Cross-linking in the Living Cell Locates the Site of Action of Oxazolidinone Antibiotics
2003; Elsevier BV; Volume: 278; Issue: 24 Linguagem: Inglês
10.1074/jbc.m302109200
ISSN1083-351X
AutoresJerry R. Colca, William Graham McDonald, Daniel J. Waldon, Lisa M. Thomasco, Robert C. Gadwood, Eric T. Lund, Gregory S. Cavey, W. Rodney Mathews, Lonnie D. Adams, Eric T. Cecil, James D. Pearson, Jeffrey H. Bock, John E. Mott, Dean L. Shinabarger, Liqun Xiong, Alexander S. Mankin,
Tópico(s)Bacterial Genetics and Biotechnology
ResumoOxazolidinone antibiotics, an important new class of synthetic antibacterials, inhibit protein synthesis by interfering with ribosomal function. The exact site and mechanism of oxazolidinone action has not been elucidated. Although genetic data pointed to the ribosomal peptidyltransferase as the primary site of drug action, some biochemical studies conducted in vitro suggested interaction with different regions of the ribosome. These inconsistent observations obtained in vivo and in vitro have complicated the understanding of oxazolidinone action. To localize the site of oxazolidinone action in the living cell, we have cross-linked a photoactive drug analog to its target in intact, actively growing Staphylococcus aureus. The oxazolidinone cross-linked specifically to 23 S rRNA, tRNA, and two polypeptides. The site of cross-linking to 23 S rRNA was mapped to the universally conserved A-2602. Polypeptides cross-linked were the ribosomal protein L27, whose N terminus may reach the peptidyltransferase center, and LepA, a protein homologous to translation factors. Only ribosome-associated LepA, but not free protein, was cross-linked, indicating that LepA was cross-linked by the ribosome-bound antibiotic. The evidence suggests that a specific oxazolidinone binding site is formed in the translating ribosome in the immediate vicinity of the peptidyltransferase center. Oxazolidinone antibiotics, an important new class of synthetic antibacterials, inhibit protein synthesis by interfering with ribosomal function. The exact site and mechanism of oxazolidinone action has not been elucidated. Although genetic data pointed to the ribosomal peptidyltransferase as the primary site of drug action, some biochemical studies conducted in vitro suggested interaction with different regions of the ribosome. These inconsistent observations obtained in vivo and in vitro have complicated the understanding of oxazolidinone action. To localize the site of oxazolidinone action in the living cell, we have cross-linked a photoactive drug analog to its target in intact, actively growing Staphylococcus aureus. The oxazolidinone cross-linked specifically to 23 S rRNA, tRNA, and two polypeptides. The site of cross-linking to 23 S rRNA was mapped to the universally conserved A-2602. Polypeptides cross-linked were the ribosomal protein L27, whose N terminus may reach the peptidyltransferase center, and LepA, a protein homologous to translation factors. Only ribosome-associated LepA, but not free protein, was cross-linked, indicating that LepA was cross-linked by the ribosome-bound antibiotic. The evidence suggests that a specific oxazolidinone binding site is formed in the translating ribosome in the immediate vicinity of the peptidyltransferase center. Antibiotics inhibit cell growth by binding to essential molecular components and interfering with their activity. Identification of the specific drug target is a critical starting point for understanding mechanism of action, possible resistance mechanisms, and for further rational drug refinement. Although one effective way to identify the target of antibiotics is by mapping drug resistance mutations, the majority of studies aimed at understanding the site and the mode of the drug action are generally carried out in vitro using biochemical techniques. Such studies, conducted with subcellular fractions, have on numerous occasions provided critical insights into understanding the mechanism of antibiotic activity. These biochemical approaches are based on a common assumption that interaction of the drug with its target in vitro closely resembles the one that takes place in the living cell. This assumption might not be valid for some antibiotics that interact with such a complex and dynamic macromolecular structure as the ribosome.A great variety of antibiotics inhibit bacterial growth by binding to the ribosome and interfering with its functions in protein synthesis. The ribosome, whose size exceeds that of an average antibiotic by four orders of magnitude, presents multiple possibilities for the antibiotic binding (1Brodersen D.E. Clemons Jr., W.M. Carter A.P. Morgan-Warren R.J. Wimberly B.T. Ramakrishnan V. Cell. 2000; 103: 1143-1154Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar, 2Schlunzen F. Zarivach R. Harms J. Bashan A. Tocilj A. Albrecht R. Yonath A. Franceschi F. Nature. 2001; 413: 814-821Crossref PubMed Scopus (865) Google Scholar). Furthermore, in the course of translation, the ribosome cycles through various conformational states and interacts with a number of ligands and effectors, including tRNAs and translation factors, which affect the spatial structure of the ribosome (3Ramakrishnan V. Cell. 2002; 108: 557-572Abstract Full Text Full Text PDF PubMed Scopus (600) Google Scholar). It is conceivable that the affinity of antibiotics for specific sites in the ribosome might depend on the conformational state of the particle.Oxazolidinones are the first new class of antibiotics introduced into medical practice in 25 years. This class of protein synthesis inhibitors is extremely effective against Gram-positive bacteria (4Ford C.W. Hamel J.C. Wilson D.M. Moerman J.K. Stapert D. Yancey Jr., R.J. Hutchinson D.K. Barbachyn M.R. Brickner S.J. Antimicrob. Agents Chemother. 1996; 40: 1508-1513Crossref PubMed Google Scholar). Several studies suggest that the ribosome is the primary target of action of these compounds (5Eustice D.C. Feldman P.A. Slee A.M. Biochem. Biophys. Res. Commun. 1988; 150: 965-971Crossref PubMed Scopus (57) Google Scholar, 6Eustice D.C. Feldman P.A. Zajac I. Slee A.M. Antimicrob. Agents Chemother. 1988; 32: 1218-1222Crossref PubMed Scopus (118) Google Scholar, 7Shinabarger D.L. Marotti K.R. Murray R.W. Lin A.H. Melchior E.P. Swaney S.M. Dunyak D.S. Demyan W.F. Buysse J.M. Antimicrob. Agents Chemother. 1997; 41: 2132-2136Crossref PubMed Google Scholar, 8Swaney S.M. Aoki H. Ganoza M.C. Shinabarger D.L. Antimicrob. Agents Chemother. 1998; 42: 3251-3255Crossref PubMed Google Scholar, 9Patel U. Yan Y.P. Hobbs Jr., F.W. Kaczmarczyk J. Slee A.M. Pompliano D.L. Kurilla M.G. Bobkova E.V. J. Biol. Chem. 2001; 276: 37199-37205Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar); however, interaction of oxazolidinones with the ribosome clearly differs from other antibiotics because these drugs are active against isolates that have developed resistance to other ribosomal antibiotics (10Stevens D.L. Herr D Lampiris H Hunt J.L. Batts D.H. Hafkin B. Clin. Infect. Dis. 2002; 34: 1481-1490Crossref PubMed Scopus (484) Google Scholar). Despite intense interest, the exact site of oxazolidinone action remains to be elucidated. Although the location of resistance mutations point to the peptidyltransferase center of the large ribosomal subunit as the possible drug target (11Swaney S.M. Shinabarger D.L. Schaadt R.D. Bock J.H. Slightom J.L. Zurenko G.E. Abstracts of the 38th Interscience Conference on Antimicrobial Agents and Chemotherapy. 1998; (San Diego, CA, September 24–27, 1998, Abst. C-104, American Society for Microbiology, Washington, D. C.)Google Scholar, 12Kloss P. Xiong L. Shinabarger D.L. Mankin A.S. J. Mol. Biol. 1999; 294: 93-101Crossref PubMed Scopus (191) Google Scholar, 13Xiong L. Kloss P. Douthwaite S. Andersen N.M. Swaney S. Shinabarger D.L. Mankin A.S. J. Bacteriol. 2000; 182: 5325-5331Crossref PubMed Scopus (141) Google Scholar, 14Prystowsky J. Siddiqui F. Chosay J. Shinabarger D.L. Millichap J. Peterson L.R. Noskin G.A. Antimicrob. Agents Chemother. 2001; 45: 2154-2156Crossref PubMed Scopus (262) Google Scholar), cross-linking and footprinting of ribosomes in vitro had suggested interaction of oxazolidinones with different regions of the ribosome including the nucleotides U-2113, A-2114, U-2118, A-2119, and C-2153 in 23 S rRNA located in the vicinity of the ribosomal E-site (15Matassova N.B. Rodnina M.V. Endermann R. Kroll H.P. Pleiss U. Wild H. Wintermeyer W. RNA (N. Y.). 1999; 5: 939-946Crossref PubMed Scopus (73) Google Scholar) and at a considerable distance from the peptidyltransferase. In addition, these studies conducted with isolated ribosomes had pointed to possible interactions of oxazolidinones with A-864 in the 16 S rRNA of the small ribosomal subunit. Lack of a clear understanding of the oxazolidinone binding site on the ribosome and reliance on indirect approaches led to the proposal of diverse models of oxazolidinone action (7Shinabarger D.L. Marotti K.R. Murray R.W. Lin A.H. Melchior E.P. Swaney S.M. Dunyak D.S. Demyan W.F. Buysse J.M. Antimicrob. Agents Chemother. 1997; 41: 2132-2136Crossref PubMed Google Scholar, 8Swaney S.M. Aoki H. Ganoza M.C. Shinabarger D.L. Antimicrob. Agents Chemother. 1998; 42: 3251-3255Crossref PubMed Google Scholar, 9Patel U. Yan Y.P. Hobbs Jr., F.W. Kaczmarczyk J. Slee A.M. Pompliano D.L. Kurilla M.G. Bobkova E.V. J. Biol. Chem. 2001; 276: 37199-37205Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 12Kloss P. Xiong L. Shinabarger D.L. Mankin A.S. J. Mol. Biol. 1999; 294: 93-101Crossref PubMed Scopus (191) Google Scholar, 15Matassova N.B. Rodnina M.V. Endermann R. Kroll H.P. Pleiss U. Wild H. Wintermeyer W. RNA (N. Y.). 1999; 5: 939-946Crossref PubMed Scopus (73) Google Scholar, 16Aoki H. Ke L. Poppe S.M. Poel T.J. Weaver E.A. Gadwood R.C. Thomas R.C. Shinabarger D.L. Ganoza M.C. Antimicrob. Agents Chemother. 2002; 46: 1080-1085Crossref PubMed Scopus (117) Google Scholar, 17Shinabarger D.L. Exp. Opin. Investig. Drugs. 1999; 8: 1195-1202Crossref PubMed Scopus (187) Google Scholar, 18Burghardt H. Schimz K.L. Muller M. FEBS Lett. 1998; 425: 40-44Crossref PubMed Scopus (34) Google Scholar, 19Thompson J. O'Connor M. Mills J.A. Dahlberg A.E. J. Mol. Biol. 2002; 322: 273-279Crossref PubMed Scopus (80) Google Scholar).One of the major limitations in studies of oxazolidinone action has been the low binding affinity of these compounds to isolated 70 S ribosomes or 50 S ribosomal subunits, e.g. 200 μm for eperezolid, one of the reference oxazolidinones (20Zhou C.C. Swaney S.M. Shinabarger D.L. Stockman B.J. Antimicrob. Agents Chemother. 2002; 46: 625-629Crossref PubMed Scopus (51) Google Scholar). The low affinity binding to isolated ribosomes or ribosomal subunits limits the utility of standard footprinting techniques that are routinely used to identify potential direct interactions with rRNA (21Moazed D. Noller H.F. Biochimie (Paris). 1987; 69: 879-884Crossref PubMed Scopus (285) Google Scholar, 22Moazed D. Noller H.F. Nature. 1987; 327: 389-394Crossref PubMed Scopus (953) Google Scholar). In contrast to the low affinity of the drug for the "static" isolated ribosome, these drugs are potent inhibitors of cell-free translation, where eperezolid exhibits an IC50 of 2.5 μm in an Escherichia coli system (7Shinabarger D.L. Marotti K.R. Murray R.W. Lin A.H. Melchior E.P. Swaney S.M. Dunyak D.S. Demyan W.F. Buysse J.M. Antimicrob. Agents Chemother. 1997; 41: 2132-2136Crossref PubMed Google Scholar, 23Brickner S.J. Hutchinson D.K. Barbachyn M.R. Manninen P.R. Ulanowicz D.A. Garmon S.A. Grega K.C. Hendges S.K. Toops D.S. Ford C.W. Zurenko G.E. J. Med. Chem. 1996; 39: 673-679Crossref PubMed Scopus (566) Google Scholar). Thus, the site of drug binding in purified non-translating ribosomes may not accurately represent the site responsible for the antibiotic activity. It is possible that the relevant site may transiently appear only in the dynamic structure of the ribosome engaged in protein synthesis.To bridge the information gained from biochemical experiments in vitro and genetic studies in vivo and to identify the site of oxazolidinone action in intact bacteria, we have used photo-induced cross-linking, a technique that is commonly used in vitro. However, in contrast to the previous studies, we have cross-linked a radioactive probe to its putative target in intact, actively growing bacteria. We reasoned that this approach applied to living cells would localize drug binding in vivo in the site relevant for its antibacterial activity. Moreover, we anticipated that this approach would succeed even if the relevant binding site were formed only transiently in the translating ribosome.EXPERIMENTAL PROCEDURESReagents and Materials—All of the compounds used in this study were synthesized at Pharmacia Corp. by previously published methods (24Barbachyn M.R. Brickner S.J. Gadwood R.C. Garmon S.A. Grega K.C. Hutchinson D.K. Munesada K. Reischer R.J. Taniguchi M. Thomasco L.M. Toops D.S. Yamada H. Ford C.W. Zurenko G.E. Adv. Exp. Med. Biol. 1998; 456: 219-238Crossref PubMed Scopus (22) Google Scholar). Carrier-free 125I-labeled PNU-259621 (abbreviated 125I-XL) 1The abbreviations used are: 125I-XL, 125I-labeled PNU-259621; nanoLC-MS/MS, nano liquid chromatography tandem mass spectrometry (MS). and the corresponding unlabeled compound were prepared using chloramine T and sodium iodide (26Greenwood F.C. Hunter W.M. Glover J.S. Biochem. J. 1963; 89: 114-163Crossref PubMed Scopus (6717) Google Scholar). Lysostaphin was from Sigma.Bacterial Strains—The linezolid-sensitive clinical isolate Staphylococcus aureus ATCC 29213 was used for the cross-linking experiments. S. aureus RN4220 NCTC8325-4 r–, m+ (restriction, minus; modification, plus; Ref. 27Kreiswirth B.N. Lofdahl S. Betley M.J. O'Reilly M. Schlievert P.M. Bergdoll M.S. Novick R.P. Nature. 1983; 305: 709-712Crossref PubMed Scopus (1001) Google Scholar) was used for the generation of insertional mutants.Cross-linking Experiments—S. aureus cultures were grown overnight with shaking in Mueller Hinton broth (Difco) at 37 °C. Cells were diluted 1:100 and grown for 3–4 h at 37 °C. When the optical density reached an A600 of ∼0.6, 1–1.4 ml of the resulting culture were centrifuged at 2000 × g for 2 min. The cells were resuspended in 170 μl of fresh Mueller Hinton medium containing either 20 μl of 2% Me2SO or non-radioactive competitor antibiotics in the same volume of Me2SO followed by 10 μl of the radioactive photoactive oxazolidinone 125I-XL (∼2–10 μCi/sample representing 1–2 μm final concentration). After a 30-min incubation at 37 °C in the dark, the suspension was exposed in open tubes to UV light using a Stratalinker 1800 (Stratagene) set to an energy exposure of 180,000 μJ (2.1 min, 254 nm). The cells were sedimented in microcentrifuge tubes, washed with Dulbecco's phosphate-buffered saline (Invitrogen), and resuspended in 180 μl of lysis buffer containing 10 mm Tris-HCl (pH 7.4), 30 mm NH4Cl, 30 mm MgCl2, and 5 μg/ml lysostaphin. After a 15-min incubation at 37 °C, the debris of the lysed cells was sedimented at 18,000 × g for 15 min at 4 °C. The resulting supernatant was used for extraction of total RNA or for the isolation of ribosomes after ultracentrifugation at 450,000 × g for 30 min in a Beckman TLA-100 ultracentrifuge (4 °C, TLA100 rotor).Isolation of Total RNA—An aliquot (180 μl) of cell lysate supernatant was diluted with buffer containing 10 mm Tris-HCl (pH 7.6), 6 mm EDTA, and 0.5% SDS to a volume of 250 μl, and RNA was extracted with phenol. The extracted RNA was precipitated by the addition of 400 μl of ethanol, and the pellet was washed with 70% ethanol, dried in vacuo, and either used directly for electrophoresis or subjected to primer extension or RNase H analysis. Electrophoresis of RNA was carried out either on 1% agarose gels or on 10% denaturing polyacrylamide gels. Gels were stained with ethidium bromide, photographed, dried, and exposed to BioMax film (Eastman Kodak Co.).Identification of 23 S rRNA Bases Cross-linked to Oxazolidinones— For the preliminary mapping of 23 S rRNA cross-links, total RNA prepared from the cross-linked sample was subjected to RNase H analysis (28Donis-Keller H. Nucleic Acids Res. 1979; 7: 179-192Crossref PubMed Scopus (295) Google Scholar, 29Mankin A.S. Skripkin E.A. Chichkova N.V. Kopylov A.M. Bogdanov A.A. FEBS Lett. 1981; 131: 253-256Crossref PubMed Scopus (25) Google Scholar) essentially as described by Dontsova et al. (30Dontsova O. Kopylov A. Brimacombe R. EMBO J. 1991; 10: 2613-2620Crossref PubMed Scopus (91) Google Scholar). In brief, 4 μg of total RNA was combined in 20 μl of water with 6 pmol of individual deoxyribooligonucleotides or pairs of deoxyribooligonucleotides complementary to sites in domains V and VI of S. aureus 23 S rRNA. The solution was incubated for 30 s at 90 °C and then cooled over 10 min to 50 °C. A 2.5-μl aliquot of 10× reaction buffer (150 mm HEPES-KOH (pH 7.8), 500 mm NH4Cl, 10 mm MgCl2, 1 mm dithiothreitol) was added followed by the addition of 1 μl of RNase H (Seikagaku America) in 2.5 μl of the 1× reaction buffer. The reactions were incubated for 30 min at 55 °C, and RNA was precipitated by the addition of 100 μl of 0.3 m sodium acetate (pH 5.5) and 300 μl of ethanol. RNA was recovered by centrifuging for 10 min at 21,000 × g at 4 °C, resuspending in 7 μl of formamide loading dyes, heating for 30 s at 90 °C, and loading the sample onto a 6% denaturing polyacrylamide gel. The gels (20 cm × 20 cm × 1 mm) were electrophoresed at 20 W for 1.5 h, stained with ethidium bromide, photographed, dried, and exposed to a Phosphor-Imager screen (Molecular Dynamics).For precise mapping of the cross-linked nucleotides, the amount of 127I-XL (in this case non-radioactive) added to S. aureus cells was increased to 2 mm. Oligonucleotide primers were 5′-terminally labeled, annealed to RNA, and extended with reverse transcriptase as described (31Merryman C. Noller H.F. Smith C.W.J. RNA: Protein Interactions: A Practical Approach. Oxford University Press, Oxford1998: 237-253Google Scholar).The following oligonucleotides were used for RNase H mapping and primer extension (numbers in parentheses correspond to the 23 S rRNA complementary sequence, E. coli numbering): SaL 2550, GCCGACATCGAGGTGCC (2494–2510); SaL 2720, GTCCATCCCGGTCCTCTCGTAC (2655–2676); SaL 2230, TAGTATCCCACCAGCGTCTC (2157–2176); SaL2340, ACCTTTGAGCGCCTCCG (2275–2291); EcL 2563, TCGCGTACCACTTTA (2563–2577).Isolation and Identification of Cross-linked Proteins—Ribosomal pellets were resuspended in 70 μl of ribosome buffer (10 mm Tris-HCl, 30 mm NH4Cl, 30 mm MgCl2 (pH 7.4)). Two volumes of glacial acetic acid were added, and the tubes were mixed for 15 min at 4 °C before the precipitated RNA was removed by centrifugation at 18,000 × g for 15 min. The resulting supernatant was brought to 80% acetone and stored overnight at–20 °C. The acetone pellet was recovered by centrifugation at 18,000 × g, washed with cold acetone to remove residual acetic acid, and lyophilized (32Barritault D. Expert-Bezancon A. Guerin M.F. Hayes D. Eur. J. Biochem. 1976; 63: 131-135Crossref PubMed Scopus (144) Google Scholar).Two-dimensional gel electrophoresis was carried out as described by Adams (33Adams L. Ausubel F. Brent R. Kingston R. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1995Google Scholar). Lyophilized protein pellets were resuspended in 35 μl of buffer containing 9 m urea, 4% Nonidet P-40, 1% dithiothreitol, and 2% pH 3.5–10 ampholytes. Samples were applied to isoelectric focusing tube gels and focused for 23,000 volt-hours. Second-dimension gels were 10–20% non-linear gradients run in Tris-glycine-SDS buffer (Bio-Rad). Gels were silver-stained (34Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7771) Google Scholar), dried, and exposed to Kodak Biomax film.High performance liquid chromatography separation of the extracted ribosomal proteins was carried out on a Vydac 218TPT C18 column according to a modified procedure of Cooperman et al. (35Cooperman B.S. Weitzmann C.J. Buck M.A. Methods Enzymol. 1988; 164: 523-532Crossref PubMed Scopus (12) Google Scholar). The elution (1 ml/min) started with 75% A (water, 0.1% trifluoroacetic acid, v/v), 25% B (acetonitrile, 0.1% trifluoroacetic acid, v/v). Buffer B proportion was increased from 25 to 80% over a 100-min linear gradient.Protein Identification—The specifically cross-linked proteins were excised from the gels, reduced, alkylated, and digested in situ with modified porcine trypsin (Promega) using a DigestPro robot (LC Packings). Nano liquid chromatography (nanoLC) tandem mass spectrometry analysis (nanoLC-MS/MS) was performed on a Micromass Q-Tof instrument equipped with a Z-spray ion source. Nanospray MS/MS data was used to identify proteins by comparing the experimental data with predicted data derived from protein and DNA databases. Tandem MS data was searched against the NCBInr and HGS protein databases using MASCOT (Matrix Science) programs maintained on an in-house server.Targeted Disruption of LepA Gene—The LepA knock-out strain of S. aureus (RN4220) was constructed by insertional mutagenesis using an E. coli vector construct that is incapable of replication in S. aureus. A 310-bp region at the 5′ end of the S. aureus LepA gene (yqeQ) was PCR-amplified from the genomic DNA using a pair of primers, CTCGATTATAGCACATATTGAC and TTTGTGCTTCGATACCTTGAG, and cloned into the pCR2.1 vector (Invitrogen) to create pCR-yqeQ-N310 plasmid. An ermB gene that confers erythromycin resistance in S. aureus was cloned into the NotI site of the pCR-yqeQ-N310 plasmid, and the resulting construct was electroporated into S. aureus (36Schenk S. Laddaga R.A. FEMS Microbiol. Lett. 1992; 94: 133-138Crossref Google Scholar). Genomic DNA was isolated from several erythromycin-resistant colonies, and yqeQ gene disruption was confirmed by PCR and Southern blot analysis. The lack of LepA expression in the constructed strain was confirmed by Western blot analysis using LepA-specific rabbit antibodies (Covance).RESULTSIn Vivo Cross-linking of Oxazolidinones to Ribosomal RNA— The structures of the oxazolidinones used in this study are shown in Fig. 1. In addition to the photosensitive probe (125I-XL), the structures are shown for the compounds used for competition, eperezolid (PNU-100592(S) and its inactive enantiomer, PNU-107112(R) as well as for linezolid (Zyvox®, PNU-100766), the first clinically approved oxazolidinone. With the exception of PNU-107112(R), all compounds were active against S. aureus (MIC values of 0.7–10 μm). All of the compounds contained the central oxazolidinone ring, the main pharmacophore of this group of drugs (24Barbachyn M.R. Brickner S.J. Gadwood R.C. Garmon S.A. Grega K.C. Hutchinson D.K. Munesada K. Reischer R.J. Taniguchi M. Thomasco L.M. Toops D.S. Yamada H. Ford C.W. Zurenko G.E. Adv. Exp. Med. Biol. 1998; 456: 219-238Crossref PubMed Scopus (22) Google Scholar). 125I-XL, the compound used in cross-linking experiments, contained the photoactive azido group.For cross-linking in vivo, exponentially growing S. aureus cells were incubated with the 125I-XL photoprobe with or without competitor compounds for 30 min (optimal under these conditions) to allow drug penetration into the cell and binding to the target. To determine the specificity of the interaction, parallel incubations contained a 20-fold excess of non-photoactive competitors, active PNU-100592(S), or the control, inactive enantiomer PNU-107112(R) (Fig. 1). After these incubations, 125I-XL was cross-linked to its target by brief exposure to UV light (see "Experimental Procedures").Extraction and electrophoresis of RNA from S. aureus cells that had been incubated with 125I-XL demonstrated that 23 S rRNA and tRNA were labeled selectively by the photoprobe (Fig. 2). Electrophoresis of the RNA on 1% agarose gels (Fig. 2A) clearly resolved 23 S, 16 S, and 5 S RNA. The 125I probe was cross-linked only to 23 S rRNA; no radioactive drug was seen associated with 16 S rRNA even upon prolonged exposure of the dried gels to film. Cross-linking of 125I-XL to 23 S rRNA likely occurred from the site of its inhibitory action because the yield of the cross-link was significantly reduced in the presence of an active drug PNU-100592(S) but not by its inactive enantiomer PNU-107112(R). (Fig. 2, lanes S and R). Separation of the extracted RNA by polyacrylamide electrophoresis (Fig. 2B) demonstrated that although no drug cross-linked to 5S rRNA, some amount of 125I-XL (much smaller than seen associated with 23 S rRNA) also cross-linked to RNA molecules co-migrating with tRNA. Specific cross-linking of biologically active 125I-XL to 23 S rRNA indicated that in their binding site in the large ribosomal subunit oxazolidinones form close contacts with certain residues of 23 S rRNA and possibly ribosome-bound tRNA.Fig. 2Analysis of RNA isolated from intact S. aureus cross-linked by [125]I-XL by agarose gel electrophoresis (A) or polyacrylamide gel electrophoresis (B). Exponentially growing S. aureus cells were cross-linked with 2 μm [125]I-XL alone (lane C) or in the presence of a 20-fold excess of biologically active non-cross-linkable competitor (lane S) or its inactive enantiomer (lane R). Panel A shows a representative ethidium bromide-stained 1% agarose gel (left) and its autoradiogram (right) of extracted cellular RNA. Panel B is a similar representation of the separation on denaturing 10% polyacrylamide gels.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To map the approximate site(s) of 125I-XL cross-linking to 23 S rRNA, RNase H mapping was utilized (28Donis-Keller H. Nucleic Acids Res. 1979; 7: 179-192Crossref PubMed Scopus (295) Google Scholar, 29Mankin A.S. Skripkin E.A. Chichkova N.V. Kopylov A.M. Bogdanov A.A. FEBS Lett. 1981; 131: 253-256Crossref PubMed Scopus (25) Google Scholar, 37Rinke-Appel J. Junke N. Stade K. Brimacombe R. EMBO J. 1991; 10: 2195-2202Crossref PubMed Scopus (88) Google Scholar). Total RNA prepared from cross-linked S. aureus cells was incubated with oligodeoxyribonucleotides complementary to specific regions of 23 S rRNA (Fig. 3A). The RNA in the formed DNA/RNA heteroduplex was cleaved with RNase H, and the resulting fragments were resolved by denaturing gel electrophoresis and identified by autoradiography. As shown in Fig. 3B, when cross-linked 23 S rRNA was cleaved with RNase H in the presence of oligonucleotide SaL 2550, complementary to the rRNA segment 2494–2510 (E. coli numbering), an ∼400-nucleotide-long radiolabeled 23 S rRNA fragment representing the 3′ end of 23 S rRNA was released. No label was found associated with the longer 5′ segment. Digestion of 23 S rRNA with RNase H in the presence of two oligonucleotides, SaL 2550 and SaL 2720 (23 S rRNA positions 2655–2676), released a single radiolabeled rRNA fragment ∼170 nucleotides long corresponding to the rRNA segment between the two oligonucleotides. Thus, 125I-XL was cross-linked exclusively to the 2494–2676 segment of 23 S rRNA.Fig. 3Identification of the site of in vivo 23 S RNA cross-linking by [125I]-XL.A, the relative location of the primers (thin bars) complementary to 23 S rRNA (thick bar) used in RNase H mapping. The approximate sizes of the RNA fragments produced by RNase H cleavage are indicated. B, the autoradiogram of the denaturing 6% polyacrylamide gel resolving the products of 23 S rRNA hydrolysis by RNase H. The location of 16 S and 23 S rRNA as observed in ethidium bromide-stained gels are shown as well as the sizes of the 23 S RNA fragments released after RNase H treatment, as determined by comparison with the ethidium bromide-stained size markers. nt, nucleotides. C, the results of primer extension mapping of the site of cross-link. C, U, A, and G were sequencing lanes. Lane K, control RNA prepared from untreated cells. Lane UV, RNA prepared from cells irradiated with UV light in the absence of antibiotic. Lane X, RNA extracted from cells that were incubated with the photoactive oxazolidinone 127I-XL before UV irradiation. Lane S, RNA from cells incubated with 127I-XL in the presence of PNU-100592(S), the oxazolidinone competitor, before UV irradiation. An arrow indicates the nucleotide residue corresponding to the cross-linked position.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The precise location of the cross-link was mapped by primer extension. A single additional band at position 2603 was seen when the rRNA sample prepared from cells incubated with non-radioactive 127I-XL was used as a template (Fig. 3C), corresponding to the drug cross-link at position A-2602. As expected from the results with the radioactive probe, the intensity of this band decreased when the cross-linking was prevented by incubation in the presence of a 20-fold excess of PNU-100592(S) in vivo. Thus, the single rRNA base cross-linked by the photoprobe in actively growing bacteria was A-2602.A-2602 is one of the central nucleotides in the ribosomal peptidyltransferase center (38Nissen P. Hansen J. Ban N. Moore P.B. Steitz T.A. Science. 2000; 289: 920-930Crossref PubMed Scopus (1736) Google Scholar). Thus, cross-linking of the oxazolidinone photoprobe to A-2602 places the site of the drug action in the peptidyltransferase center.Oxazolidinone Cross-linking to Ribosome-associated Proteins in Vivo—To investigate possible in vivo cross-linking of 125I-XL to ribosome-associated proteins, ribosomes were pelleted from the lysates of S. aureus cells cross-linked with the drug, and proteins were fractionated by SDS electrophoresis. SDS-PAGE analysis of the proteins in the ribosome pellet demonstrated two radiolabeled protein bands of ∼64 and 11 kDa that were selectively cross-linked (Fig. 4A). The 125I-XL cross-linking to these the proteins showed the same specificity as was seen for the 23 S RNA in these samples; cross-linking was reduced in the presence of the biologically active competitor eperezolid, PNU-100592(S), but not by its inacti
Referência(s)