supporting a role for the Egr transcription factors in promotion of osteoclast survival. Although both Nab2 and MEK inhibition increased osteoclast apoptosis, a further increase in osteoclast apoptosis with Nab2 expression in combination with UO126 treatment was not evident (Fig. 3A). In addition, numbers of total osteoclasts were also determined (Fig. 3B). A difference in overall total numbers of osteoclasts was not observed. A trend toward decreased overall cell numbers in osteoclasts treated with UO126 in combination with Nab2 infection as compared with either treatment alone was observed (Fig. 3B). These data suggest a role for Egr1 and/or Egr2 in M-CSF-suppressed osteoclast apoptosis and demonstrate the necessity of Egr family members in the promotion of MEK-dependent osteoclast survival. Because Nab2 expression increased osteoclast apoptosis and both Egr1 and Egr2 were expressed in response to M-CSF in mature osteoclasts, Egr1 and Egr2 were evaluated as potential regulators of osteoclast apoptosis. Wild-type forms of both Egr1 and Egr2 as well as two point mutants (caEgr1 and caEgr2) were used to test this possibility. This point mutation occurs within the repressor domain of each transcription factor and abolishes the interaction between Egr1/2 and Nab1/2. Osteoclasts were infected with each respective adenovirus and treated with M-CSF after serum starvation. Expression of ei

Referência(s)