Portal de Periódicos da CAPES

Inhibition of Hydrogen Sulfide Generation Contributes to Gastric Injury Caused by Anti-Inflammatory Nonsteroidal Drugs

2005; Elsevier BV; Volume: 129; Issue: 4 Linguagem: Inglês

10.1053/j.gastro.2005.07.060

1528-0012

Stefano Fiorucci, Elisabetta Antonelli, Eleonora Distrutti, Giovanni Rizzo, Andrea Mencarelli, Stefano Orlandi, R C O Zanardo, Barbara Renga, Moises Di Sante, Antonio Morelli, Giuseppe Cirino, John L. Wallace,

Eosinophilic Esophagitis

Background & Aims: Hydrogen sulfide (H2S), an endogenous gaseous mediator that causes vasodilation, is generated in mammalian tissues by cystathionine β-synthase (CBS) and cystathionine-γ-lyase (CSE). Here, we have investigated the role of H2S in a rodent model of nonsteroidal anti-inflammatory drug (NSAID) gastropathy. Methods: Rats were given acetyl salycilic acid (ASA) or an NSAID alone or in combination with NaHS, an H2S donor, and killed 3 hours later. Gastric blood flow was measured by laser-Doppler flowmetry, whereas intravital microscopy was used to quantify adhesion of leukocytes to mesenteric postcapillary endothelium. Results: At a dose of 100 μmol/kg, NaHS attenuated by 60%–70% the gastric mucosal injury, and tumor necrosis factor (TNF)-α, intercellular adhesion molecule (ICAM)-1, and lymphocyte function-associated antigen (LFA)-1 mRNA up-regulation induced by NSAIDs (P < .05) NaHS administration prevented the associated reduction of gastric mucosal blood flow (P < .05) and reduced ASA-induced leukocyte adherence in mesenteric venules. NaHS did not affect suppression of prostaglandin E2 (PGE2) synthesis by NSAIDs. Glibenclamide, a KATP channel inhibitor, and DL-propargylglycine, a CSE inhibitor, exacerbated, whereas pinacidil, a KATP opener, attenuated gastric injury caused by ASA. Exposure to NSAIDs reduced H2S formation and CSE expression (mRNA and protein) and activity by 60%–70%. By promoter deletion and mutation analysis, an Sp1 consensus site was identified in the CSE promoter. Exposure to NSAIDs inhibits Sp1 binding to its promoter and abrogates CSE expression in HEK-293 cells transfected with a vector containing the core CSE promoter. Exposure to NSAIDs inhibits Sp1 and ERK phosphorylation. Conclusions: These data establish a physiologic role for H2S in regulating the gastric microcirculation and identify CSE as a novel target for ASA/NSAIDs. Background & Aims: Hydrogen sulfide (H2S), an endogenous gaseous mediator that causes vasodilation, is generated in mammalian tissues by cystathionine β-synthase (CBS) and cystathionine-γ-lyase (CSE). Here, we have investigated the role of H2S in a rodent model of nonsteroidal anti-inflammatory drug (NSAID) gastropathy. Methods: Rats were given acetyl salycilic acid (ASA) or an NSAID alone or in combination with NaHS, an H2S donor, and killed 3 hours later. Gastric blood flow was measured by laser-Doppler flowmetry, whereas intravital microscopy was used to quantify adhesion of leukocytes to mesenteric postcapillary endothelium. Results: At a dose of 100 μmol/kg, NaHS attenuated by 60%–70% the gastric mucosal injury, and tumor necrosis factor (TNF)-α, intercellular adhesion molecule (ICAM)-1, and lymphocyte function-associated antigen (LFA)-1 mRNA up-regulation induced by NSAIDs (P < .05) NaHS administration prevented the associated reduction of gastric mucosal blood flow (P < .05) and reduced ASA-induced leukocyte adherence in mesenteric venules. NaHS did not affect suppression of prostaglandin E2 (PGE2) synthesis by NSAIDs. Glibenclamide, a KATP channel inhibitor, and DL-propargylglycine, a CSE inhibitor, exacerbated, whereas pinacidil, a KATP opener, attenuated gastric injury caused by ASA. Exposure to NSAIDs reduced H2S formation and CSE expression (mRNA and protein) and activity by 60%–70%. By promoter deletion and mutation analysis, an Sp1 consensus site was identified in the CSE promoter. Exposure to NSAIDs inhibits Sp1 binding to its promoter and abrogates CSE expression in HEK-293 cells transfected with a vector containing the core CSE promoter. Exposure to NSAIDs inhibits Sp1 and ERK phosphorylation. Conclusions: These data establish a physiologic role for H2S in regulating the gastric microcirculation and identify CSE as a novel target for ASA/NSAIDs. Gaseous transmitters are a growing family of regulatory molecules involved in multilevel regulation of physiologic and pathologic functions in mammalian tissues.1Wang R. Two’s company, three’s a crowd can H2S be the third endogenous gaseous transmitter?.FASEB J. 2002; 16: 1792-1798Crossref PubMed Scopus (1549) Google Scholar Although nitric oxide (NO) is the best characterized member of this family, it is increasingly recognized that carbon monoxide (CO) and hydrogen sulfide (H2S) might also function as gaseous mediators in mammalian cells.1Wang R. Two’s company, three’s a crowd can H2S be the third endogenous gaseous transmitter?.FASEB J. 2002; 16: 1792-1798Crossref PubMed Scopus (1549) Google Scholar, 2Boehning D. Snyder S.H. Novel neural modulators.Annu Rev Neurosci. 2003; 26: 105-131Crossref PubMed Scopus (473) Google Scholar H2S synthesis from cysteine occurs naturally in a range of mammalian tissues principally through the activity of 2 pyridoxal-5′-phosphate-dependent enzymes, cystathionine γ lyase (CSE) and cystathionine β synthetase (CBS), although alternative sources (eg, by activity of cysteine aminotransferase and/or 3- mercaptosulphurtransferase) cannot yet be discounted.1Wang R. Two’s company, three’s a crowd can H2S be the third endogenous gaseous transmitter?.FASEB J. 2002; 16: 1792-1798Crossref PubMed Scopus (1549) Google Scholar, 2Boehning D. Snyder S.H. Novel neural modulators.Annu Rev Neurosci. 2003; 26: 105-131Crossref PubMed Scopus (473) Google Scholar, 3Moore P.K. Bhatia M. Moochhala S. Hydrogen sulfide from the smell of the past to the mediator of the future?.Trends Pharmacol Sci. 2003; 24: 609-611Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 4Stipanuk M.H. Sulfur amino acid metabolism pathways for production and removal of homocysteine and cysteine.Annu Rev Nutr. 2004; 24: 539-577Crossref PubMed Scopus (744) Google Scholar In some tissues, CBS and CSE are both required for generation of H2S, whereas, in others, one enzyme suffices. CBS-derived H2S is a physiologically relevant neurotransmitter in the central nervous system in which exposure to this gaseous transmitter1Wang R. Two’s company, three’s a crowd can H2S be the third endogenous gaseous transmitter?.FASEB J. 2002; 16: 1792-1798Crossref PubMed Scopus (1549) Google Scholar results in activation of adenosine triphosphate (ATP)-sensitive K+ (KATP) channels. In the cardiovascular system, H2S, mostly derived from CSE, modulates endothelium-dependent and -independent vasodilation.1Wang R. Two’s company, three’s a crowd can H2S be the third endogenous gaseous transmitter?.FASEB J. 2002; 16: 1792-1798Crossref PubMed Scopus (1549) Google Scholar, 5Mok Y.Y. Atan M.S. Yoke Ping C. Zhong Jing W. Bhatia M. Moochhala S. Moore P.K. Role of hydrogen sulphide in haemorrhagic shock in the rat protective effect of inhibitors of hydrogen sulphide biosynthesis.Br J Pharmacol. 2004; 143: 881-889Crossref PubMed Scopus (217) Google Scholar, 6Zhao W. Zhang J. Lu Y. Wang R. The vasorelaxant effect of H2S as a novel endogenous gaseous KATP channel opener.EMBO J. 2001; 20: 6008-6016Crossref PubMed Scopus (1646) Google Scholar Highlighting the functional role of H2S, CBS deficiency leads to hyper-homocyst(e)inemia, a condition that includes elevated serum levels of homocysteine, homocystine, or homocysteine-mixed disulfides, and is associated with increased blood pressure and endothelial dysfunction.7Clarke R. Daly L. Robinson K. Naughten E. Cahalane S. Fowler B. Graham I. Hyperhomocysteinemia an independent risk factor for vascular disease.N Engl J Med. 1991; 324: 1149-1155Crossref PubMed Scopus (2046) Google Scholar In rodents, CBS/CSE deficiency induced by genetic-deletion8Fowler B. Kraus J. Packman S. Rosenberg L.E. Homocystinuria evidence for three distinct classes of cystathionine β-synthase mutants in cultured fibroblasts.J Clin Invest. 1978; 61: 645-653Crossref PubMed Scopus (78) Google Scholar, 9Eberhardt R.T. Forgione M.A. Cap A. Leopold J.A. Rudd M.A. Trolliet M. Heydrick S. Stark R. Klings E.S. Moldovan N.I. Yaghoubi M. Goldschmidt-Clermont P.J. Farber H.W. Cohen R. Loscalzo J. Endothelial dysfunction in a murine model of mild hyperhomocyst(e)inemia.J Clin Invest. 2000; 106: 483-491Crossref PubMed Scopus (376) Google Scholar or chronic treatment with DL-propargylglycine, an irreversible and selective inhibitor of CSE,10Yan H. Du J. Tang C. The possible role of hydrogen sulfide on the pathogenesis of spontaneous hypertension in rats.Biochem Biophys Res Commun. 2004; 313: 22-27Crossref PubMed Scopus (317) Google Scholar results in reduced nitric oxide (NO) bioactivity. This leads to severe endothelial dysfunction characterized by impaired aortic relaxation to acetylcholine and a paradoxical vasoconstriction of mesenteric microvessels in response to bradykinin.9Eberhardt R.T. Forgione M.A. Cap A. Leopold J.A. Rudd M.A. Trolliet M. Heydrick S. Stark R. Klings E.S. Moldovan N.I. Yaghoubi M. Goldschmidt-Clermont P.J. Farber H.W. Cohen R. Loscalzo J. Endothelial dysfunction in a murine model of mild hyperhomocyst(e)inemia.J Clin Invest. 2000; 106: 483-491Crossref PubMed Scopus (376) Google Scholar Gastrointestinal injury is a common complication of nonsteroidal anti-inflammatory drugs (NSAIDs) and acetylsalicylic acid (ASA) therapy.11Wolfe M.M. Lichtenstein D.R. Singh G. Gastrointestinal toxicity of nonsteroidal anti-inflammatory drugs.N Engl J Med. 1999; 340: 1888-1899Crossref PubMed Scopus (1928) Google Scholar Owing to the inhibition of cyclooxygenase (COX) isoenzymes in the gastrointestinal tract, ASA and NSAIDs reduce the intrinsic ability of the gastric mucosa to resist injury induced by endogenous and exogenous agents.11Wolfe M.M. Lichtenstein D.R. Singh G. Gastrointestinal toxicity of nonsteroidal anti-inflammatory drugs.N Engl J Med. 1999; 340: 1888-1899Crossref PubMed Scopus (1928) Google Scholar, 12Wallace J. Nonsteroidal anti-inflammatory drugs and gastroenteropathy the second hundred years.Gastroenterology. 1997; 112: 1000-1016Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar Thus, inhibition of generation of COX-1- and COX-2-derived eicosanoids (prostaglandin E2 [PGE2] and the lipoxin analogue, aspirin-triggered lipoxin) results in altered gastric mucosal blood flow and increased leukocyte-endothelial adhesive interactions in the gastric microcirculation, an essential step in the process of acute gastric injury caused by ASA/NSAIDs.13Fiorucci S. de Lima Jr, O.M. Mencarelli A. Palazzetti B. Distrutti E. McKnight W. Dicay M. Ma L. Romano M. Morelli A. Wallace J.L. Cyclooxygenase-2-derived lipoxin A4 increases gastric resistance to aspirin-induced damage.Gastroenterology. 2002; 123: 1598-1606Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 14Wallace J.L. Arfors K.E. McKnight G.W. A monoclonal antibody against the CD18 leukocyte adhesion molecule prevents indomethacin-induced gastric damage in the rabbit.Gastroenterology. 1991; 100: 878-883PubMed Google Scholar, 15Santucci L. Fiorucci S. Di Matteo F.M. Morelli A. Role of tumor necrosis factor-α release and leukocyte margination in indomethacin-induced gastric injury in rats.Gastroenterology. 1995; 108: 393-401Abstract Full Text PDF PubMed Scopus (154) Google Scholar Human and animal studies have highlighted the role of gaseous mediators, particularly NO, in maintaining gastric mucosal integrity.16Wallace J.L. Ignarro L.J. Fiorucci S. Potential cardioprotective actions of NO-releasing aspirin.Nat Rev Drug Discov. 2002; 1: 375-382Crossref PubMed Scopus (146) Google Scholar, 17Fiorucci S. Santucci L. Gresele P. Faccino R.M. Del Soldato P. Morelli A. Gastrointestinal safety of NO-aspirin (NCX-4016) in healthy human volunteers a proof of concept endoscopic study.Gastroenterology. 2003; 124: 600-607Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar Thus, by modulating expression/activity of adhesion molecules at the leukocyte-endothelium interface and by maintaining gastric mucosal blood flow, NO compensates for depressed generation of protective eicosanoids.18Perini R. Fiorucci S. Wallace J.L. Mechanisms of nonsteroidal anti-inflammatory drug-induced gastrointestinal injury and repair a window of opportunity for cyclooxygenase-inhibiting nitric oxide donors.Can J Gastroenterol. 2004; 18: 229-236PubMed Google Scholar Whether or not the gastric mucosa has the ability to generate H2S and the regulatory functions exerted by this gaseous mediator in this tissue is unknown. Aspirin; indomethacin; ketoprofen; diclofenac; lipopolysaccharide (LPS; Escherichia coli 0111:B4 serotype); sodium hydrogen sulfide (NaHS); L-cysteine, glibenclamide, a KATP channel blocker; pinacidil, a KATP opener; DL-propargylglycine; antiphosphoserine antibody; and all other reagents were purchased from Sigma Chemical Co. (St. Louis, MO). The stock solution of NaHS was freshly prepared by dissolving NaHS immediately before use. All tissue culture reagents, including minimal essential medium (MEM), fetal bovine serum (FBS), penicillin, and streptomycin, were obtained from Gibco (Milan, Italy). Filtered, deionized water was used for buffer preparation. Silver and sulphide ion selective electrodes were from ThermoOrion (Beverly, MA). The anti-human Sp1 antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and anti-ERK and anti-phospho-ERK antibody were obtained from New England Biolabs (Beverly, MA). The anti-CSE antibody was a generous gift of Dr. N. Nishi, Department of Endocrinology, Kagawa Medical School, Kagawa, Japan. All studies were approved by the animal study committees of the University of Perugia and the University of Calgary. Male Wistar rats (225–275 g) were obtained from Charles River Breeding Farms (Monza, Italy, or Montreal, Canada) and maintained on standard laboratory rat chow on a 12-hour light/dark cycle. Rats were deprived of food for 24 hours before being given one of the following orally: ASA (30 mg/kg), indomethacin (10 mg/kg), ketoprofen (30 mg/kg), ASA (30 mg/kg) plus celecoxib (100 mg/kg), or vehicle.13Fiorucci S. de Lima Jr, O.M. Mencarelli A. Palazzetti B. Distrutti E. McKnight W. Dicay M. Ma L. Romano M. Morelli A. Wallace J.L. Cyclooxygenase-2-derived lipoxin A4 increases gastric resistance to aspirin-induced damage.Gastroenterology. 2002; 123: 1598-1606Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 14Wallace J.L. Arfors K.E. McKnight G.W. A monoclonal antibody against the CD18 leukocyte adhesion molecule prevents indomethacin-induced gastric damage in the rabbit.Gastroenterology. 1991; 100: 878-883PubMed Google Scholar, 15Santucci L. Fiorucci S. Di Matteo F.M. Morelli A. Role of tumor necrosis factor-α release and leukocyte margination in indomethacin-induced gastric injury in rats.Gastroenterology. 1995; 108: 393-401Abstract Full Text PDF PubMed Scopus (154) Google Scholar Rats were killed 3 hours later, and gastric mucosal damage was measured. To assess gastric mucosal damage, the lengths (in mm) of all lesions were measured with a digital calliper, and a “gastric damage score” was calculated for each stomach by summing these values.13Fiorucci S. de Lima Jr, O.M. Mencarelli A. Palazzetti B. Distrutti E. McKnight W. Dicay M. Ma L. Romano M. Morelli A. Wallace J.L. Cyclooxygenase-2-derived lipoxin A4 increases gastric resistance to aspirin-induced damage.Gastroenterology. 2002; 123: 1598-1606Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar This assessment was performed by an individual blinded to the treatments the rats had received. In addition, samples of the body region of the stomach were excised and processed, as described previously,15Santucci L. Fiorucci S. Di Matteo F.M. Morelli A. Role of tumor necrosis factor-α release and leukocyte margination in indomethacin-induced gastric injury in rats.Gastroenterology. 1995; 108: 393-401Abstract Full Text PDF PubMed Scopus (154) Google Scholar for measurement of myeloperoxidase (MPO) activity as an index of leukocyte accumulation in the tissue. To investigate whether H2S administration could prevent the gastric injury caused by NSAIDs, rats were treated intraperitoneally with NaHS, as the H2S donor, at doses of 25, 50, 100, or 150 μmol/kg or with vehicle, and 30 minutes later were given ASA orally at a dose of 50 mg/kg.13Fiorucci S. de Lima Jr, O.M. Mencarelli A. Palazzetti B. Distrutti E. McKnight W. Dicay M. Ma L. Romano M. Morelli A. Wallace J.L. Cyclooxygenase-2-derived lipoxin A4 increases gastric resistance to aspirin-induced damage.Gastroenterology. 2002; 123: 1598-1606Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 14Wallace J.L. Arfors K.E. McKnight G.W. A monoclonal antibody against the CD18 leukocyte adhesion molecule prevents indomethacin-induced gastric damage in the rabbit.Gastroenterology. 1991; 100: 878-883PubMed Google Scholar, 15Santucci L. Fiorucci S. Di Matteo F.M. Morelli A. Role of tumor necrosis factor-α release and leukocyte margination in indomethacin-induced gastric injury in rats.Gastroenterology. 1995; 108: 393-401Abstract Full Text PDF PubMed Scopus (154) Google Scholar The rats were killed 3 hours later, and gastric mucosal damage and MPO activity were evaluated as described above. In these experiments, NaHS was used as the H2S donor for the following reasons: (1) NaHS dissociates to Na+ and HS− in solution, then HS− associates with H+ and produces H2S. At physiologic pH, ≃one third of the H2S exists as the undissociated form (H2S), whereas the remaining two thirds exists as HS− at equilibrium with H2S; (2) the use of NaHS enables us to define the concentrations of H2S in solution more accurately and reproducibly than bubbling H2S gas; (3) the influence of Na+ ions (less than 1 mmol/L) is negligible; and (4) NaHS at concentrations used in the present study does not change the pH of the medium. To investigate the role of endogenous H2S in modulating gastric mucosal resistance to damage induced by ASA and NSAIDs, rats were pretreated with DL-propargylglycine5Mok Y.Y. Atan M.S. Yoke Ping C. Zhong Jing W. Bhatia M. Moochhala S. Moore P.K. Role of hydrogen sulphide in haemorrhagic shock in the rat protective effect of inhibitors of hydrogen sulphide biosynthesis.Br J Pharmacol. 2004; 143: 881-889Crossref PubMed Scopus (217) Google Scholar, 10Yan H. Du J. Tang C. The possible role of hydrogen sulfide on the pathogenesis of spontaneous hypertension in rats.Biochem Biophys Res Commun. 2004; 313: 22-27Crossref PubMed Scopus (317) Google Scholar at a dose of 10 mg/kg per day for 5 days and then administered ASA (50 mg/kg). The rats were killed 3 hours later, and gastric mucosal injury and MPO were assessed. In another set of experiments, we determined whether or not cysteine or N-acetylcysteine, which are known to release H2S after enzymatic degradation by CSE and CBS, would influence gastric resistance to ASA-induced damage. Rats were treated with cysteine (15 mg/kg) or N-acetylcysteine (15 mg/kg) prior to oral administraton of ASA (50 mg/kg). Three hours later, the extent of gastric damage was assessed, as described previously. Finally, to determine whether KATP channels are involved in the gastric protection afforded by H2S,6Zhao W. Zhang J. Lu Y. Wang R. The vasorelaxant effect of H2S as a novel endogenous gaseous KATP channel opener.EMBO J. 2001; 20: 6008-6016Crossref PubMed Scopus (1646) Google Scholar rats were pretreated intraperitoneally (IP) with NaHS (100 μmol/kg) alone or in combination with glibenclamide (10 mg/kg), a KATP channel blocker, or pinacidil, a KATP channel opener, immediately prior to oral administration of ASA (50 mg/kg). Three hours later, the extent of mucosal injury and tissue MPO activity were assessed as described previously. Rats were anesthetized with ketamine and pentobarbital sodium (50 mg/kg, IP), and body temperature was maintained at 37°C by means of a thermostatically regulated heating pad. Gastric blood flow was measured using a laser-Doppler flowmeter (Perimed, Stockholm, Sweden).19Beck P.L. McKnight W. Lee S.S. Wallace J.L. Prostaglandin modulation of the gastric vasculature and mucosal integrity in cirrhotic rats.Am J Physiol. 1993; 265: G453-G458PubMed Google Scholar The stomach was exposed by a midline laparotomy, opened by an incision along the greater curvature, and then pinned over a plexiglas platform and clamped. A “mucosal chamber” of 1.5 cm2 gastric mucosa was prepared.19Beck P.L. McKnight W. Lee S.S. Wallace J.L. Prostaglandin modulation of the gastric vasculature and mucosal integrity in cirrhotic rats.Am J Physiol. 1993; 265: G453-G458PubMed Google Scholar Throughout the experiment, the mucosa was bathed with 0.1 mmol/L HCl, maintained at 37°C by means of circulating warm water. Blood flow was measured after 30 minutes of equilibration and recorded continuously throughout the experiments from the mucosal side of the stomach with a laser probe placed 0.5–1 mm above the mucosal surface in the acidified solution. H2S (10 mg/kg) was administered IP at the end of the equilibration period. ASA (30 mg/kg) was administered orally 1 hour before the start of the experiment. The left carotid artery was cannulated and connected to a pressure transducer for mean arterial pressure (MAP) recording using a multichannel recorder (PowerLab PC; A.D. Instruments, Milford, MA). Four rats per group were used for these studies, and measurements were repeated at least 3 times. Rats were anesthetized with pentobarbital sodium (60 mg/kg, IP), and cautery incisions were made along the abdominal region. A tracheotomy was performed to facilitate breathing. The rats were placed in a supine position, and a segment of the mesentery was exteriorized through the abdominal incision. The mesentery was carefully placed over an optically clear viewing pedestal that allowed for transillumination of a 2-cm2 segment of tissue. All exposed tissue was covered with saline-soaked gauze to minimize dehydration. The temperature of the pedestal was kept at 37°C, and the mesentery was superfused with warmed bicarbonate-buffered saline (pH 7.4). An intravital microscope (Nikon L25/0.35) and a ×10 eyepiece were used to observe the mesenteric microcirculation. Postcapillary venules with diameters ranging from 20 to 40 μm were selected for the study. A video camera mounted on the microscope (Panasonic digital 5000) projected the image onto a monitor, and the images were recorded for playback analysis using a videocassette recorder. Images of the mesenteric microcirculation were recorded for 15 minutes before aspirin administration (baseline), at the time of aspirin administration (time 0), and every 15 minutes for 60 minutes. Aspirin was administered intragastrically at a dose of 50 mg/kg. In some experiments, rats were pretreated intragastrically with NaHS (100 μmol/kg) 30 minutes prior to ASA administration (controls received vehicle at the same time). In other experiments, glibencamide (10 mg/kg) was administered 15 minutes prior to NaHS administration. Leukocyte adhesion was blindly quantified as the number of leukocytes that adhered to the vessel wall for 30 seconds or more along a 100-μm venule length.13Fiorucci S. de Lima Jr, O.M. Mencarelli A. Palazzetti B. Distrutti E. McKnight W. Dicay M. Ma L. Romano M. Morelli A. Wallace J.L. Cyclooxygenase-2-derived lipoxin A4 increases gastric resistance to aspirin-induced damage.Gastroenterology. 2002; 123: 1598-1606Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar Sulfide concentrations and production by the gastric mucosa were measured as previously described20Khan S.U. Morris G.F. Hidiroglou M. Rapid estimation of sulfide in rumen and blood with a sulfide-specific ion electrode.Microchem J. 1980; 25: 388-395Crossref Scopus (34) Google Scholar, 21Eto K. Kimura H. A novel enhancing mechanism for hydrogen sulfide-producing activity of cystathionine beta-synthase.J Biol Chem. 2002; 277: 42680-42685Crossref PubMed Scopus (73) Google Scholar with minor modifications. Briefly, gastric samples (100–150 mg) were homogenized in 1 mL ice-cold T-PER protein extractor. A tissue sample containing ∼5–10 mg protein was also lysed in 1 mL ice-cold T-PER protein extractor. Two milliliters of an assay reaction mixture was introduced into the reactor. The mixture contained 10 mmol/L L-cysteine (or N-acetyl-L-cysteine), 2 mmol/L pyridoxal 5′-phosphate, 100 mmol/L potassium phosphate buffer (pH, 7.4), and 10% (wt/vol) liver homogenate or gastric tissue lysate. DL-propargylglycine, 2 mmol/L, was incubated with gastric homogenates for 5 minutes at 37°C prior to the enzyme reaction. Calmodulin and calcium chloride were added to a final reaction mixture at concentrations of 9.6 μmol/L and 0.6 mmol/L, respectively. A constant stream of nitrogen was passed through the mixture via gas-inlet capillary. Reactions were initiated by transferring the reactor from ice bath to a 37°C water bath. The stream of nitrogen carried the sulfide acid in the second reactor containing 2 mL sulfide antioxidant buffer (SAOB) solution, consisting of 2 mol/L KOH, 1 mol/L salicylic acid, and 0.22 mol/L ascorbic acid at pH 12.8. After incubating at 37°C for 90 minutes, 1 mL 50% trichloroacetic acid solution was added to the mixture to stop the reaction. The remainder of H2S in the mixture was carried out via nitrogen stream by another 30 minutes of incubation at 37°C. The concentration of sulfide in the SAOB solution was measured with a sulfide-sensitive electrode Model 9616 S2−/Ag+ electrode (Orion Research, Beverly, MA). Total RNA was isolated from rat liver and from gastric tissue by using the TRIzol reagent according to manufacturer specifications (Invitrogen, Milan, Italy). RNA was processed directly to cDNA by reverse transcription with Superscript III (Invitrogen). Briefly, 2 μg RNA was added to the mixture, which contained DNase I reaction buffer 10X and 1 U DNase I. The mixture was incubated for 15 minutes at room temperature, then 1 μL EDTA 25 mmol/L solution was added, and the mixture was incubated at 95°C for 5 minutes. Four microliters of first-strand buffer 5X (250 mmol/L Tris-HCl, pH, 8.3; 375 mmol/L KCl; 15 mmol/L MgCl2) were mixed with 2 μL of DTT 0.1 mol/L, 1 μL of dNTPs mix 10 mmol/L, 0.5 μL of random primers 300 ng/μL, 1 μL of RNase out, and 1 μL of Super Script III. The mixture was incubated at room temperature for 10 minutes and at 42°C for 50 minutes, heated at 95°C for 5 minutes to inactivate the enzyme, and cooled at 4°C. All PCR primers for quantitative and qualitative PCR were designed using software PRIMER3-NEW using published sequence data from the NCBI database. Primers were synthesized by MWG BIOTECH. For rat GAPDH, the sense primer was 5′-ATGACTCTACCCACGGCAAG-3′, and the antisense was 5′-TACTCAGCACCAGCATCACC-3′; for rat CBS, the sense primer was CCAGGACTTGGAGGTACAGC, and the antisense was TCGGCACTGTGTGGTAATGT; for rat CSE, the sense primer was GTATTGAGGCACCAACAGGT, and the antisense was GTTGGGTTTGTGGGTGTTTC; for COX-1, the sense primer was 5′-CGAGGATGTCATCAAGGAG-3′, and the antisense was 5′-TCAGTGAGGCTGTGTTAACG-3′; for COX-2, the sense primer was 5′-TCAAGACAGATCAGAAGCGA-3′, and the antisense was 5′-TACCTGAGTGTCTTTGATTG-3′; for rat TNF-α, the sense primer was CCC CAT TAC TCT GAC CCC TT, and the antisense was AGG CCT GAG ACA TCT TCA GC; for ICAM-1, the sense primer was CAAACGGGAGATGAATGG, and the antisense was TGGCGGTAATAGGTGTAAAT. In control experiments with 3 replicates, no false positives were detected. Amplification reactions contained 2 μL cDNA, 12.5 μL of the 2X dynamo SYBR Green Qpcr Master Mix, and 0.75 μL of each of the specific primers. Primer concentrations in the final volume of 25 μL were 300 nmol/L. All reactions were performed in triplicate in an iCycler iQ system (Bio-Rad, Hercules, CA), and the thermal cycling conditions were as follows: 15 minutes at 95°C, followed by 40 cycles of 95°C for 10 seconds, 55°C for 10 seconds, and 72°C for 20 seconds. Tissues were quickly removed from rats and homogenized with a Teflon tissue grinder in ice-cold buffer (100 mmol/L sodium phosphate, [pH 7.8]/1 mmol/L PMSF), and sonicated. The homogenates were centrifuged at 10,900g for 5 minutes at 4°C, and the supernatants were further centrifuged at 17,400g for 20 minutes at 4°C. The resulting supernatants were quickly frozen in liquid nitrogen and stored at −80°C until use. Tissue samples were solubilized in the SDS-sample buffer, boiled for 5 minutes, separated on a 10% SDS/polyacrylamide gel, and transferred to the nitrocellulose (0.45 mm, Millipore). The CSE protein was detected with anti-CSE antibody22Nishi N. Tanabe H. Oya H. Urushihara M. Miyanaka H. Wada F. Identification of probasin-related antigen as cystathionine γ-lyase by molecular cloning.J Biol Chem. 1994; 269: 1015PubMed Google Scholar at 1:3000 dilution, followed by incubation with horseradish-peroxidase-conjugated anti-rabbit IgG secondary antibody and the ECL Western blotting system (Amersham Biosciences). CSE activity was assessed by a sensitive method recently reported by Ogasawara et al,23Ogasawara Y. Ishii K. Tanabe S. Enzymatic assay of γ-cystathionase activity using pyruvate oxidase-peroxidase sequential reaction.J Biochem Biophys Methods. 2002; 51: 139-150Crossref PubMed Scopus (14) Google Scholar with minor modifications. Briefly, CSE catalyses the pyruvate formation from b-chloro-L-alanine. This reaction is terminated by the addition of DL-propargylglycine. The produced pyruvate is oxidized by pyruvate oxidase in the presence of thiamine pyrophosphate and bivalent magnesium to liberate H2O2. A leuco dye, N-(carboxymethylamino)-4,4′-bis(dimethylamino)-diphenylamine, is oxidized by H2O2 with peroxidase to produce Bindschedler’s green. The reaction was performed in 96-well dishes, and the absorbance of green dye (727 nm) was measured by a microplate reader. The 182-bp genomic DNA fragment upstream from the transcriptional start site (−155 to +27), containing canonical TATA and CAAT boxes and the Sp1 site, was isolated by PCR from mouse hepatocyte genomic DNA.24Ishii I. Akahoshi N. Yu X.N. Kobayashi Y. Namekata K. Komaki G. Kimura H. M