Portal de Periódicos da CAPES

Self-association of the Spindle Pole Body-related Intermediate Filament Protein Fin1p and Its Phosphorylation-dependent Interaction with 14-3-3 Proteins in Yeast

2003; Elsevier BV; Volume: 278; Issue: 17 Linguagem: Inglês

10.1074/jbc.m212495200

1083-351X

Martijn J. van Hemert, André M. Deelder, Chris Molenaar, H. Yde Steensma, G. Paul H. van Heusden,

Microtubule and mitosis dynamics

The Fin1 protein of the yeastSaccharomyces cerevisiae forms filaments between the spindle pole bodies of dividing cells. In the two-hybrid system it binds to 14-3-3 proteins, which are highly conserved proteins involved in many cellular processes and which are capable of binding to more than 120 different proteins. Here, we describe the interaction of the Fin1 protein with the 14-3-3 proteins Bmh1p and Bmh2p in more detail. Purified Fin1p interacts with recombinant yeast 14-3-3 proteins. This interaction is strongly reduced after dephosphorylation of Fin1p. Surface plasmon resonance analysis showed that Fin1p has a higher affinity for Bmh2p than for Bmh1p (KD 289versus 585 nm). Sequences in both the central and C-terminal part of Fin1p are required for the interaction with Bmh2p in the two-hybrid system. In yeast strains lacking 14-3-3 proteins Fin1 filament formation was observed, indicating that the 14-3-3 proteins are not required for this process. Fin1 also interacts with itself in the two-hybrid system. For this interaction sequences at the C terminus, containing one of two putative coiled-coil regions, are sufficient. Fin1p-Fin1p interactions were demonstrated in vivo by fluorescent resonance energy transfer between cyan fluorescent protein-labeled Fin1p and yellow fluorescent protein-labeled Fin1p. The Fin1 protein of the yeastSaccharomyces cerevisiae forms filaments between the spindle pole bodies of dividing cells. In the two-hybrid system it binds to 14-3-3 proteins, which are highly conserved proteins involved in many cellular processes and which are capable of binding to more than 120 different proteins. Here, we describe the interaction of the Fin1 protein with the 14-3-3 proteins Bmh1p and Bmh2p in more detail. Purified Fin1p interacts with recombinant yeast 14-3-3 proteins. This interaction is strongly reduced after dephosphorylation of Fin1p. Surface plasmon resonance analysis showed that Fin1p has a higher affinity for Bmh2p than for Bmh1p (KD 289versus 585 nm). Sequences in both the central and C-terminal part of Fin1p are required for the interaction with Bmh2p in the two-hybrid system. In yeast strains lacking 14-3-3 proteins Fin1 filament formation was observed, indicating that the 14-3-3 proteins are not required for this process. Fin1 also interacts with itself in the two-hybrid system. For this interaction sequences at the C terminus, containing one of two putative coiled-coil regions, are sufficient. Fin1p-Fin1p interactions were demonstrated in vivo by fluorescent resonance energy transfer between cyan fluorescent protein-labeled Fin1p and yellow fluorescent protein-labeled Fin1p. green fluorescent protein activating domain binding domain fluorescence resonance energy transfer cyan fluorescent protein yellow fluorescent protein enzyme-linked immunosorbent assay The Saccharomyces cerevisiae FIN1 gene encodes a protein of 291 amino acids with a predicted pI of 10 that contains two putative coiled-coil regions at its C terminus. We showed recently (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar) that the subcellular localization of the GFP1-Fin1 protein is highly cell cycle-dependent (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar). In large budded cells the protein is visible as a filament between the two spindle pole bodies. In resting cells the protein is undetectable, and in small budded cells it is localized in the nucleus. During late mitosis it localizes on the spindle pole bodies. Purified His6-tagged Fin1p self-assembles into filaments with a diameter of ∼10 nm after dialysis against low salt buffers as is observed for other intermediate filament-forming proteins. The Fin1 protein is an interaction partner of the yeast 14-3-3 protein Bmh2 (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar). The 14-3-3 proteins form a family of highly conserved acidic dimeric proteins that are present, often in multiple isoforms, in all eukaryotic organisms (for review see Refs. 2Aitken A. Trends Cell Biol. 1996; 6: 341-347Abstract Full Text PDF PubMed Scopus (349) Google Scholar, 3Finnie C. Borch J. Collinge D.B. Plant Mol. Biol. 1999; 40: 545-554Crossref PubMed Scopus (119) Google Scholar, 4Chung H.J. Sehnke P.C. Ferl R.J. Trends Plant Sci. 1999; 4: 367-371Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 5Fu H. Subramanian R.R. Masters S.C. Annu. Rev. Pharmacol. Toxicol. 2001; 40: 617-647Crossref Scopus (1334) Google Scholar, 6Van Hemert M.J. Steensma H.Y. van Heusden G.P.H. Bioessays. 2001; 23: 936-946Crossref PubMed Scopus (473) Google Scholar). They bind to more than 120 different proteins and play a role in the regulation of many cellular processes, including signaling, cell cycle control, apoptosis, exocytosis, cytoskeletal rearrangements, transcription, and regulation of enzymes. Although the exact function of the 14-3-3 proteins is still not completely understood, three main mechanisms seem to be important. First, 14-3-3 proteins positively or negatively regulate the activity of enzymes; second, 14-3-3 proteins may act as localization anchors, controlling the subcellular localization of proteins; and third, 14-3-3 proteins can function as adaptor molecules or scaffolds, thus stimulating protein-protein interactions. Binding motifs have been identified in a number of proteins that bind to the 14-3-3 proteins. Many of these binding motifs consist of a phosphorylated serine residue, flanked by a proline and arginine residue (7Muslin A.J. Tanner J.W. Allen P.M. Shaw A.S. Cell. 1996; 84: 889-897Abstract Full Text Full Text PDF PubMed Scopus (1195) Google Scholar, 8Yaffe M.B. Rittinger K. Volinia S. Caron P.R. Aitken A. Leffers H. Gamblin S.J. Smerdon S.J. Cantley L.C. Cell. 1997; 91: 961-971Abstract Full Text Full Text PDF PubMed Scopus (1353) Google Scholar, 9Liu Y.C. Liu Y. Elly C. Yoshida H. Lipkowitz S. Altman A. J. Biol. Chem. 1997; 272: 9979-9985Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). However, other 14-3-3 binding motifs have been identified that are seemingly unrelated and do not contain a phosphoserine (10Andrews R.K. Harris S.J. McNally T. Berndt M.C. Biochemistry. 1998; 37: 638-647Crossref PubMed Scopus (120) Google Scholar, 11Petosa C. Masters S.C. Bankston L.A. Pohl J. Wang B.C. Fu H.I. Liddington R.C. J. Biol. Chem. 1998; 273: 16305-16310Abstract Full Text Full Text PDF PubMed Scopus (281) Google Scholar). The yeast S. cerevisiae has two genes,BMH1 and BMH2, encoding 14-3-3 proteins (12van Heusden G.P.H. Wenzel T.J. Lagendijk E.L. Steensma H.Y. van den Berg J.A. FEBS Lett. 1992; 302: 145-150Crossref PubMed Scopus (113) Google Scholar, 13van Heusden G.P.H. Griffiths D.J. Ford J.C. Chin A.W.-T. Schrader P.A. Carr A.M. Steensma H.Y. Eur. J. Biochem. 1995; 229: 45-53Crossref PubMed Scopus (140) Google Scholar, 14Van Hemert M.J. van Heusden G.P.H. Steensma H.Y. Yeast. 2001; 18: 889-895Crossref PubMed Scopus (41) Google Scholar, 15Gelperin D. Weigle J. Nelson K. Roseboom P. Irie K. Matsumoto K. Lemmon S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11539-11543Crossref PubMed Scopus (147) Google Scholar). A bmh1 bmh2 disruption is lethal in most but not all laboratory strains, and the lethal bmh1 bmh2 disruption can be complemented by at least four of the Arabidopsis isoforms and by a human and Dictyostelium isoform (16Knetsch M.L.W. van Heusden G.P.H. Ennis H.L. Shaw D.R. Epskamp S.J.P. Snaar-Jagalska B.E. Biochim. Biophys. Acta. 1997; 1357: 243-248Crossref PubMed Scopus (13) Google Scholar). As in higher eukaryotes, the S. cerevisiae 14-3-3 proteins are involved in many cellular processes, and many different binding partners have been identified (14Van Hemert M.J. van Heusden G.P.H. Steensma H.Y. Yeast. 2001; 18: 889-895Crossref PubMed Scopus (41) Google Scholar), including the protein kinases Ste20p (17Roberts R.L. Mosch H.U. Fink G.R. Cell. 1997; 89: 1055-1065Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar) and Yak1p (18Moriya H. Shimizu-Yoshida Y. Omori A. Iwashita S. Katoh M. Sakai A. Genes Dev. 2001; 15: 1217-1228Crossref PubMed Scopus (121) Google Scholar) and the transcription factors Rtg3 (19van Heusden G.P.H. Steensma H.Y. Yeast. 2001; 18: 1479-1491Crossref PubMed Scopus (27) Google Scholar), Msn2, and Msn4 (20Beck T. Hall M.N. Nature. 1999; 402: 689-692Crossref PubMed Scopus (803) Google Scholar). Recently, it has been shown (21Callejo M. Alvarez D. Price G.B. Zannis-Hadjopoulos M. J. Biol. Chem. 2002; 277: 38416-38423Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar) that the yeast 14-3-3 proteins bind to cruciform DNA. Here, we describe the two-hybrid screen identifying the Fin1 protein as an interaction partner of the Bmh2 protein and detailed studies on the interaction between of the Fin1 protein and the yeast 14-3-3 proteins. In addition, the self-association of Fin1p was studied using both the yeast two-hybrid system and fluorescence resonance energy transfer in intact yeast cells. S. cerevisiae HF7c (22James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar) was used as reporter strain in two-hybrid screens. S. cerevisiae strain GG3100 is CEN-PK113-5D (MATa ura3–52; P. Kötter, Göttingen, Germany) containing plasmid pRUL182. The bmh1 bmh2 strain RR1249 and the isogenic control strain F3α were obtained from Dr. G. R. Fink (MIT, Cambridge, MA) (17Roberts R.L. Mosch H.U. Fink G.R. Cell. 1997; 89: 1055-1065Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). GG3066 expressing both CFP-Fin1 and YFP-Fin1, was constructed by transformation of CENPK113–3B (MATα ura3–52 his3; P. Kötter, Göttingen, Germany) with the plasmids pRUL1005 (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar) and pRUL1008. The control strain GG3087 expressing free CFP and free YFP was constructed by transformation of CENPK113–3B with the plasmids pRUL1001 (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar) and pRUL1004. Escherichia coli(strain XL1-blue) and yeast were cultured as described before (13van Heusden G.P.H. Griffiths D.J. Ford J.C. Chin A.W.-T. Schrader P.A. Carr A.M. Steensma H.Y. Eur. J. Biochem. 1995; 229: 45-53Crossref PubMed Scopus (140) Google Scholar). The plasmids constructions are listed in TableI. The sequences of the oligonucleotides used are shown in Table II.Table IPlasmid constructionsPlasmidFeatures/constructionpGAD-C1, -C2, and -C3Two hybrid vectors for the expression of Ga14 activating domain fusion proteins (22James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar)pGBDK-C1, -C2, and -C3Two-hybrid vectors containing a kanamycin resistance marker. Constructed from pGBD-C1, -C2, and -C3 (22James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar), respectively, by replacing a AatII-BglI fragment containing the larger part of the ampicillin resistance marker by a 1.2-kbAatII-BglI fragment with the kanamycin resistance marker from plasmid pRUL531 using a linker consisting of oligonucleotides MH-1 and MH-2.pMVHisPlasmid allowing the galactose-inducible expression of His6-tagged proteins in yeast. A synthetic DNA fragment consisting of oligonucleotides MH-5 and MH-6 was ligated in the BamHI-HindIII sites of pYES2 (Invitrogen).pUG36[FIN1]Plasmid allowing the expression of a N-terminal GFP-Fin1 fusion protein under control of the MET25 promoter (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar).pRUL182Plasmid allowing the expression of a N-terminal His6 Fin1p fusion protein in yeast. The 0.9-kb BamHI-SalI fragment from pRUL557, containing FIN1, was cloned in theBglII-XhoI sites of pMVHis.pRUL348Library plasmid isolated during a two-hybrid screen withBMH2 as bait. Encodes a fusion between the GAL4activating domain and FIN1, lacking the first 30 bp.pRUL360pGAD plasmid with part of FIN1 isolated during a two-hybrid screen with FIN1.pRUL361pGAD plasmid with part of FIN1 isolated during a two-hybrid screen with FIN1.pRUL362pGAD plasmid with part ofFIN1 isolated during a two-hybrid screen withFIN1.pRUL366pGAD plasmid with part ofFIN1 constructed from pRUL348 by deleting a 1.3-kbXhoI-SalI fragment.pRUL367pGAD plasmid with part of FIN1 constructed from pRUL348 by deleting a 1.8-kb StuI-MscI fragment.pRUL368pGAD plasmid with part of FIN1 constructed by insertion of a synthetic DNA fragment consisting of oligonucleotides MH-9 and MH-10 in the EcoRI-PstI sites of pGAD-C1.pRUL369pGAD plasmid with part of FIN1. A synthetic DNA fragment consisting of oligonucleotides MH-9 and MH-10 was digested with TaqI and inserted in the EcoRI-ClaI sites of pGAD-C1.pRUL370pGAD plasmid with part of FIN1. Made by insertion of a linker consisting of oligonucleotides MH-11 and MH-12 in the EcoRI-PstI sites of pGAD-C1.pRUL371pGAD plasmid with part of FIN1. A 1.3-kbXhoI-BglII fragment of pRUL348 was replaced by a fragment generated by PCR with primers MH-13 and MH-14 on pRUL348, followed by digestion with XhoI and BglII.pRUL372pGBDK plasmid with part of FIN1. A 102-bpEcoRI-BglII fragment from pRUL369 was cloned in pGBDK-C1.pRUL526Plasmid allowing the expression of a N-terminal His6 Bmh1p fusion protein in E. coli. A 1-kb HinCII-SalI fragment with BMH1from plasmid pRS306[BMH1] (13van Heusden G.P.H. Griffiths D.J. Ford J.C. Chin A.W.-T. Schrader P.A. Carr A.M. Steensma H.Y. Eur. J. Biochem. 1995; 229: 45-53Crossref PubMed Scopus (140) Google Scholar) was ligated into theSmaI-SalI sites of pQE-30 (Qiagen).pRUL527Plasmid allowing the expression of a N-terminal His6-Bmh2p fusion protein in E. coli. TheBMH2-containing BamHI-SalI fragment from plasmid pRUL532 was cloned in the BamHI-SalI sites of pQE-32 (Qiagen).pRUL532Plasmid with BMH2open reading frame. BamHI and SalI restriction sites were introduced at the ends of the BMH2 open reading frame by PCR on plasmid pBlue[BMH2] (13van Heusden G.P.H. Griffiths D.J. Ford J.C. Chin A.W.-T. Schrader P.A. Carr A.M. Steensma H.Y. Eur. J. Biochem. 1995; 229: 45-53Crossref PubMed Scopus (140) Google Scholar) using primers MH-3 and MH-4. The resulting fragment was ligated into theBamHI-SalI sites of pUC18.pRUL551pGBDK plasmid with BMH2. The BMH2-containingBamHI-SalI fragment from pRUL532 was cloned in pGBDK-C2.pRUL557Plasmid with the FIN1 open reading frame. A BamHI site was introduced directly upstream of the FIN1 start codon and a SalI site 42 bp downstream of the stop codon by PCR on genomic DNA from S. cerevisiae strain S288c, using primers MH-7 and MH-8. This 0.9-kb PCR product was ligated into the BamHI-SalI sites of pUC18.pRUL558pGBDK plasmid with FIN1. The 0.9-kbBamHI-SalI fragment with FIN1 from pRUL557 was cloned in pGBDK-C2.pRUL1004Plasmid suitable for expression of YFP fusion proteins. The GFP-containingXbaI-BamHI fragment of plasmid pUG36 was replaced by a YFP-containing fragment. The latter fragment was made by PCR on plasmid pDH5 (D. Haley, Yeast Resource Center, University of Washington, Seattle, WA) as described previously (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar).pRUL1008Plasmid encoding YFP-Fin1p. The FIN1 open ready frame was cloned into pRUL1004 as described previously (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar).pRUL1072pGAD plasmid with part of FIN1 made by cloning a PCR fragment obtained by using the primers FIN1-K and FIN1-B into pGAD-C1 digested with ClaI and BglII.pRUL1070pGAD plasmid with part of FIN1 made by cloning a PCR fragment obtained by using the primers FIN1-G and FIN1-B into pGAD-C1 digested with ClaI andBglII. Open table in a new tab Table IIOligonucleotide sequencesMH-1GTCAAGCTTCGAGTTC2-aAll sequences are given 5′ to 3′.MH-2CTCGAAGCTTGACTTCMH-3CGGGATCCAAATGTCCCAAACTCGTMH-4GCGTCGACCCCCTTGTATTTCTCAGMH-5AGCTAAAATGAGAGGTTCTCATCACCATCACCATCACAGATCTCACGTGTTGGCCATCCCGGGMH-6GATCCCCGGGATGGCCAACACGTGAGATCTGTGATGGTGATGGTGATGAGAACCTCTCATTTTMH-7CGGGATCCATGAGCAATAAAAGCAACCGMH-8ACGCGTCGACCTTGCTTACTTCCTGTGTAAMH-9AATTCGTGGAACTTAAAGAAATAAAGGACTTGCTACTACAAATGTTGAGAAGACAGCGAGAGA TTGAATCAAGATTATCCAATATCGAACTTCAACTCACGGAAATACCGAAACATAAGTAACTGCAMH-10GTTACTTATGTTTCGGTATTTCCGTGAGTTGAAGTTCGATATTGGATAATCTTGATTCAATCTC TCGCTGTCTTCTCAACATTTGTAGTAGCAAGTCCTTTATTTCTTTAAGTTCCACGMH-11AATTCATGTTGAGAAGACAGCGAGAGATTGAATCAAGATTATCCAATATCGAACTTTAAGCTTGTGCAMH-12CAAGCTTAAAGTTCGATATTGGATAATCTTGATTCAATCTCTCGCTGTCTTCTCAACATGMH-13GGTGATGGTTCGTTAACGAGMH-14GAAGATCTAAGCTTAGGTTTCTTCAGTCACTATATTATFIN1-BGAAGATCTTTACTTATGTTTCGGTATTTCCFIN1-GCCATCGATGGAATGAAGCATAGTATAFIN1-KCCATCGATAAGACAGATGGAATGAAGCAT2-a All sequences are given 5′ to 3′. Open table in a new tab Nucleic acid manipulations were performed by standard techniques. The QIAprep mini spin kit (Qiagen) was used to isolate plasmid DNA from E. coli. The same kit was used to purify plasmid DNA from S. cerevisiae, after yeast cells were incubated with 1 mg/ml lyticase in buffer P1 (Qiagen) for 30 min. Subsequently, the isolated plasmid DNA was amplified inE. coli XLI-blue. Library Y2HL (22James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar), consisting of 0.5–3-kb fragments of genomic DNA fused to the GAL4ad, was a gift of Philip James. Strain HF7c was first transformed (23Gietz R.D. Schiestl R.H. Willems A.R. Woods R.A. Yeast. 1995; 11: 355-360Crossref PubMed Scopus (1712) Google Scholar) with pRUL551 and subsequently with 50 μg of each of the libraries Y2HL-C1, Y2HL-C2, and Y2HL-C3. Transformants with an activated HIS3reporter were selected on MY medium supplemented with adenine (20 μg/ml), lysine (30 μg/ml), and 20 mm 3-aminotriazole and subsequently assayed for β-galactosidase activity. Library plasmids were isolated from His+β-galactosidase+ transformants by amplification inE. coli after selection for ampicillin resistance. His6-tagged recombinant Bmh1p and Bmh2p were purified from E. coli XLI containing pRUL526 and pRUL527, respectively. Cells were grown to anA620 of 0.25 in TB supplemented with ampicillin. After addition of isopropyl-1-thio-β-d-galactopyranoside to a final concentration of 1 mm, the cells were grown for an additional 2.5 h to an A620 of 0.82. Two grams (wet weight) of cells were harvested by centrifugation, resuspended in 15 ml of 50 mm sodium phosphate buffer, pH 7.8, containing 300 mm NaCl, 1 mg/ml lysozyme, 10 μg/ml RNase A, and 10 μg/ml DNase I and incubated for 30 min at 0 °C. Then Triton X-100 was added to a final concentration of 0.1%, and the cells were incubated on ice for an additional 10 min. The lysate was cleared by two centrifugation steps at 13,000 × g for 10 min at 4 °C. One ml of nickel-nitrilotriacetic acid-agarose suspension (Qiagen) was added to the lysate, and after a 90-min incubation at 4 °C under continuous stirring the mixture was poured into a column. The column was washed with 100 ml of 50 mmphosphate buffer, pH 7.8, 300 mm NaCl, at 20 ml/h, followed by washing with 55 ml of Buffer B (50 mm phosphate buffer, pH 6.5, 300 mm NaCl, 10% glycerol). The His6-tagged proteins were eluted with a 40-ml 0–500 mm gradient of imidazole in Buffer B. Fractions containing the purified His6-Bmh1p or His6-Bmh2p were dialyzed against 50 mm phosphate buffer, pH 7.5, 50% glycerol, 300 mm NaCl. Protein concentrations were determined by Bradford analysis (24Bradford M.M. Anal. Biochem. 1976; 7: 72248-72254Google Scholar), and purity was estimated by SDS-PAGE followed by Coomassie and silver staining. The purified proteins were stored at −80 °C. S. cerevisiae strain GG3100 was grown in 500 ml of MY medium to anA620 of 0.8. Cells were harvested, washed, and cultured for 16 h in 500 ml of MYZ medium supplemented with 1% galactose to induce the expression of the recombinant protein. Cells were harvested by centrifugation, and the pellet (3.8 g) was vortexed with 4 g of glass beads (600 μm; Sigma) in 40 ml of lysis buffer (8 m urea, 50 mm Tris-HCl, pH 8, 500 mm NaCl, 2 mm 2-mercaptoethanol) containing 1 mm phenylmethylsulfonyl fluoride, 2 μg/ml pepstatin A, 2 μg/ml chymostatin, 1 mm ε-aminocaproic acid, 1 μg/ml E-64, 1 μg/ml leupeptin, 2 μg/ml aprotonin, and 1 mmNa3VO4. Cell debris was removed by centrifugation for 10 min at 13,000 × g, and the pH of the clear supernatant was adjusted to 8.0 with NaOH. The extract was incubated with 500 μl of nickel-nitrilotriacetic acid-agarose (Qiagen) for 16 h at room temperature. All washing and elution steps were performed in spin columns. The nickel-nitrilotriacetic acid-agarose was washed six times with 0.5 ml of lysis buffer, 10 times with 0.5 ml of lysis buffer containing 10 mm imidazole, and single times with 0.5 ml of lysis buffer containing 20, 30, and 40 mm imidazole. His6-Fin1p was eluted with 0.5 ml of lysis buffer containing 400 mm imidazole. The eluted protein was dialyzed against 50 mm phosphate buffer, pH 7.5, 500 mm NaCl, 50% glycerol at 4 °C. Alternatively, the protein was stored at −20 °C in the 8 murea-containing elution buffer. The protein concentration was determined with the Bradford assay, and purity was estimated by SDS-PAGE and Coomassie staining. Microtiter plates (Flow Laboratories) were coated overnight at 4 °C with varying amounts of purified His6-Fin1p or cytochrome c(Sigma) in 50 μl of PBS (50 mm phosphate buffer, pH 7.5, 150 mm NaCl). After washing with 200 μl of PBS, the wells were blocked with 200 μl of 1% blocking reagent (Roche Molecular Biochemicals) in PBS for 90 min at room temperature. When desired, bound Fin1p was dephosphorylated by incubation with 100 units of λ protein phosphatase (New England Biolabs) in 100 μl of λ protein phosphatase buffer for 60 min at 30 °C. Controls contained heat-inactivated protein phosphatase (10 min at 100 °C in the presence of 100 mm EDTA, pH 8.0). After five washes with 200 μl of PBST (PBS, 0.5% blocking reagent, 0.05% Tween 20), the wells were incubated with 50 μl of PBS containing the indicated amounts of purified His6-Bmh1p or His6-Bmh2p for 1 h at room temperature. The wells were washed five times with 200 μl of PBST, and 100 μl of anti-Bmh1 antiserum (13van Heusden G.P.H. Griffiths D.J. Ford J.C. Chin A.W.-T. Schrader P.A. Carr A.M. Steensma H.Y. Eur. J. Biochem. 1995; 229: 45-53Crossref PubMed Scopus (140) Google Scholar) (1:2000) in PBST was added followed by a 1-h incubation at room temperature. After washing with PBST, goat anti-rabbit IgG alkaline phosphatase conjugate (Promega) and nitrophenylphosphate were used to detect bound antiserum. Bound Fin1p was detected by a similar procedure except that anti-RGSH4 antibody (Qiagen) and anti-mouse/rabbit IgG-peroxidase (Roche Molecular Biochemicals) were used. Surface plasmon resonance analysis was done with a BIAcore-3000. 2000 resonance units of Fin1p were coupled to a CM5 sensor chip (BIAcore) by theN-hydroxysuccinimide/N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (NHS/EDC) method (25Johnsson B. Lofas S. Lindquist G. Anal. Biochem. 1991; 198: 268-277Crossref PubMed Scopus (1205) Google Scholar). Fin1p was dialyzed against 2.5 mm phosphate buffer, pH 7.5, 25 mmNaCl. The reference channel was made by activating and deactivating the surface without coupling a protein. Measurements were done in HBS buffer (BIAcore) at 25 °C at a flow rate of 30 μl/min. Each run consisted of an association step of 5 min using either His6-Bmh1p or His6-Bmh2p dissolved in HBS, followed by a dissociation step with HBS buffer. Between runs the chip was regenerated with 10 mm glycine, pH 10. Analysis of kinetic data was performed with the BIAevaluate 3.0 software (BIAcore) using the 1:1 (Langmuir) binding fitting model. Simulations with experimentally found kinetic parameters were done with BIAsim (BIAcore) and Clamp software (26Myszka D.G. Morton T.A. Trends Biochem. Sci. 1998; 23: 149-150Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar). Yeast cells were cultured in MY medium, and exponentially growing cells were analyzed using a Zeiss Axiovert 135 TV microscope (Zeiss, Jena, Germany), equipped with a 100-watt mercury lamp and a ×100/NA 1.30 Plan Neofluar phase objective. YFP was detected with a filter set consisting of a 500/20-nm bandpass filter, a 515-nm dichroic mirror, and a 535/30-bandpass emission filter. For FRET images the emission filter of the YFP filter set was used in combination with the CFP excitation filter and dichroic mirror. CFP was detected with a filter set consisting of a 436/20-nm bandpass excitation filter, a 455-nm dichroic mirror, and a 480/20-nm bandpass emission filter (all from Chroma Technologies). Images were acquired using a cooled CCD camera (Princeton Instruments), in the sequence YFP-, FRET-, and CFP-image (27Hailey D.W. Davis T.N. Muller E.G.D. Methods Enzymol. 2003; (in press)Google Scholar). Typical exposure times were 0.2 s. The set of three images was corrected for background and, when necessary, for pixel shift. Overlap from the CFP and YFP into the FRET image was corrected at each pixel. Images were further processed with in-house software. For calculation of relative FRET values the formula, FRETC = (IFRET − a *ICFP − b *IYFP)/ICFP, essentially as described (28Gordon G.W. Berry G. Liang X.H. Levine B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (729) Google Scholar), was used, where FRETC is the corrected FRET value, and IFRET,ICFP, and IYFP are intensities measured through FRET, CFP, and YFP filter sets, respectively. a and b are bleed-through percentages measured in cells only expressing CFP or YFP. Calculated FRETC values are displayed in pseudocolor. To identify binding partners of the yeast 14-3-3 protein Bmh2 we made use of the two-hybrid system. To facilitate analysis of positive clones, we constructed “bait” and “prey” vectors with a different selection marker. Therefore, we replaced the ampicillin resistance marker of bait vectors pGBD-C1, pGBD-C2, and pGBD-C3 (22James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar) by the kanamycin resistance marker. Then, we constructed plasmid pRUL551 encoding a fusion between Bmh2p and Gal4bd. This construct was able to complement a lethal bmh1 bmh2 disruption, indicating that the fusion protein has retained (at least) its essential 14-3-3 function (data not shown). pRUL551 alone already activated theHIS3 reporter of HF7c, but this could be suppressed by addition of 20 mm 3-aminotriazole. Of 22 × 106 transformants, five had both an active HIS3and β-galactosidase reporter. We isolated plasmids from the His+β-galactosidase+ transformants, and after transformation of E. coli, colonies were selected on medium supplemented with ampicillin. None of these E. coli colonies contained the bait plasmid pRUL551. In two other two-hybrid screens using bait plasmids with a kanamycin marker we did not isolate the bait plasmid either (data not shown), indicating the power of the use of different selection markers in the bait and prey plasmids. Cotransformation of HF7c with each of the five isolated library plasmids and pRUL551 resulted again in His+ transformants with β-galactosidase activity. Cotransformation of HF7c with the isolated library plasmids and the empty vector pGBDK-C1 yielded His− transformants without β-galactosidase activity. This demonstrates that the activation of the reporter genes of HF7c in these five positives is dependent on the presence of both pRUL551 and the library plasmid. Sequencing of the yeast DNA insert of one of the isolated plasmids revealed an in-frame fusion between theGAL4ad and the 3′-end of GCR2, encoding amino acids 223 to 534 of the Gcr2 protein. GCR2 encodes a transcription factor required for full activation of glycolytic genes. Three other plasmids contain SPT21. However, forSPT21 there is not an in-frame fusion with theGAL4 activating domain. The last plasmid contains an in-frame fusion between the GAL4ad and YDR130c, lacking the first 30 base pairs. As the protein encoded by this open reading frame forms cell cycle-specific filaments, we named this open reading frame FIN1 (filaments in between nuclei 1) (1van Hemert M.J. Lamers G.E.M. Klein D.C.G. Oosterkamp T.H. Steensma H.Y. van Heusden G.P.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5390-5393Crossref PubMed Scopus (28) Google Scholar). The reverse combination,BMH2 fused to the GAL4ad and FIN1fused to GAL4bd, also reacts positively in the two-hybrid system (data not shown). We studied the interaction between Fin1p and the yeast 14-3-3 proteins in more detail. To confirm the interaction between the 14-3-3 proteins and Fin1p found in the two-hybrid system, we used a sandwich ELISA with purified proteins. To this end we isolated recombinant His6-tagged Bmh1 and Bmh2 proteins from E. coliand His6-tagged Fin1p from yeast (see “Materials and Methods”). Various amounts of purified Fin1p (0–200 ng) were immobilized to the wells of a microtiter plate. After