Similar Structural Basis for Membrane Localization and Protein Priming by an RNA-dependent RNA Polymerase
2002; Elsevier BV; Volume: 277; Issue: 18 Linguagem: Inglês
10.1074/jbc.m112429200
ISSN1083-351X
AutoresJohn Lyle, Amy S. Clewell, K L Richmond, Oliver C. Richards, Debra A. Hope, Steve C. Schultz, Karla Kirkegaard,
Tópico(s)RNA and protein synthesis mechanisms
ResumoProtein primers are used to initiate genomic synthesis of several RNA and DNA viruses, although the structural details of the primer-polymerase interactions are not yet known. Poliovirus polymerase binds with high affinity to the membrane-bound viral protein 3AB but uridylylates only the smaller peptide 3B in vitro. Mutational analysis of the polymerase identified four surface residues on the three-dimensional structure of poliovirus polymerase whose wild-type identity is required for 3AB binding. These mutants also decreased 3B uridylylation, arguing that the binding sites for the membrane tether and the protein primer overlap. Mutation of flanking residues between the 3AB binding site and the polymerase active site specifically decreased 3B uridylylation, likely affecting steps subsequent to binding. The physical overlap of sites for protein priming and membrane association should facilitate replication initiation in the membrane-associated complex. Protein primers are used to initiate genomic synthesis of several RNA and DNA viruses, although the structural details of the primer-polymerase interactions are not yet known. Poliovirus polymerase binds with high affinity to the membrane-bound viral protein 3AB but uridylylates only the smaller peptide 3B in vitro. Mutational analysis of the polymerase identified four surface residues on the three-dimensional structure of poliovirus polymerase whose wild-type identity is required for 3AB binding. These mutants also decreased 3B uridylylation, arguing that the binding sites for the membrane tether and the protein primer overlap. Mutation of flanking residues between the 3AB binding site and the polymerase active site specifically decreased 3B uridylylation, likely affecting steps subsequent to binding. The physical overlap of sites for protein priming and membrane association should facilitate replication initiation in the membrane-associated complex. human immunodeficiency virus The replication of linear nucleic acids without loss of coding information from the ends is a problem that has been solved in several ways by cellular and viral genomes. Solutions include those used by vaccinia virus, which primes DNA replication from hairpins that can be refolded to regenerate the terminal sequences (1Baroudy B.M. Venkatesan S. Moss B. Cell. 1982; 28: 315-324Abstract Full Text PDF PubMed Scopus (193) Google Scholar, 2deLange A.M. Reddy M. Scraba D. Upton C. McFadden G. J. Virol. 1986; 59: 249-259Crossref PubMed Google Scholar), byDrosophila, which repair damaged chromosomal termini by recombination (3Biessmann H. Mason J.M. Ferry K. d'Hulst M. Vlageirdottir K. Traverse K.L. Pardue M.L. Cell. 1990; 61: 663-673Abstract Full Text PDF PubMed Scopus (200) Google Scholar), by many eukaryotic cells, which add end-specific telomeric sequences postreplicatively, and by viruses such as adenovirus and Φ29, which use protein primers that are covalently linked to the initiating nucleotides (reviewed in Ref. 4Salas M. Annu. Rev. Biochem. 1991; 60: 39-71Crossref PubMed Scopus (345) Google Scholar). For mammalian positive-strand RNA viruses such as poliovirus and hepatitis C, two mechanisms are suspected: de novo initiation (5Sun X. Johnson R. Hockman M. Wang Q. Biochem. Biophys. Res. Commun. 2000; 268: 798-803Crossref PubMed Scopus (65) Google Scholar, 6Zhong W. Uss A.S. Ferrari E. Lau J.Y. Hong Z. J. Virol. 2000; 74: 2017-2022Crossref PubMed Scopus (166) Google Scholar, 7Luo G. Hamatake R.K. Mathis D.M. Racela J. Rigat K.L. Lemm J. Colonno R.J. J. Virol. 2000; 74: 851-863Crossref PubMed Scopus (252) Google Scholar, 8Kim M.J. Zhong W. Hong Z. Kao C.C. J. Virol. 2000; 74: 10312-10322Crossref PubMed Scopus (35) Google Scholar) and protein priming (9Paul A.V. Boom J.H. Filippov D. Wimmer E. Nature. 1998; 393: 280-284Crossref PubMed Scopus (297) Google Scholar) from the genomic ends. The protein primer for the synthesis of poliovirus RNA includes, at a minimum, the 22-amino acid viral peptide 3B (also called VPg), which is found covalently linked to the 5′ ends of all newly synthesized positive and negative strands. Poliovirus translates its proteins as a single, large polyprotein that is cleaved into the proteins required for virion formation, host modification, and RNA replication. In many cases, proteolytic precursors have functions distinct from those of the limit digestion products. Evidence for the use of 3B. As a protein primer comes from in vitro experiments in which it was demonstrated that 3B is uridylylated in the presence of UTP, the poliovirus RNA-dependent RNA polymerase (3D), and an RNA template (9Paul A.V. Boom J.H. Filippov D. Wimmer E. Nature. 1998; 393: 280-284Crossref PubMed Scopus (297) Google Scholar). The RNA used to template the uridylylation of 3B can either be poly(A), poliovirus RNA, or the small cis replication enhancer RNA (10Paul A.V. Rieder E. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10359-10370Crossref PubMed Scopus (236) Google Scholar, 11Rieder E. Paul A.V. Kim D.W. van Boom J.H. Wimmer E. J. Virol. 2000; 74: 10371-10380Crossref PubMed Scopus (127) Google Scholar), an internal sequence required for RNA replication in infected cells (12Goodfellow I. Chaudhry Y. Richardson A. Meredith J. Almond J.W. Barclay W. Evans D.J. J. Virol. 2000; 74: 4590-4600Crossref PubMed Scopus (199) Google Scholar). Whether 3B itself serves as the primer within infected cells and how it is brought into the RNA replication complex are not yet known. Evidence for direct binding between polymerase and 3B was observed in the two-hybrid system (13Xiang W. Cuconati A. Hope D. Kirkegaard K. Wimmer E. J. Virol. 1998; 72: 6732-6741Crossref PubMed Google Scholar), although a stronger signal was observed between the polymerase and a larger polypeptide that contains the 3B, sequences, 3AB (13Xiang W. Cuconati A. Hope D. Kirkegaard K. Wimmer E. J. Virol. 1998; 72: 6732-6741Crossref PubMed Google Scholar, 14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar). When mutations of 3AB were tested to identify those that disrupted interactions with the poliovirus polymerase in the two-hybrid system, only those that mapped within the 3B sequences were found to be disruptive (13Xiang W. Cuconati A. Hope D. Kirkegaard K. Wimmer E. J. Virol. 1998; 72: 6732-6741Crossref PubMed Google Scholar). Therefore, it is likely that many of the direct contacts between the polymerase and 3AB are within the 3B sequence. All positive-strand RNA viruses, from picornaviruses such as poliovirus and foot and mouth disease virus to flaviviruses such as Dengue and hepatitis C virus, form their RNA replication complexes in association with cytoplasmic membranes whose identity differs for different viruses (Refs. 15Chen J. Ahlquist P.A. J. Virol. 2000; 74: 4310-4318Crossref PubMed Scopus (119) Google Scholar, 16Suhy D.A. Giddings T.H.J. Kirkegaard K. J. Virol. 2000; 74: 8158-8165Crossref Scopus (423) Google Scholar, 17Teterina N.L. Egger D. Bienz K. Brown D.M. Semler B.L. Ehrenfeld E. J. Virol. 2001; 75: 3841-3850Crossref PubMed Scopus (63) Google Scholar and the references therein). Protein 3AB contains an extended hydrophobic domain and associates with membranes both in vitro and when expressed in isolation in tissue culture cells (18Ho J.S. Towner T.V. Semler B.L. J. Biol. Chem. 1996; 271: 26810-26818Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar,19Datta U. Dasgupta A. J. Virol. 1994; 68: 4468-4477Crossref PubMed Google Scholar). Membrane-bound 3AB has been recovered from Escherichia coli expression systems and found to both stimulate the proteolytic activity of the precursor of poliovirus polymerase, 3CD (20Lama J. Paul A.V. Harris K.S. Wimmer E. J. Biol. Chem. 1994; 269: 66-70Abstract Full Text PDF PubMed Google Scholar), and recruit soluble polymerase from solution (14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar). A specific interaction between 3AB and poliovirus polymerase can also be observed with purified, detergent-solubilized 3AB, which stimulates poliovirus polymerase activity (20Lama J. Paul A.V. Harris K.S. Wimmer E. J. Biol. Chem. 1994; 269: 66-70Abstract Full Text PDF PubMed Google Scholar, 21Paul A.V. Cao X. Harris K.S. Lama J. Wimmer E. J. Biol. Chem. 1994; 269: 29173-29181Abstract Full Text PDF PubMed Google Scholar, 22Plotch S.J. Palant O. J. Virol. 1995; 69: 7169-7179Crossref PubMed Google Scholar) by stabilizing the polymerase complex with the template and primer (23Richards O.C. Ehrenfeld E. J. Biol. Chem. 1998; 273: 12832-12840Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 24Rodriguez-Wells V. Plotch S.J. DeStefano J.J. Nucleic Acids Res. 2001; 29: 2715-2724Crossref PubMed Scopus (24) Google Scholar). These data have led to a model in which membrane-associated 3AB or one of its larger precursors (25Towner J.S. Mazanet M.M. Semler B.L. J. Virol. 1998; 72: 7191-7200Crossref PubMed Google Scholar) binds directly to the soluble RNA-dependent RNA polymerase, facilitating its recruitment to the membranes upon which viral RNA replication occurs. Previously, it was shown that the V391L mutation in poliovirus polymerase confers a specific defect in the interaction of the polymerase with viral protein 3AB in the yeast two-hybrid system andin vitro (14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar). Val391 is located near motif E, a motif conserved among RNA-dependent RNA polymerases; the positions of Val391 and several motifs conserved among polymerases are shown in Fig. 1 (26Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). According to the frequently used analogy comparing polymerase structures to right hands, the "thumb" of polymerases such as HIV1 reverse transcriptase,Taq DNA polymerase, and T7 DNA polymerase binds to the double-stranded portion of the template strand, positioning the primer, the 3′-hydroxyl of the nascent strand, at the active site (reviewed in Ref. 27Jager J. Pata J.D. Curr. Opin. Struct. Biol. 1999; 9: 21-28Crossref PubMed Scopus (53) Google Scholar). The precise orientations of the template, the protein primer, and the nascent RNA strand in the poliovirus polymerase structure are not yet known. To define the 3AB binding site further and to determine whether residues in that site are important for 3B uridylylation, mutagenesis of the surface residues that surround the V391L mutation was undertaken. The ability of 14 mutant polymerases to bind to viral protein 3AB, catalyze RNA-dependent RNA polymerization, and uridylylate 3B was determined. The wild-type identities of several clustered surface residues near motif E were found to be involved in all 3AB- and 3B-mediated functions. Flanking residues appear to have additional functions in the enzymology of protein priming. Mutations were introduced into the pT5T3D plasmid, designed to express polymerase 3D in E. coli, using the QuikChange mutagenesis protocol (Stratagene, La Jolla, CA) or the megaprimer method (28Ke S.H. Madison E.L. Nucleic Acids Res. 1997; 25: 3371-3372Crossref PubMed Scopus (228) Google Scholar) with the primers described in Table I. The flanking primers for the megaprimer mutagenesis were CTGGGAGCAATAAAG and CCCAGGAGTGATAACAGGTTCAGCAGTGGG, amplifying the coding region of 3D polymerase from nucleotide 606–1348. The PCR products were cleaved with NsiI and MfeI (New England Biolabs, Beverly, MA) and inserted into similarly cleaved wild-type pT5T3D. The mutations were confirmed by sequencing.Table IIntroduced mutations in 3D polymerase, mutagenic oligonucleotides, and sources of plasmidsMutationOligonucleotide1-aIntroduced mutations are underlined. Oligonucleotides were purchased from Stanford Protein and Nucleic Acids Facilities or OPERON Technologies./source of plasmidPurified?CommentsY326ACTAAAAATGATTGCCGCGGGTGATGATG1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).YesD328A/D329ADiamond et al. (Ref.50Diamond S.E. Kirkegaard K. J. Virol. 1994; 68: 863-876Crossref PubMed Google Scholar)YesD358AGACTCCAGCTGCCAAATCAGCTAC1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).YesK359AGACTCCAGCTGACGCGTCAGCTACATTTG1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).YesE369AGTCACATGGGCCAATGTAACATTC1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).YesN370AGTCACATGGGAGGCTGTAACATTC1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).No1-dPolymerase does not purify well, may be malfolded or poorly expressed.K375AGTAACATTCTTGGCGAGATTCTTCAGG1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).YesR376AGTAACATTCTTGAAGGCATTCTTCAGGGC1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).No1-dPolymerase does not purify well, may be malfolded or poorly expressed.F377ACATTCTTGAAGAGAGCCTTCAGGGCAGACG1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).YesR379AGAGATTCTTCGCGGCAGACGAGAAATAC1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).YesDecreased solubilityR379EGAAGAGATTCTTCGAGGCAGACGAGAAATACCC1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).YesE382ACTTCAGGGCAGACGCGAAATACCC1-bMutation introduced into pT5T3D using megaprimer PCR mutagenesis (28).YesH389ACCCATTTCTTATCGCGCCAGTAATGCC1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).No1-dPolymerase does not purify well, may be malfolded or poorly expressed.V391LHope et al. (Ref.14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar)Yests in virusP393AATCCAGTAATGGCGATGAAGGAAATNo1-dPolymerase does not purify well, may be malfolded or poorly expressed.M394TBarton et al. (Ref.35Barton D.J. Morasco B.J. Eisner-Smerage L. Collis P.S. Diamond S.E. Hewlett M.J. Virology. 1996; 217: 459-469Crossref PubMed Scopus (10) Google Scholar)Yests in virusK395ACCAGTAATGCCAATGGCGGAAATTCATG1-cMutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).YesN424DBurns et al. (Ref.34Burns C.C. Richards O.C. Ehrenfeld E. J. Virol. 1992; 189: 568-582Crossref Scopus (15) Google Scholar)No1-dPolymerase does not purify well, may be malfolded or poorly expressed.ts in virusN424HBurns et al. (Ref.34Burns C.C. Richards O.C. Ehrenfeld E. J. Virol. 1992; 189: 568-582Crossref Scopus (15) Google Scholar)Yests in virusN424YBurns et al. (Ref.34Burns C.C. Richards O.C. Ehrenfeld E. J. Virol. 1992; 189: 568-582Crossref Scopus (15) Google Scholar)No1-dPolymerase does not purify well, may be malfolded or poorly expressed.ts in virus1-a Introduced mutations are underlined. Oligonucleotides were purchased from Stanford Protein and Nucleic Acids Facilities or OPERON Technologies.1-b Mutation introduced into pT5T3D using megaprimer PCR mutagenesis (28Ke S.H. Madison E.L. Nucleic Acids Res. 1997; 25: 3371-3372Crossref PubMed Scopus (228) Google Scholar).1-c Mutation introduced into pT5T3D with the oligonucleotide shown and the complementary oligonucleotide using the QuikChange site-directed mutagenesis kit (Stratagene).1-d Polymerase does not purify well, may be malfolded or poorly expressed. Open table in a new tab To construct two-hybrid bait plasmids, the 3D polymerase coding region was amplified from mutant pT5T3D using primers CCGAATTCGGTGAAATCCAGTGGATGAGA and CGGGATCCTCGAGTTACTAAAATGAGTCAAGCC, cleaved with EcoRI and BamHI, and cloned into pLex202+PL (29Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1322) Google Scholar). The appropriate sequence in all plasmids constructed using PCR was confirmed by sequencing. Wild-type and mutant poliovirus polymerases were purified as described previously (30Hobson S.D. Rosenblum E.S. Richards O.C. Richmond K. Kirkegaard K. Schultz S.C. EMBO J. 2001; 20: 1153-1163Crossref PubMed Scopus (121) Google Scholar). Activity assays were performed with 2 μm polymerase in 50 mm HEPES (pH 7.5), 0.5 mmMnCl2, 50 μm ZnSO4, 30 mm NaCl, 70 μg/ml poly(A) (200 μmnucleotide), 25 μg/ml oligod(T)16 (100 μm nucleotide), 400 μm UTP, and 1 μCi/ml [α-32P]UTP (3000 Ci/mmol; PerkinElmer Life Sciences). Reactions were incubated for 10 min on ice, incubated for 30 min at 30 °C, and spotted onto DE81 paper wetted in wash (5% dibasic sodium phosphate and 2% sodium pyrophosphate (w/v)). The paper was washed five times for 5 min in 200 ml of wash and then washed for 1 min in 200 ml of distilled H2O and 1 min in 200 ml of 95% ethanol. The paper was allowed to dry, and bound 32P was quantified using a PhosphorImager (Molecular Dynamics). For expression in the yeast two-hybrid system, the coding regions of wild-type polymerase and all mutant polymerases that were successfully expressed in E. coli were cloned into the C-terminal coding region of a lexA-encoding "bait" plasmid (29Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1322) Google Scholar). Expression of these lexA-polymerase bait proteins was comparable to that of the wild-type lexA-polymerase fusion protein (data not shown; Ref. 14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar). β-Galactosidase assays were performed as described previously (14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar) by the permeabilized cell method of Miller (31Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar). Cells were grown at 30 °C in medium containing 2% raffinose to A600 = 0.1/cm. Galactose was then added to 2% (w/v), and cells were incubated at 25 °C until they reached A600 = 0.3/cm, at which time the cells were harvested. Membranes containing 3AB were prepared basically according to the protocol of Lama et al. (20Lama J. Paul A.V. Harris K.S. Wimmer E. J. Biol. Chem. 1994; 269: 66-70Abstract Full Text PDF PubMed Google Scholar). E. coli (BL21) containing pKK3AB (20Lama J. Paul A.V. Harris K.S. Wimmer E. J. Biol. Chem. 1994; 269: 66-70Abstract Full Text PDF PubMed Google Scholar) were grown in LB with 150 μg/ml ampicillin at 37 °C toA660 = 0.5/cm. The cultures were then grown at 22 °C until they reached A660 = 0.75/cm, at which time they were induced with 0.5 μmisopropyl-1-thio-β-d-galactopyranoside. The cultures were harvested by centrifugation at 11,000 × g at 4 °C (8500 rpm in a Beckman JA-14 rotor) for 5 min. The cells were resuspended in 25 ml of ice-cold 100 mm NaCl, 50 mm Tris-HCl (pH 7.6), and 5% glycerol and harvested as described above. This wash step was repeated one additional time. The final pellet was frozen at −80 °C. The pellet was thawed and resuspended on ice in 10 ml/liter original culture of Buffer A (100 mm NaCl, 50 mm Tris-HCl (pH 7.6), 5% glycerol, 1 mm phenylmethylsulfonyl fluoride, 1 mm EDTA, 1 mm dithiothreitol, and 1× Complete Protease Inhibitor Mixture (Roche Molecular Biochemicals)). This suspension was lysed by passage through a chilled French press at 16,000 p.s.i. The lysate was precleared by centrifugation at 10,000 × gfor 40 min in a Beckman JA-20 rotor at 9000 rpm at 4 °C. The membrane fraction was collected by centrifugation at 24,000 rpm for 30 min (100,000 × g) in a Beckman SW-41Ti rotor at 4 °C. The pellet was resuspended to 12.5 mg/ml protein in Buffer A and stored at −80 °C. Control membranes were prepared identically from cells harboring the pGEM vector. Ten μl of membranes (125 μg of total protein) was mixed with 30 μl of a preparation that contained 5 μm wild-type or mutant polymerase, diluted using the buffers from the final column of the purification (100 mm NaCl, 25 mm Tris-HCl (pH 8.5), 15% glycerol, 0.5% octyl-β-glucopyranoside, 0.1 mm EDTA, 0.02% NaN3, 2 mm dithiothreitol) and glycerol to 40% and 600 mm NaCl. The reaction was incubated on ice for 1 h and then incubated at 30 °C for 20 min. The reaction was spun at 14,000 rpm (16,000 × g) at room temperature for 5 min. The supernatant was removed, and the pellet was resuspended in 100 μl of wash buffer (500 mm NaCl, 25 mm Tris-HCl (pH 8.0), and 10 mmdithiothreitol). The membranes were collected by centrifugation as described above, and the pellet was resuspended in 8 μl of 2× SDS-PAGE buffer (32Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (206977) Google Scholar), vortexed, and boiled for 4 min. The proteins were resolved on a 12.5% SDS gel (29:1, acrylamide:bis). The gel was stained with Sypro Red (Molecular Dynamics) diluted 1:5000 in 7.5% acetic acid for 30 min at room temperature with gentle rocking. The gel was destained for 30 min in 7.5% acetic acid. Staining was visualized using the Molecular Dynamics Storm in red fluorescence mode. Quantitation was performed with ImageQuant software (Molecular Dynamics). Wild-type and mutant polymerase preparations were adjusted to 20 μm polymerase, 50% glycerol, and 150 mm NaCl using the buffers from the final column of the purification and glycerol. 30 μl of solution that contained 10 μl of 75% acetonitrile and 20 μl of column buffer supplemented to 4 m NaCl was added to 100 μl of polymerase. The mixture was incubated on ice for 1 h. An aliquot (100 μl) of the mixture was dialyzed against 100 mm NaCl and 50% glycerol for 6 h. (Slide-A-Lyzer Mini Dialysis Units; Pierce). Protein concentration was then adjusted to 10 μmpolymerase with dialysis buffer. Polymerase (10 μl) was then added to 40 μl of reaction buffer to final concentrations of 50 mm HEPES (pH 7.5), 2 mm dithiothreitol, 0.5 mm MnCl2, 8% glycerol, 140 μg/ml poly(A) (400 μm/nt), 200 μm 3B (VPg), 2 μm UTP, and 10 μCi/ml [α-32P]UTP (3000 Ci/mmol; PerkinElmer Life Sciences), and the reactions were incubated at 30 °C for 30 min. The reaction was stopped by the addition of 100 μl of 2× SDS-PAGE buffer. The products were resolved on a 12% (29:1, acrylamide:bis) Tris-tricine gel. The gel was dried onto 3MM Whatman paper and analyzed by PhosphorImager (Molecular Dynamics). Quantitation was performed with ImageQuant (Molecular Dynamics). Analysis of the crystal structure of poliovirus 3D polymerase was performed using Swiss-PDB Viewer (Ref. 33Guex N. Peitsch M.S. Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9554) Google Scholar; available at www.expasy.ch/spdbv/) using coordinates from Hansenet al. (26Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). Images were rendered using POV-Ray freeware (available at www.povray.org). We predicted that if the genetic screen that identified the V391L mutation accurately identified the 3AB binding site on the poliovirus polymerase (14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar), then polymerases that contained mutations in residues adjacent to Val391should display phenotypes similar to that of the V391L polymerase. Mutations were introduced into 14 additional residues surrounding Val391, as shown on the three-dimensional structure of polymerase (26Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar) in Fig. 5A and summarized in TableI. For Asp358, Lys359, Glu369, Glu370, Lys375, Arg376, Phe377, Arg379, Glu382, His389, Pro393, and Lys395, codons that encode alanine were substituted for the wild-type codons (Table I). Mutational analyses of Asn424 (changed to Asp, His, and Tyr) and Met394 (changed to Thr) have been described previously, and the resulting viruses have been shown to be temperature-sensitive for RNA synthesis (34Burns C.C. Richards O.C. Ehrenfeld E. J. Virol. 1992; 189: 568-582Crossref Scopus (15) Google Scholar, 35Barton D.J. Morasco B.J. Eisner-Smerage L. Collis P.S. Diamond S.E. Hewlett M.J. Virology. 1996; 217: 459-469Crossref PubMed Scopus (10) Google Scholar). Therefore, the published mutations N424D, N424H, N424Y, and M394T were introduced at these positions. Because the R379A mutant polymerase exhibited decreased solubility, making it unsuitable for direct binding assays, an additional mutant polymerase, R379E, was created. Mutant polymerases D358A, K359A, E369A, K375A, F377A, R379A, R379E, E382A, V391L, M394T, K395A, and N424H were successfully expressed and purified. The effects of mutations in the putative 3AB-binding domain of poliovirus polymerase on its interactions with 3AB in the two-hybrid system are shown in Fig.2. Testing the effect of these mutations on the interaction of polymerase with known ligands in addition to 3AB provided controls for proper folding of the lexA-polymerase bait fusion protein. Those mutations that conferred a defect in polymerase binding to the 3AB "prey" but not to other preys (human Sam68 protein or other polymerase molecules) were considered to confer specific defects in 3AB binding (13Xiang W. Cuconati A. Hope D. Kirkegaard K. Wimmer E. J. Virol. 1998; 72: 6732-6741Crossref PubMed Google Scholar, 14Hope D.A. Diamond S.E. Kirkegaard K. J. Virol. 1997; 71: 9490-9498Crossref PubMed Google Scholar, 36McBride A.E. Schlegel A. Kirkegaard K. Proc. Natl. Acad. Sci. U. S. A. 1995; 93: 2296-2301Crossref Scopus (142) Google Scholar). Mutations F377A, R379A, R379E, and V391L all caused specific defects in polymerase-3AB binding (Fig. 2, first two rows). However, mutations in flanking residues D358A, K359A, E369A, E370A, K375A, E382A, M394T, K395A, and N424Y had no significant effect on the interaction of polymerase with 3AB, other polymerase molecules, or Sam68 (Fig. 2). Therefore, Phe377, Arg379, and Val391 are likely to constitute at least part of the 3AB binding site, as summarized in Fig. 5B. To test the effect of mutations on the ability of the polymerase to bind 3AB outside of the context of a fusion protein, membranes that contained 3AB were used to recruit mutant and wild-type 3D polymerases from solution. E. coli membranes were prepared from cells that did or did not express plasmid-encoded 3AB. Equivalent amounts of these membranes were used as affinity matrices to recruit soluble polymerases from solution. Whereas expression of 3AB in eukaryotic systems has been reported (19Datta U. Dasgupta A. J. Virol. 1994; 68: 4468-4477Crossref PubMed Google Scholar, 25Towner J.S. Mazanet M.M. Semler B.L. J. Virol. 1998; 72: 7191-7200Crossref PubMed Google Scholar), these expression levels are low (37Barco A. Carrasco L. Gene (Amst.). 1995; 156: 19-25Crossref PubMed Scopus (8) Google Scholar), so that obtaining sufficient quantities from these systems to perform the analyses reported here would be difficult. As shown in Fig. 3A, the presence of 3AB in the membranes allowed the recruitment from solution of wild-type polymerase (lanes 2 and 3) and E369A mutant polymerase (lanes 5 and 6). However, recruitment was significantly disturbed by the R379E mutation (lanes 8 and 9), even though equivalent amounts of all polymerases were present in the reaction mixtures (lanes 10–12). These data and similar data for other mutant polymerases are quantified in Fig. 3B, where the amounts of wild-type and mutant polymerases recruited by the 3AB-containing membranes are compared for several independent experiments. Consistent with the results of the two-hybrid experiments, mutant polymerases R379E, V391L, and F377A all displayed reduced binding to the 3AB-containing membranes. In addition, E382A mutant polymerase displayed reduced binding, whereas none of the other mutant polymerases displayed significantly reduced interactions with membrane-associated 3AB. These data are summarized on the three-dimensional structure of the polymerase in Fig. 5C. The clustering of the residues in a hydrophobic pocket on the protein surface and the lack of apparent misfolding of the mutant polymerases argue that these residues identify a site of direct 3AB binding. It is not clear whether the 3AB binding site on poliovirus polymerase identified the binding site for 3B as well. However, available evidence (see "Introduction") supports the hypothesis that important contacts for 3AB with polymerase are contained in the 3B sequences. In addition, the 3AB binding site identified by two-hybrid and membrane recruitment assays (Fig. 5,B and C) is close to the active site for phosphodiester bond formation (26Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar), making the 3AB binding site an attractive candidate for the binding of the 3B sequences during uridylylation. To determine whether mutations in the binding sites for 3AB affect 3B uridylylation, 12 different mutant polymerases whose effects on the binding of 3AB had been defined (Figs. 2 and 3) and 2 mutant polymerases that contained mutations in the active site for polymerization (Y326A and D328A/D329A) were studied. Uridylylation of 3B was quantified during the initial, linear phase of the uridylylation reaction (data not shown), therefore giving a measure of the reaction rate. As can be seen from the direct labeling of 3B by α-[32P]UTP (Fig. 4,
Referência(s)