Produção Nacional
Revisado por pares
Linker for Activation of T-cell Family Member2 (LAT2) a Lipid Raft Adaptor Protein for AKT Signaling, Is an Early Mediator of Alkylphospholipid Anti-leukemic Activity
2012; Elsevier BV; Volume: 11; Issue: 12 Linguagem: Inglês
10.1074/mcp.m112.019661
ISSN1535-9484
AutoresCarolina Hassibe Thomé, Guilherme Augusto dos Santos, Germano Aguiar Ferreira, Priscila Santos Scheucher, Clarice Izumi, Andréia Machado Leopoldino, Ana Maria Simão, Pietro Ciancaglini, Kléber T. de Oliveira, Alice Chin, Samir Hanash, Roberto Passetto Falcão, Eduardo Magalhães Rego, Lewis Joel Greene, Vítor M. Faça,
Tópico(s)Protein Degradation and Inhibitors
ResumoLipid rafts are highly ordered membrane domains rich in cholesterol and sphingolipids that provide a scaffold for signal transduction proteins; altered raft structure has also been implicated in cancer progression. We have shown that 25 μm 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate (ODPC), an alkylphospholipid, targets high cholesterol domains in model membranes and induces apoptosis in leukemia cells but spares normal hematopoietic and epithelial cells under the same conditions. We performed a quantitative (SILAC) proteomic screening of ODPC targets in a lipid-raft-enriched fraction of leukemic cells to identify early events prior to the initiation of apoptosis. Six proteins, three with demonstrated palmitoylation sites, were reduced in abundance. One, the linker for activation of T-cell family member 2 (LAT2), is an adaptor protein associated with lipid rafts in its palmitoylated form and is specifically expressed in B lymphocytes and myeloid cells. Interestingly, LAT2 is not expressed in K562, a cell line more resistant to ODPC-induced apoptosis. There was an early loss of LAT2 in the lipid-raft-enriched fraction of NB4 cells within 3 h following treatment with 25 μm ODPC. Subsequent degradation of LAT2 by proteasomes was observed. Twenty-five μm ODPC inhibited AKT activation via myeloid growth factors, and LAT2 knockdown in NB4 cells by shRNA reproduced this effect. LAT2 knockdown in NB4 cells also decreased cell proliferation and increased cell sensitivity to ODPC (7.5×), perifosine (3×), and arsenic trioxide (8.5×). Taken together, these data indicate that LAT2 is an early mediator of the anti-leukemic activity of alkylphospholipids and arsenic trioxide. Thus, LAT2 may be used as a target for the design of drugs for cancer therapy. Lipid rafts are highly ordered membrane domains rich in cholesterol and sphingolipids that provide a scaffold for signal transduction proteins; altered raft structure has also been implicated in cancer progression. We have shown that 25 μm 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate (ODPC), an alkylphospholipid, targets high cholesterol domains in model membranes and induces apoptosis in leukemia cells but spares normal hematopoietic and epithelial cells under the same conditions. We performed a quantitative (SILAC) proteomic screening of ODPC targets in a lipid-raft-enriched fraction of leukemic cells to identify early events prior to the initiation of apoptosis. Six proteins, three with demonstrated palmitoylation sites, were reduced in abundance. One, the linker for activation of T-cell family member 2 (LAT2), is an adaptor protein associated with lipid rafts in its palmitoylated form and is specifically expressed in B lymphocytes and myeloid cells. Interestingly, LAT2 is not expressed in K562, a cell line more resistant to ODPC-induced apoptosis. There was an early loss of LAT2 in the lipid-raft-enriched fraction of NB4 cells within 3 h following treatment with 25 μm ODPC. Subsequent degradation of LAT2 by proteasomes was observed. Twenty-five μm ODPC inhibited AKT activation via myeloid growth factors, and LAT2 knockdown in NB4 cells by shRNA reproduced this effect. LAT2 knockdown in NB4 cells also decreased cell proliferation and increased cell sensitivity to ODPC (7.5×), perifosine (3×), and arsenic trioxide (8.5×). Taken together, these data indicate that LAT2 is an early mediator of the anti-leukemic activity of alkylphospholipids and arsenic trioxide. Thus, LAT2 may be used as a target for the design of drugs for cancer therapy. The development of resistance to drugs that inhibit signaling pathways in cancer cells has emerged as a major limitation of targeted therapy. While the major mechanism of acquired resistance is the emergence of additional mutations or growth factor receptor overexpression (1Kosaka T. Yamaki E. Mogi A. Kuwano H. Mechanisms of resistance to EGFR TKIs and development of a new generation of drugs in non-small-cell lung cancer.J. Biomed. Biotechnol. 2011; 2011: 165214Crossref PubMed Scopus (110) Google Scholar), recent studies have shown an interesting mechanism of constitutional resistance to epidermal growth factor receptor inhibitors in breast cancer cells, which involves structural alterations in lipid rafts and is independent of the kinase itself (2Irwin M.E. Mueller K.L. Bohin N. Ge Y. Boerner J.L. Lipid raft localization of EGFR alters the response of cancer cells to the EGFR tyrosine kinase inhibitor gefitinib.J. Cell. Physiol. 2011; 226: 2316-2328Crossref PubMed Scopus (129) Google Scholar). Lipid rafts or membrane rafts are highly ordered membrane domains that are rich in cholesterol and sphingolipids which function by compartmentalizing diverse cellular processes (3Pike L.J. Rafts defined: a report on the Keystone Symposium on Lipid Rafts and Cell Function.J. Lipid Res. 2006; 47: 1597-1598Abstract Full Text Full Text PDF PubMed Scopus (1128) Google Scholar, 4Lingwood D. Simons K. Lipid rafts as a membrane-organizing principle.Science. 2010; 327: 46-50Crossref PubMed Scopus (3201) Google Scholar), including signal transduction (5Seminario M.C. Bunnell S.C. Signal initiation in T-cell receptor microclusters.Immunol. Rev. 2008; 221: 90-106Crossref PubMed Scopus (79) Google Scholar, 6Gupta N. DeFranco A.L. Lipid rafts and B cell signaling.Semin. Cell Dev. Biol. 2007; 18: 616-626Crossref PubMed Scopus (106) Google Scholar, 7Jury E.C. Flores-Borja F. Kabouridis P.S. Lipid rafts in T cell signalling and disease.Semin. Cell Dev. Biol. 2007; 18: 608-615Crossref PubMed Scopus (98) Google Scholar). Emerging evidence associates altered raft structure with cancer progression (8Jahn K.A. Su Y. Braet F. Multifaceted nature of membrane microdomains in colorectal cancer.World J. Gastroenterol. 2011; 17: 681-690Crossref PubMed Scopus (19) Google Scholar, 9Patra S.K. Dissecting lipid raft facilitated cell signaling pathways in cancer.Biochim. Biophys. Acta. 2008; 1785: 182-206Crossref PubMed Scopus (261) Google Scholar, 10Hitosugi T. Sato M. Sasaki K. Umezawa Y. Lipid raft specific knockdown of SRC family kinase activity inhibits cell adhesion and cell cycle progression of breast cancer cells.Cancer Res. 2007; 67: 8139-8148Crossref PubMed Scopus (43) Google Scholar). Therefore, the development of therapeutic strategies for disrupting raft-based cell signaling in cancer represents a potentially useful approach. We and others have presented evidence that alkylphospholipid (APL) 1The abbreviations used are:AMLacute myeloid leukemiaAPLalkylphospholipidATOarsenic trioxideDMSOdimethyl sulfoxideDRMdetergent-resistant membraneDTdoubling timeGRgrowth rateLABlinker for activation of B-cellsLAT2linker for activation of T cells-2MCDmethyl-β-cyclodextrinMGFmyeloid growth factorNTALnon-T-cell activation linkerODPC10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphateRPribosomal proteins. 1The abbreviations used are:AMLacute myeloid leukemiaAPLalkylphospholipidATOarsenic trioxideDMSOdimethyl sulfoxideDRMdetergent-resistant membraneDTdoubling timeGRgrowth rateLABlinker for activation of B-cellsLAT2linker for activation of T cells-2MCDmethyl-β-cyclodextrinMGFmyeloid growth factorNTALnon-T-cell activation linkerODPC10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphateRPribosomal proteins. drugs target raft structure in leukemia (11dos Santos G.A. Thomé C.H. Ferreira G.A. Yoneda J.S. Nobre T.M. Daghastanli K.R. Scheucher P.S. Gimenes-Teixeira H.L. Constantino M.G. de Oliveira K.T. Faça V.M. Falcão R.P. Greene L.J. Rego E.M. Ciancaglini P. Interaction of 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate with mimetic membranes and cytotoxic effect on leukemic cells.Biochim. Biophys. Acta. 2010; 1798: 1714-1723Crossref PubMed Scopus (11) Google Scholar) and lymphoma cells (12van der Luit A.H. Vink S.R. Klarenbeek J.B. Perrissoud D. Solary E. Verheij M. van Blitterswijk W.J. A new class of anticancer alkylphospholipids uses lipid rafts as membrane gateways to induce apoptosis in lymphoma cells.Mol. Cancer Ther. 2007; 6: 2337-2345Crossref PubMed Scopus (118) Google Scholar). One such APL, perifosine, is currently in clinical trials as an anti-cancer therapeutic agent (13Pinton G. Manente A.G. Angeli G. Mutti L. Moro L. Perifosine as a potential novel anti-cancer agent inhibits EGFR/MET-AKT axis in malignant pleural mesothelioma.PLoS ONE. 2012; 7: e36856Crossref PubMed Scopus (35) Google Scholar). acute myeloid leukemia alkylphospholipid arsenic trioxide dimethyl sulfoxide detergent-resistant membrane doubling time growth rate linker for activation of B-cells linker for activation of T cells-2 methyl-β-cyclodextrin myeloid growth factor non-T-cell activation linker 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate ribosomal proteins. acute myeloid leukemia alkylphospholipid arsenic trioxide dimethyl sulfoxide detergent-resistant membrane doubling time growth rate linker for activation of B-cells linker for activation of T cells-2 methyl-β-cyclodextrin myeloid growth factor non-T-cell activation linker 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate ribosomal proteins. We demonstrated that 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate (ODPC) targets high cholesterol raft-like domains in model membranes and induces apoptosis in leukemia cells, with an effective dose of 25 μm after 24 h in NB4 cells, but has no effect on normal hematopoietic and epithelial cells under the same conditions (11dos Santos G.A. Thomé C.H. Ferreira G.A. Yoneda J.S. Nobre T.M. Daghastanli K.R. Scheucher P.S. Gimenes-Teixeira H.L. Constantino M.G. de Oliveira K.T. Faça V.M. Falcão R.P. Greene L.J. Rego E.M. Ciancaglini P. Interaction of 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate with mimetic membranes and cytotoxic effect on leukemic cells.Biochim. Biophys. Acta. 2010; 1798: 1714-1723Crossref PubMed Scopus (11) Google Scholar). Here we present evidence based on quantitative proteomics (14Ong S.E. Blagoev B. Kratchmarova I. Kristensen D.B. Steen H. Pandey A. Mann M. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics.Mol. Cell. Proteomics. 2002; 1: 376-386Abstract Full Text Full Text PDF PubMed Scopus (4569) Google Scholar) that the APL ODPC targets proteins recovered in a lipid raft-enriched fraction of leukemic cells. Proteins with predicted palmitoylation sites located in lipid rafts are reduced in abundance after treatment with ODPC. We provide evidence that an adaptor protein for cell signaling, linker for activation of T-cells-2 (LAT2)/non-T-cell activation linker (NTAL)/linker for activation of B-cells (LAB) (15Iwaki S. Jensen B.M. Gilfillan A.M. Ntal/Lab/Lat2.Int. J. Biochem. Cell Biol. 2007; 39: 868-873Crossref PubMed Scopus (22) Google Scholar), is involved in early events of ODPC anti-leukemic activity. Additionally, we show that LAT2 knockdown cells obtained with shRNA have suppressed AKT activation, decreased cell proliferation, and increased cell sensitivity to drugs such as ODPC, perifosine, and arsenic trioxide (ATO), indicating that LAT2 is a potential target for the design of drugs for cancer therapy. The human cell lines NB4 (acute promyelocytic leukemia) (16Lanotte M. Martin-Thouvenin V. Najman S. Balerini P. Valensi F. Berger R. NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3).Blood. 1991; 77: 1080-1086Crossref PubMed Google Scholar), U937 (histiocytic lymphoma with myeloid markers) (17Strefford J.C. Foot N.J. Chaplin T. Neat M.J. Oliver R.T. Young B.D. Jones L.K. The characterisation of the lymphoma cell line U937, using comparative genomic hybridisation and multi-plex FISH.Cytogenet. Cell Genet. 2001; 94: 9-14Crossref PubMed Scopus (20) Google Scholar), and K562 (chronic myeloid leukemia in blast crisis) (18Naumann S. Reutzel D. Speicher M. Decker H.J. Complete karyotype characterization of the K562 cell line by combined application of G-banding, multiplex-fluorescence in situ hybridization, fluorescence in situ hybridization, and comparative genomic hybridization.Leuk. Res. 2001; 25: 313-322Crossref PubMed Scopus (70) Google Scholar) were cultured at 37 °C with 5% CO2 in RPMI 1640 medium supplemented with 10% fetal bovine serum. Cell viability was determined via trypan blue assay, and only cultures with ≥95% viability were used. ODPC was synthesized as described elsewhere (11dos Santos G.A. Thomé C.H. Ferreira G.A. Yoneda J.S. Nobre T.M. Daghastanli K.R. Scheucher P.S. Gimenes-Teixeira H.L. Constantino M.G. de Oliveira K.T. Faça V.M. Falcão R.P. Greene L.J. Rego E.M. Ciancaglini P. Interaction of 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate with mimetic membranes and cytotoxic effect on leukemic cells.Biochim. Biophys. Acta. 2010; 1798: 1714-1723Crossref PubMed Scopus (11) Google Scholar, 19Agresta M. D'Arrigo P. Fasoli E. Losi D. Pedrocchi-Fantoni G. Riva S. Servi S. Tessaro D. Synthesis and antiproliferative activity of alkylphosphocholines.Chem. Phys. Lipids. 2003; 126: 201-210Crossref PubMed Scopus (18) Google Scholar) and tested at 25 μm concentration for 3, 6, 12, and 24 h with phosphate buffered saline (PBS) as the vehicle control. Apoptotic events were detected via annexin-V and propidium iodide assays using flow cytometry (11dos Santos G.A. Thomé C.H. Ferreira G.A. Yoneda J.S. Nobre T.M. Daghastanli K.R. Scheucher P.S. Gimenes-Teixeira H.L. Constantino M.G. de Oliveira K.T. Faça V.M. Falcão R.P. Greene L.J. Rego E.M. Ciancaglini P. Interaction of 10-(octyloxy) decyl-2-(trimethylammonium) ethyl phosphate with mimetic membranes and cytotoxic effect on leukemic cells.Biochim. Biophys. Acta. 2010; 1798: 1714-1723Crossref PubMed Scopus (11) Google Scholar). All cell lines were purchased from the American Tissue Culture Collection (Rockville, MD). Perifosine was purchased from Selleck Chemicals (Houston, TX) and dissolved in PBS. The effective dose (ED50) of perifosine for the inhibition of 50% of the proliferation of leukemic cells was determined by means of median dose effect analysis using commercially available software (Calcusyn) (Biosoft, Ferguson, MO) (20Chou T.C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies.Pharmacol. Rev. 2006; 58: 621-681Crossref PubMed Scopus (3646) Google Scholar). NB4 cells were maintained serum-free overnight (18 h). ODPC (25 μm), Wortmannin (1 μm) (positive control for inhibition of phosphoinositide 3-kinase (PI3K)), or PBS (negative control) was then added for 15 min, and cells were stimulated with a mixture of myeloid growth factors (10 ng/ml each of hr-IL-3, hr-GM-CSF, hr-FLT3-L, and hr-SCF) (PeproTech, Mexico City, Mexico). Aliquots were removed 5, 15, and 30 min after stimulation, and phosphorylation of Ser 473 of AKT was measured via Western blotting. Palmitoyl transferases were inhibited via the incubation of NB4 cells with 100 μm 2-bromopalmitic acid (2-BrPA) (Sigma, St. Louis, MO), or its vehicle (0.1% v/v dimethyl sulfoxide (DMSO)) as a negative control, for 1 h to deplete palmitoyl residues in raft proteins (21Resh M.D. Use of analogs and inhibitors to study the functional significance of protein palmitoylation.Methods. 2006; 40: 191-197Crossref PubMed Scopus (122) Google Scholar). The cells were collected after 3, 6, 12, and 24 h. For cholesterol depletion, 2.5 × 105 cells were treated with 2.5 mg/ml methyl-β-cyclodextrin (MCD) (product number C4555, lot number 054K01461V; Sigma) for 30 min in serum-free medium (22Vink S.R. Luit A.H.v.d. Klarenbeek J.B. Verheij M. Blitterswijk W.J.v. Lipid rafts and metabolic energy differentially determine uptake of anti-cancer alkylphospholipids in lymphoma versus carcinoma cells.Biochem. Pharmacol. 2007; 74: 1456-1465Crossref PubMed Scopus (33) Google Scholar). After incubation the cells were washed three times with PBS and suspended in complete culture medium containing 25 μm ODPC or PBS as a vehicle control. NB4 cells were treated with 10 μm MG132 (Sigma) or 0.1% DMSO (v/v) as a vehicle control for 3 h. Cells were then treated with 25 μm ODPC or PBS as a vehicle control and harvested at 3, 6, 12, and 24 h for LAT2 analysis via Western blotting. Alternatively, NB4 cells were treated with 5 μm MLN9708 (Selleck Chemicals, Houston, TX) for 30 min or 0.1% DMSO (v/v) as a vehicle control and then exposed to 25 μm ODPC or 25 μm perifosine or PBS as a vehicle control and harvested at 3, 6, 12, and 24 h for LAT2 analysis via Western blotting. The tetrapeptide Asp-Glu-Val-Asp (DEVD), modified by N-acetylation of the N terminus and with p-nitroanilide (pNA) to form an alpha peptide bond with the C-terminal aspartic acid residue (Sigma), was used as a substrate. DEVD-dependent protease activity was determined via spectrophotometric measurement of pNA at 405 nm released from the substrate. Caspase activity is reported as nmol substrate hydrolyzed/min. Briefly, following the induction of apoptosis, between 1 × 106 and 2 × 106 cells were rinsed twice with PBS, resuspended in lysis buffer (50 mm HEPES, 100 mm NaCl, 0.1% Chaps, 1 mm DTT, 100 μm EDTA, pH 7.4), incubated on ice for 5 min, and centrifuged at 20,000 × g for 30 min at 4 °C, and the supernatants were denoted total cell lysates (held on ice until use). The protein concentration was determined according to the Bradford method (Bio-Rad, Hercules, CA), using bovine serum albumin as a standard. Thirty micrograms of proteins were incubated with 200 μm substrate for 1 h at 37 °C in reaction buffer (50 mm HEPES, 100 mm NaCl, 0.1% Chaps, 10 mm DTT, 100 μm EDTA, and 10% glycerol, pH 7.4). NB4 cells were cultured with SILAC, RPMI 1640 medium Kit (Life Tech, Carlsbad, CA), containing light lysine (natural l-Lys) or heavy lysine ([U13C-l-Lys) and supplemented with 10% (v/v) dialyzed fetal bovine serum plus 0.01% (w/v) penicillin/streptomycin as described elsewhere (14Ong S.E. Blagoev B. Kratchmarova I. Kristensen D.B. Steen H. Pandey A. Mann M. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics.Mol. Cell. Proteomics. 2002; 1: 376-386Abstract Full Text Full Text PDF PubMed Scopus (4569) Google Scholar). Cells underwent at least seven duplication cycles. The "heavy" labeled NB4 cells were treated with 25 μm ODPC for 3 h, and the "light" labeled NB4 cells were treated with PBS as a control. For each treatment, 2.0 × 108 cells were used. For total cell extracts, equal amounts of light (control) or heavy (ODPC-treated) NB4 cells were mixed, washed twice with cold PBS, and resuspended in buffer (0.1 ml 25 mm Tris-HCl pH 8.5, 2% SDS plus a protease inhibitor mixture (product number P8340; Sigma)). A d-130 tissue homogenizer (Biosystem, São José dos Pinhais, PR, Brazil) was used at 15,000 rpm for 2 min to lyse the cells. Lysates were centrifuged at 20,000 × g for 30 min at 4 °C, and the supernatants were denoted total cell lysates. Lipid raft-enriched fractions, designated as detergent-resistant membranes (DRMs), were isolated using a successive detergent extraction method exactly as described elsewhere (23Adam R.M. Yang W. Di Vizio D. Mukhopadhyay N.K. Steen H. Rapid preparation of nuclei-depleted detergent-resistant membrane fractions suitable for proteomics analysis.BMC Cell Biol. 2008; 9: 30Crossref PubMed Scopus (41) Google Scholar), except for the use of a 25-gauge needle instead of a Dounce homogenizer to disrupt the cells. Briefly, NB4 cells were resuspended in buffer M (50 mm HEPES, pH 7.4, 10 mm NaCl, 5 mm MgCl2, 0.1 mm EDTA plus a protease inhibitor mixture, 1 mm Na3VO4, 1 mm NaF, and 1 mm Na4P2O7.10 dH2O) and broken by being passed through a 25-gauge needle 20 times and centrifuged at 500 × g for 10 min at 4 °C to pellet nuclei and intact cells. The supernatant was centrifuged at 16,000 × g for 20 min at 4 °C to pellet membranes. The pellets were resuspended in buffer A (25 mm MES (2-(N-morpholino)-ethanesulfonic acid), 150 mm NaCl, pH 6.5) and samples combined with an equal volume of buffer A containing 2% Triton X-100 and protease inhibitor. Samples were incubated on ice for 60 min and centrifuged at 16,000 × g for 20 min at 4 °C, and the supernatant (the Triton-soluble material) was designated as DSM. Pellets were rinsed briefly with buffer A and resuspended in buffer B (10 mm Tris-Cl, pH 7.6, 150 mm NaCl, 60 mm β-octyl glucoside and phosphatase and protease inhibitor). Samples were incubated on ice for 30 min and centrifuged at 16,000 × g for 20 min at 4 °C, and supernatants were collected as the lipid raft-enriched fraction that was designated as DRM. Western blot analysis was performed to determine the level of efficacy of enrichment with the lipid raft marker Lyn, the non-raft marker Ergic-53, and the nucleus marker histone H4. NB4 cells (4 × 108) were washed twice with cold PBS and lysed in 2 ml of 25 mm MES buffer (pH 6.5), 150 mm NaCl containing a protease inhibitor mixture (product number P8340; Sigma), and 1% Triton X-100 for 30 min at 4 °C. Cells were disrupted by being passed through a 25-gauge needle 20 times followed by use of a d-130 tissue homogenizer (Biosystem) (15,000 rpm) for 2 min. The suspension of disrupted cells was then centrifuged at 500 × g for 10 min at 4 °C to pellet nuclei and intact cells. About 1 ml of supernatant was layered onto a continuous sucrose density gradient (0%–63% (w/v), 13 ml) in 25 mm MES buffer (pH 6.5) containing 150 mm NaCl, and centrifugation was carried out for 4 h at 180,000 × g using a Hitachi vertical rotor (P65VT3) at 4 °C. Fractions of 1 ml were collected and assayed for protein content and refractive index. The protein concentration was determined according to the Bradford method (Bio-Rad) using bovine serum albumin as standard. Five micrograms of protein from each fraction were subjected to SDS-polyacrylamide gel electrophoresis and Western blot analysis. The proteins present in the total protein extract or DRM fraction were partially separated by 12.5% SDS-PAGE. Each lane was cut into 6 or 10 pieces, washed, and digested with trypsin as described elsewhere (24Pereira S.R. Faça V.M. Gomes G.G. Chammas R. Fontes A.M. Covas D.T. Greene L.J. Changes in the proteomic profile during differentiation and maturation of human monocyte-derived dendritic cells stimulated with granulocyte macrophage colony stimulating factor/interleukin-4 and lipopolysaccharide.Proteomics. 2005; 5: 1186-1198Crossref PubMed Scopus (53) Google Scholar). Tryptic peptides were successively extracted with 0.1% formic acid and 50% acetonitrile and then 70% acetonitrile and dried with a SpeedVac apparatus (Thermo Scientific, Marietta, OH). Peptide mixtures were dissolved in 45 μl 4% acetonitrile, 0.1% formic acid, and 0.5 m urea and analyzed via LC-MS/MS in a nanoflow reversed-phase HPLC system connected to an LTQ Orbitrap mass spectrometer (Thermo Scientific). Chromatography was carried out with an in-house packed 75-μm inner diameter (New Objectives) × 25-cm long C18 column packed with Magic C18 resin at 250 nl/min with 90 min linear gradients from 5% to 40% acetonitrile in 0.1% formic acid. MS/MS scans of the five most abundant doubly or triply charged peaks in the FT-MS scan were recorded in a data-dependent mode in the linear ion trap (25Faça V.M. Ventura A.P. Fitzgibbon M.P. Pereira-Faça S.R. Pitteri S.J. Green A.E. Ireton R.C. Zhang Q. Wang H. O'Briant K.C. Drescher C.W. Schummer M. McIntosh M.W. Knudsen B.S. Hanash S.M. Proteomic analysis of ovarian cancer cells reveals dynamic processes of protein secretion and shedding of extra-cellular domains.PLoS One. 2008; 3: e2425Crossref PubMed Scopus (110) Google Scholar). Two additional verification replicate runs were performed using the same amount of DRM extract mixtures. The data for these replicates were collected as described above. Peptides and proteins were identified with the Computational Proteomics Analysis System (26Rauch A. Bellew M. Eng J. Fitzgibbon M. Holzman T. Hussey P. Igra M. Maclean B. Lin C.W. Detter A. Fang R. Faca V. Gafken P. Zhang H. Whiteaker J. Whitaker J. States D. Hanash S. Paulovich A. McIntosh M.W. Computational Proteomics Analysis System (CPAS): an extensible, open-source analytic system for evaluating and publishing proteomic data and high throughput biological experiments.J. Proteome Res. 2006; 5: 112-121Crossref PubMed Scopus (176) Google Scholar) using the X!Tandem search engine (January 2007 release) (27MacLean B. Eng J.K. Beavis R.C. McIntosh M. General framework for developing and evaluating database scoring algorithms using the TANDEM search engine.Bioinformatics. 2006; 22: 2830-2832Crossref PubMed Scopus (183) Google Scholar) and Peptide Prophet (28Nesvizhskii A.I. Keller A. Kolker E. Aebersold R. A statistical model for identifying proteins by tandem mass spectrometry.Anal. Chem. 2003; 75: 4646-4658Crossref PubMed Scopus (3621) Google Scholar) and Protein Prophet (29Keller A. Nesvizhskii A.I. Kolker E. Aebersold R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search.Anal. Chem. 2002; 74: 5383-5392Crossref PubMed Scopus (3885) Google Scholar) algorithms for the statistical validation of data and protein grouping. MS data were searched in the human International Protein Index (IPI version 3.52; 73,950 entries). Search parameters for tryptic peptides included up to two missed cleavages, mass allowances of 0.5 Da for fragment ions, fixed cysteine modification with carbamidomethylation (+57.02146), variable methionine oxidation (+15.99491), and variable lysine modification (+6.020129) to account for both heavy and light SILAC labels. Only peptides with a Peptide Prophet score above 0.90 and precursor ions with a delta mass less than 20 ppm were considered for protein identification and quantification. The list of proteins was generated with a Protein Prophet cut-off value of 0.9, representing an overall protein false discovery rate of ∼2% based on the Protein Prophet estimate and including proteins identified based on single peptide hits. Proteins were quantitated as previously described, using the Q3 algorithm to measure SILAC peak intensities (30Faca V. Coram M. Phanstiel D. Glukhova V. Zhang Q. Fitzgibbon M. McIntosh M. Hanash S. Quantitative analysis of acrylamide labeled serum proteins by LC-MS/MS.J. Proteome Res. 2006; 5: 2009-2018Crossref PubMed Scopus (101) Google Scholar, 31Faca V.M. Song K.S. Wang H. Zhang Q. Krasnoselsky A.L. Newcomb L.F. Plentz R.R. Gurumurthy S. Redston M.S. Pitteri S.J. Pereira-Faca S.R. Ireton R.C. Katayama H. Glukhova V. Phanstiel D. Brenner D.E. Anderson M.A. Misek D. Scholler N. Urban N.D. Barnett M.J. Edelstein C. Goodman G.E. Thornquist M.D. McIntosh M.W. DePinho R.A. Bardeesy N. Hanash S.M. A mouse to human search for plasma proteome changes associated with pancreatic tumor development.PLoS Med. 2008; 5: e123Crossref PubMed Scopus (213) Google Scholar). NB4, U937, or K562 cells were washed twice in cold PBS; lysed with lysis buffer, 50 mm Tris-HCl, pH 8.5, 2% SDS, 1 mm Na3VO4 containing the protease inhibitor mixture (product number P8340; Sigma); and homogenized in a d-130 tissue homogenizer (15,000 rpm) (Biosystems, Sao Jose dos Pinhais, PR, Brazil) for 2 min on ice. Lysates were centrifuged at 20,000 × g for 30 min at 4 °C, and the supernatants were designated as total cell lysates. The protein concentration was determined according to the Bradford method (Bio-Rad). Proteins were submitted to SDS-PAGE and transferred to polyvinylidene fluoride membranes (GE Lifesciences, Pittsburgh, PA). Membranes were blocked with 5% nonfat milk in 0.05% Tween-TBS and incubated with the specific antibodies. Mouse anti-β-actin (sc-81178), goat anti-Lyn(44)-G (sc-15G), goat anti-ERGIC-53 (sc-32442), rabbit anti-histone H4 (H-97) (sc-10810), rabbit anti-AKT 1(5G12) (sc-81435), rabbit anti-phospho-AKT 1/2/3 (Ser-473) (sc-101629), rabbit anti-PTEN (C-20)-R (sc-6817-R), and horseradish peroxidase-conjugated secondary donkey anti-goat IgG (sc-2033) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-phospho-PTEN (Ser-380/Thr-382/383) (#9549), rabbit anti-caspase-3 (#9662), rabbit anti-cleaved caspase-3 (#9661), rabbit anti-PARP (#9542), rabbit anti-cleaved PARP (#9541), rabbit anti-caspase-7 (#9492), rabbit anti-cleaved caspase-7 (#9491), rabbit anti-caspase-9 (#9502), rabbit anti-cleaved caspase-9 (#9501), rabbit anti-cleaved caspase-8 (#9496), rabbit anti-NTAL/LAB (#9533), rabbit anti-phospho-S6 ribosomal protein (Ser-235/236) (#4858), rabbit anti-AKT (#9272), rabbit anti-phospho-AKT (Ser-473)(#4058), and horseradish peroxidase-conjugated secondary antibody goat anti-rabbit IgG were purchased from Cell Signaling (Beverly, MA). Goat anti-mouse IgG (NA931VS) was purchased from GE Healthcare Life Sciences. The apparent molecular weights reported in the figures were obtained via comparison with a biotinylated protein ladder (#7727 and #7075) (Cell Signaling, Beverly, MA). The antibody–protein complex was detected using ECL Western blotting detection reagents (GE Healthcare Life Sciences). Western blotting experiments were quantified with image analysis software (ImageQuant TL) (GE Healthcare Life Sciences). Stable NB4 cell line knockdown of LAT2 was obtained using MISSION lentiviral shRNA transduction particles (catalogue number SHCLNV-NM_014146; Sigma) according to the manufacturer's protocol. The shRNA sequence against LAT2 used was CCGGGAAGATGAGGAATCTGAGGATCTCGAGATCCTCAGATTCCTCATCTTCTTTTTTG(TRCN0000129029). MISSION TurboGFP™ Control Transduction Particles (Sigma) were used as a control for transduction efficiency. Empty vector virus (pLKO.1, catalogue number SHC003V; Sigma) was used as a negative control for LAT2 knockdown. RPMI 1640 medium was used for viral transduction of NB4 cells in the presence of polybrene (8 μg/ml) (Sigma). NB4 cells were transduced at a multiplicity of
Referência(s)