Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Metabolic Basis of Visual Cycle Inhibition by Retinoid and Nonretinoid Compounds in the Vertebrate Retina

2008; Elsevier BV; Volume: 283; Issue: 15 Linguagem: Inglês

10.1074/jbc.m708982200

ISSN

1083-351X

Autores

Marcin Golczak, Akiko Maeda, Grzegorz Bereta, Tadao Maeda, Philip D. Kiser, Silke Hunzelmann, Johannes von Lintig, William S. Blaner, Krzysztof Palczewski,

Tópico(s)

Retinoids in leukemia and cellular processes

Resumo

In vertebrate retinal photoreceptors, the absorption of light by rhodopsin leads to photoisomerization of 11-cis-retinal to its all-trans isomer. To sustain vision, a metabolic system evolved that recycles all-trans-retinal back to 11-cis-retinal. The importance of this visual (retinoid) cycle is underscored by the fact that mutations in genes encoding visual cycle components induce a wide spectrum of diseases characterized by abnormal levels of specific retinoid cycle intermediates. In addition, intense illumination can produce retinoid cycle by-products that are toxic to the retina. Thus, inhibition of the retinoid cycle has therapeutic potential in physiological and pathological states. Four classes of inhibitors that include retinoid and nonretinoid compounds have been identified. We investigated the modes of action of these inhibitors by using purified visual cycle components and in vivo systems. We report that retinylamine was the most potent and specific inhibitor of the retinoid cycle among the tested compounds and that it targets the retinoid isomerase, RPE65. Hydrophobic primary amines like farnesylamine also showed inhibitory potency but a short duration of action, probably due to rapid metabolism. These compounds also are reactive nucleophiles with potentially high cellular toxicity. We also evaluated the role of a specific protein-mediated mechanism on retinoid cycle inhibitor uptake by the eye. Our results show that retinylamine is transported to and taken up by the eye by retinol-binding protein-independent and retinoic acid-responsive gene product 6-independent mechanisms. Finally, we provide evidence for a crucial role of lecithin: retinol acyltransferase activity in mediating tissue specific absorption and long lasting therapeutic effects of retinoid-based visual cycle inhibitors. In vertebrate retinal photoreceptors, the absorption of light by rhodopsin leads to photoisomerization of 11-cis-retinal to its all-trans isomer. To sustain vision, a metabolic system evolved that recycles all-trans-retinal back to 11-cis-retinal. The importance of this visual (retinoid) cycle is underscored by the fact that mutations in genes encoding visual cycle components induce a wide spectrum of diseases characterized by abnormal levels of specific retinoid cycle intermediates. In addition, intense illumination can produce retinoid cycle by-products that are toxic to the retina. Thus, inhibition of the retinoid cycle has therapeutic potential in physiological and pathological states. Four classes of inhibitors that include retinoid and nonretinoid compounds have been identified. We investigated the modes of action of these inhibitors by using purified visual cycle components and in vivo systems. We report that retinylamine was the most potent and specific inhibitor of the retinoid cycle among the tested compounds and that it targets the retinoid isomerase, RPE65. Hydrophobic primary amines like farnesylamine also showed inhibitory potency but a short duration of action, probably due to rapid metabolism. These compounds also are reactive nucleophiles with potentially high cellular toxicity. We also evaluated the role of a specific protein-mediated mechanism on retinoid cycle inhibitor uptake by the eye. Our results show that retinylamine is transported to and taken up by the eye by retinol-binding protein-independent and retinoic acid-responsive gene product 6-independent mechanisms. Finally, we provide evidence for a crucial role of lecithin: retinol acyltransferase activity in mediating tissue specific absorption and long lasting therapeutic effects of retinoid-based visual cycle inhibitors. In vertebrate photoreceptor cells, absorbance of light by the visual chromophore, 11-cis-retinal, coupled to rhodopsin leads to its photoisomerization to all-trans-retinal and initiation of the phototransduction signal cascade (reviewed in Ref. 1Palczewski K. Annu. Rev. Biochem. 2006; 75: 743-767Crossref PubMed Scopus (545) Google Scholar). To ensure constant vision, 11-cis-retinal is efficiently regenerated by a complex sequence of enzymatic reactions called the visual or retinoid cycle (reviewed in Refs. 2Travis G.H. Golczak M. Moise A.R. Palczewski K. Annu. Rev. Pharmacol. Toxicol. 2007; 47: 469-512Crossref PubMed Scopus (318) Google Scholar, 3McBee J.K. Palczewski K. Baehr W. Pepperberg D.R. Prog. Retin. Eye Res. 2001; 20: 469-529Crossref PubMed Scopus (315) Google Scholar, 4Lamb T.D. Pugh Jr., E.N. Prog. Retin. Eye. Res. 2004; 23: 307-380Crossref PubMed Scopus (516) Google Scholar). This pathway is located in both retinal pigment epithelium (RPE) 3The abbreviations used are:RPEretinal pigment epitheliumA2EN-retinidene-N-retinyl ethanolamineCHAPS3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonateDMFN,N-dimethylformamideGMgrowth mediumLRATlecithin:retinol acyltransferaseRAretinoic acidRBPserum retinol-binding proteinRet-NH2all-trans-retinylamineRDHretinol dehydrogenaseROSrod outer segmentsTDH(2E,6E)-N-hexadecyl-3,7,11-trimethyldodeca-2,6,10-trienamineTDT(12E,16E)-13,17,21-trimethyldocosa-12,16,20-trien-11-oneWTwild typeHPLChigh performance liquid chromatographyMES4-morpholineethanesulfonic acidbis-tris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolERGelectroretinogram.3The abbreviations used are:RPEretinal pigment epitheliumA2EN-retinidene-N-retinyl ethanolamineCHAPS3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonateDMFN,N-dimethylformamideGMgrowth mediumLRATlecithin:retinol acyltransferaseRAretinoic acidRBPserum retinol-binding proteinRet-NH2all-trans-retinylamineRDHretinol dehydrogenaseROSrod outer segmentsTDH(2E,6E)-N-hexadecyl-3,7,11-trimethyldodeca-2,6,10-trienamineTDT(12E,16E)-13,17,21-trimethyldocosa-12,16,20-trien-11-oneWTwild typeHPLChigh performance liquid chromatographyMES4-morpholineethanesulfonic acidbis-tris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolERGelectroretinogram. and photoreceptor cells. The key enzymatic step of visual chromophore regeneration is the isomerization of all-trans-retinyl palmitate and other esters to 11-cis-retinol in a reaction catalyzed by RPE65 (5Jin M. Li S. Moghrabi W.N. Sun H. Travis G.H. Cell. 2005; 122: 449-459Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar, 6Moiseyev G. Chen Y. Takahashi Y. Wu B.X. Ma J.X. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 12413-12418Crossref PubMed Scopus (402) Google Scholar, 7Redmond T.M. Poliakov E. Yu S. Tsai J.Y. Lu Z. Gentleman S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 13658-13663Crossref PubMed Scopus (322) Google Scholar).The importance of the retinoid cycle for maintaining vision is documented by the number and variety of diseases caused by mutations in genes encoding proteins involved in this process (2Travis G.H. Golczak M. Moise A.R. Palczewski K. Annu. Rev. Pharmacol. Toxicol. 2007; 47: 469-512Crossref PubMed Scopus (318) Google Scholar). Three main strategies have been developed to treat these diseases. The first uses virally mediated transfer gene technology to replace the defective gene. This approach has successfully rescued vision in mouse and dog models of Leber congenital amaurosis and retinitis pigmentosa (8Acland G.M. Aguirre G.D. Ray J. Zhang Q. Aleman T.S. Cideciyan A.V. Pearce-Kelling S.E. Anand V. Zeng Y. Maguire A.M. Jacobson S.G. Hauswirth W.W. Bennett J. Nat. Genet. 2001; 28: 92-95Crossref PubMed Scopus (1024) Google Scholar, 9Acland G.M. Aguirre G.D. Bennett J. Aleman T.S. Cideciyan A.V. Bennicelli J. Dejneka N.S. Pearce-Kelling S.E. Maguire A.M. Palczewski K. Hauswirth W.W. Jacobson S.G. Mol. Ther. 2005; 12: 1072-1082Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar, 10Jacobson S.G. Acland G.M. Aguirre G.D. Aleman T.S. Schwartz S.B. Cideciyan A.V. Zeiss C.J. Komaromy A.M. Kaushal S. Roman A.J. Windsor E.A. Sumaroka A. Pearce-Kelling S.E. Conlon T.J. Chiodo V.A. Boye S.L. Flotte T.R. Maguire A.M. Bennett J. Hauswirth W.W. Mol. Ther. 2006; 13: 1074-1084Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 11Aleman T.S. Jacobson S.G. Chico J.D. Scott M.L. Cheung A.Y. Windsor E.A. Furushima M. Redmond T.M. Bennett J. Palczewski K. Cideciyan A.V. Invest. Ophthalmol. Vis. Sci. 2004; 45: 1259-1271Crossref PubMed Scopus (85) Google Scholar, 12Jacobson S.G. Aleman T.S. Cideciyan A.V. Heon E. Golczak M. Beltran W.A. Sumaroka A. Schwartz S.B. Roman A.J. Windsor E.A. Wilson J.M. Aguirre G.D. Stone E.M. Palczewski K. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 15123-15128Crossref PubMed Scopus (118) Google Scholar, 13Batten M.L. Imanishi Y. Tu D.C. Doan T. Zhu L. Pang J. Glushakova L. Moise A.R. Baehr W. Van Gelder R.N. Hauswirth W.W. Rieke F. Palczewski K. PLoS Med. 2005; 2: 1177-1189Crossref Scopus (113) Google Scholar). The second approach involving pharmacological supplementation with the missing chromophore primarily applies to diseases characterized by deficits in retinoid biosynthesis (13Batten M.L. Imanishi Y. Tu D.C. Doan T. Zhu L. Pang J. Glushakova L. Moise A.R. Baehr W. Van Gelder R.N. Hauswirth W.W. Rieke F. Palczewski K. PLoS Med. 2005; 2: 1177-1189Crossref Scopus (113) Google Scholar, 14Van Hooser J.P. Aleman T.S. He Y.G. Cideciyan A.V. Kuksa V. Pittler S.J. Stone E.M. Jacobson S.G. Palczewski K. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8623-8628Crossref PubMed Scopus (225) Google Scholar, 15Van Hooser J.P. Liang Y. Maeda T. Kuksa V. Jang G.F. He Y.G. Rieke F. Fong H.K. Detwiler P.B. Palczewski K. J. Biol. Chem. 2002; 277: 19173-19182Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 16Rohrer B. Goletz P. Znoiko S. Ablonczy Z. Ma J.X. Redmond T.M. Crouch R.K. Invest. Ophthalmol. Vis. Sci. 2003; 44: 310-315Crossref PubMed Scopus (53) Google Scholar). The third strategy is to attenuate flux of retinoids in the eye by inhibiting specific steps in the retinoid cycle (17Radu R.A. Mata N.L. Nusinowitz S. Liu X. Sieving P.A. Travis G.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4742-4747Crossref PubMed Scopus (199) Google Scholar, 18Radu R.A. Han Y. Bui T.V. Nusinowitz S. Bok D. Lichter J. Widder K. Travis G.H. Mata N.L. Invest. Ophthalmol. Vis. Sci. 2005; 46: 4393-4401Crossref PubMed Scopus (200) Google Scholar, 19Radu R.A. Mata N.L. Bagla A. Travis G.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 5928-5933Crossref PubMed Scopus (130) Google Scholar, 20Radu R.A. Mata N.L. Nusinowitz S. Liu X. Travis G.H. Novartis Found. Symp. 2004; 255 (discussion 63–67, 177–178): 51-63Crossref PubMed Google Scholar). This approach is used for diseases associated with accumulation of toxic visual cycle by-products (e.g. lipofuscin fluorophores, such as N-retinidene-N-retinyl ethanolamine (A2E) and its derivatives) that can cause multiple forms of retinal degeneration (21Finnemann S.C. Leung L.W. Rodriguez-Boulan E. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 3842-3847Crossref PubMed Scopus (228) Google Scholar, 22De S. Sakmar T.P. J. Gen. Physiol. 2002; 120: 147-157Crossref PubMed Scopus (74) Google Scholar, 23Bergmann M. Schutt F. Holz F.G. Kopitz J. FASEB J. 2004; 18: 562-564Crossref PubMed Scopus (180) Google Scholar). Examples of diseases sharing this phenotype include age-related macular degeneration, retinitis pigmentosa, and Stargardt disease (reviewed in Ref. 2Travis G.H. Golczak M. Moise A.R. Palczewski K. Annu. Rev. Pharmacol. Toxicol. 2007; 47: 469-512Crossref PubMed Scopus (318) Google Scholar).Visual cycle inhibitors can be classified into four distinct groups based on their chemical structures. The first consists of 13-cis-retinoic acid (13-cis-RA) and the hydroxyphenyl amide of its all-trans isomer, fenretinide (Fig. 1A). These retinoid inhibitors have been used for decades in the treatment of acne and chemoprevention of cancer (24Conley B. O'Shaughnessy J. Prindiville S. Lawrence J. Chow C. Jones E. Merino M.J. Kaiser-Kupfer M.I. Caruso R.C. Podgor M. Goldspiel B. Venzon D. Danforth D. Wu S. Noone M. Goldstein J. Cowan K.H. Zujewski J. J. Clin. Oncol. 2000; 18: 275-283Crossref PubMed Google Scholar). Clinical reports showing delayed dark adaptation and night blindness upon 13-cis-RA treatment drew attention to these compounds as potential visual therapeutics (25Caffery B.E. Josephson J.E. J. Am. Optom. Assoc. 1988; 59: 221-224PubMed Google Scholar, 26Caruso R.C. Zujewski J. Iwata F. Podgor M.J. Conley B.A. Ayres L.M. Kaiser-Kupfer M.I. Arch. Ophthalmol. 1998; 116: 759-763Crossref PubMed Scopus (25) Google Scholar). 13-cis-RA was found to inhibit 11-cis-retinol dehydrogenase, which catalyzes the final enzymatic step in the visual cycle (27Gamble M.V. Mata N.L. Tsin A.T. Mertz J.R. Blaner W.S. Biochim. Biophys. Acta. 2000; 1476: 3-8Crossref PubMed Scopus (32) Google Scholar), and to bind RPE65 (28Gollapalli D.R. Rando R.R. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 10030-10035Crossref PubMed Scopus (44) Google Scholar). Fenretinide slowed the flux of retinoids into the eyes, most probably by reducing levels of vitamin A bound to serum retinol-binding protein (RBP) (17Radu R.A. Mata N.L. Nusinowitz S. Liu X. Sieving P.A. Travis G.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4742-4747Crossref PubMed Scopus (199) Google Scholar). Both compounds reduced A2E deposition in the eye (18Radu R.A. Han Y. Bui T.V. Nusinowitz S. Bok D. Lichter J. Widder K. Travis G.H. Mata N.L. Invest. Ophthalmol. Vis. Sci. 2005; 46: 4393-4401Crossref PubMed Scopus (200) Google Scholar, 19Radu R.A. Mata N.L. Bagla A. Travis G.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 5928-5933Crossref PubMed Scopus (130) Google Scholar, 20Radu R.A. Mata N.L. Nusinowitz S. Liu X. Travis G.H. Novartis Found. Symp. 2004; 255 (discussion 63–67, 177–178): 51-63Crossref PubMed Google Scholar). All-trans-retinylamine (Ret-NH2) and its derivatives (Fig. 1B) may exert similar effects. Developed as a transition state analog for the isomerization reaction, Ret-NH2 inhibits 11-cis-retinol production (29Golczak M. Kuksa V. Maeda T. Moise A.R. Palczewski K. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 8162-8167Crossref PubMed Scopus (104) Google Scholar, 30Golczak M. Imanishi Y. Kuksa V. Maeda T. Kubota R. Palczewski K. J. Biol. Chem. 2005; 280: 42263-42273Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Moreover, Ret-NH2 is reversibly N-acetylated by lecithin:retinol acyltransferase (LRAT) and stored in retinosomes within the RPE (30Golczak M. Imanishi Y. Kuksa V. Maeda T. Kubota R. Palczewski K. J. Biol. Chem. 2005; 280: 42263-42273Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 31Imanishi Y. Gerke V. Palczewski K. J. Cell Biol. 2004; 166: 447-453Crossref PubMed Scopus (85) Google Scholar, 32Imanishi Y. Batten M.L. Piston D.W. Baehr W. Palczewski K. J. Cell Biol. 2004; 164: 373-383Crossref PubMed Scopus (157) Google Scholar). This last characteristic may contribute to its efficient transport and long-lasting inhibition of the retinoid cycle in vivo. Farnesyl-containing isoprenoid derivatives, originally characterized by Rando and co-workers (33Maiti P. Kong J. Kim S.R. Sparrow J.R. Allikmets R. Rando R.R. Biochemistry. 2006; 45: 852-860Crossref PubMed Scopus (87) Google Scholar), belong to the third group of inhibitors. These are thought to act through interaction with RPE65 (Fig. 1C), although their therapeutic efficiency is retracted (34Maiti P. Kong J. Kim S. Sparrow J. Allikmets R. Rando R. Biochemistry. 2007; 46: 8700Crossref Scopus (3) Google Scholar). The last class of inhibitors is composed of nonretinoid hydrophobic primary amine with therapeutic potential. These compounds have yet to be evaluated (Fig. 1D).In the present work, we used biochemical, cell culture, and in vivo experimental approaches to compare the properties and therapeutic potential of various retinoid cycle inhibitors that might benefit retinal diseases. We evaluated inhibitory efficacy and potency, molecular targets, and modes of action in vivo and in vitro. Farnesylamine and farnesol derivatives were used to investigate the role of the amino group in inhibiting the retinoid cycle. Finally, we evaluated the role of serum RBP/STRA6 (retinoic acid-responsive gene product 6) in delivering some of these therapeutic agents to the eyes.MATERIALS AND METHODSAnimals—Rbp–/– mice were previously generated and described (35Quadro L. Blaner W.S. Salchow D.J. Vogel S. Piantedosi R. Gouras P. Freeman S. Cosma M.P. Colantuoni V. Gottesman M.E. EMBO J. 1999; 18: 4633-4644Crossref PubMed Scopus (400) Google Scholar, 36Quadro L. Hamberger L. Gottesman M.E. Wang F. Colantuoni V. Blaner W.S. Mendelsohn C.L. Endocrinology. 2005; 146: 4479-4490Crossref PubMed Scopus (106) Google Scholar), and their genotypes were confirmed by published protocols (36Quadro L. Hamberger L. Gottesman M.E. Wang F. Colantuoni V. Blaner W.S. Mendelsohn C.L. Endocrinology. 2005; 146: 4479-4490Crossref PubMed Scopus (106) Google Scholar). All mice were from a mixed C57Bl/6 × sv129 genetic background. Lrat–/– mice were generated and genotyped as described previously (55Kawaguchi R. Yu J. Honda J. Hu J. Whitelegge J. Ping P. Wiita P. Bok D. Sun H. Science. 2007; 315: 820-825Crossref PubMed Scopus (604) Google Scholar). Abca4–/– mice were generated by standard procedures (Ingenious Targeting, Inc., Rochester, NY). The targeting vector was constructed by replacing exon 1 with the neo cassette. Abca4–/– mice were maintained in a mixed background of C57BL/6 and 129Sv/Ev, and siblings with Leu residue in position 450 (Leu-450) of RPE65 were used. Genotyping of mice was done by PCR using primers ABCR1 (5′-GCCCAGTGGTCGATCTGTCTAGC-3′) and ABCR2 (5′-CGGACACAAAGGCCGCTAGGACCACG-3′) for wild type (WT) (619 bp) and A0 (5′-CCACAGCACACATCAGCATTTCTCC-3′) and N1 (5′-TGCGAGGCCAGAGGCCACTTGTGTAGC-3′) for targeted deletion (455 bp). PCR products were cloned and sequenced to verify their identity.Typically, 6-week-old mice were used for these experiments. Mice were maintained continuously in darkness, and all experimental manipulations were performed under dim red light passed through an Eastman Kodak Co. Safelight filter. All animal procedures were approved by Case Western Reserve University and conformed with recommendations of the American Veterinary Medical Association Panel on Euthanasia and the Association of Research for Vision and Ophthalmology. Fresh bovine eyes were obtained from a local slaughterhouse (Mahan's Packing, Bristolville, OH), and RPE microsomes were prepared from bovine eyecups (37Saari J.C. Bredberg D.L. Methods Enzymol. 1990; 190: 156-163Crossref PubMed Scopus (25) Google Scholar).Materials and Chemical Syntheses—13-cis-RA and all-trans-RA were purchased from Sigma and fenretinide from Toronto Research Chemicals Inc. (Toronto, Canada). (2E,6E)-N-hexadecyl-3,7,11-trimethyldodeca-2,6,10-trienamine (TDH) and (12E,16E)-13,17,21-trimethyldocosa-12,16,20-trien-11-one (TDT) were synthesized by Acucela Inc. (Bothell, WA). Ret-NH2 was synthesized as previously described (29Golczak M. Kuksa V. Maeda T. Moise A.R. Palczewski K. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 8162-8167Crossref PubMed Scopus (104) Google Scholar, 30Golczak M. Imanishi Y. Kuksa V. Maeda T. Kubota R. Palczewski K. J. Biol. Chem. 2005; 280: 42263-42273Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Farnesylamine was prepared by reacting farnesyl bromide with potassium phthalimide (38Jones T.H. Clark D.A. Heterick B.E. Snelling R.R. J. Nat. Prod. 2003; 66: 325-326Crossref PubMed Scopus (10) Google Scholar). Reaction progress was monitored by TLC. The chemical structure of farnesylamine derivatized with N,O-bis(trimethylsilyl)trifluoroacetamide in the presence of 10% of trimethylchlorosilane was validated by gas chromatography-mass spectrometry.Stable Transduction of the NIH3T3 Cell Line—An NIH3T3 stable cell line expressing LRAT and two double-stable cell lines expressing LRAT/RPE65 and LRAT/STRA6 were used. Full-length human LRAT, RPE65, and STRA6 clones used to prepare these cell lines were purchased from the American Type Culture Collection (Manassas, VA). For construction of retroviral expression vectors, LRAT, RPE65, and STRA6 cDNA were amplified by PCR, and EcoRI and NotI restriction sites were introduced at the ends of the coding sequence by using the following primers: STRA6, GCAGATGAATTCACCATGTCGTCCCAGCCAGCAGG and CGTCTAGCGGCCGCTCAGGGCTGGGCACCATTGG; LRAT, GAGGTGAATTCAGCTACTCAGGGATGAAGAACCCCATGCTG and ACTGACGCGGCCGCATGAAGTTAGCCAGCCATCCATAG; RPE65, TCTGGGAATTCAACTGGAAGAAAATGTCTATCCAGGTTGAG and CTTGCTGGCGGCCGCTCAAGATTTTTTGAACAGTCC. These primers were cloned into the pMXs-IG (STRA6 and RPE65) or pMXs-IP (LRAT) retroviral vectors provided by Dr. T. Kitamura (University of Tokyo) (39Kitamura T. Koshino Y. Shibata F. Oki T. Nakajima H. Nosaka T. Kumagai H. Exp. Hematol. 2003; 31: 1007-1014Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar). Inserts were sequenced and confirmed to be identical to LRAT, RPE65, and STRA6 reference sequences deposited in the Ensembl data base. The Phoenix-Eco retroviral producer cell line as well as the NIH3T3 cells were cultured in growth medium (GM) consisting of Dulbecco's modified Eagle's medium, pH 7.2, with 4 mm l-glutamine, 4,500 mg/liter glucose, and 110 mg/liter sodium pyruvate, supplemented with 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 units/ml streptomycin. Cells were maintained at 37 °C in 5% CO2. Twenty-four hours prior to transfection, 2.5 × 106 Phoenix-Eco cells were seeded on a 6-cm plate and cultured in 6 ml of GM. To generate a transfection mixture, 1 ml of 50 mm HEPES, pH 7.05, containing 10 mm KCl, 12 mm dextrose, 280 mm NaCl, and 1.5 mm Na2HPO4 was added to an equal volume of 250 mm CaCl2 solution containing 20 μg of plasmid DNA, mixed, incubated for 1 min, and added dropwise to the cells. This medium was replaced with fresh GM 8 h after transfection and replaced again 24 h later. The retroviral supernatant was harvested 48 h post-transfection, centrifuged at 1,500 rpm for 5 min to remove detached cells, aliquoted into 0.5-ml portions, frozen in liquid nitrogen, and stored at –80 °C. 24 h prior to transduction, 2 × 105 NIH3T3 fibroblasts were plated per 6-cm dish in 6 ml of GM. For transduction, this medium was replaced with a mixture consisting of 2.5 ml of GM (the one just collected, not fresh GM), 0.5 ml of viral supernatant, and 5 μg/ml Polybrene. The plate was gently swirled and incubated for 24 h at 30 °C in 5% CO2 before replacing the medium with fresh GM. After reaching confluence, cells were split and seeded at 2 × 105. This infection cycle was repeated 2–4 times.LRAT, Retinol Dehydrogenase (RDH), and Enzymatic Isomerization Assays—The LRAT activity assay was carried out in 10 mm Tris/HCl buffer, pH 7.5, containing 1% bovine serum albumin (final volume 200 μl). All-trans-retinol was delivered in 0.8 μlof N,N-dimethylformamide (DMF) to a final concentration of 10 μm, and the reaction was initiated by the addition of bovine RPE microsomes (150 μg of protein). Reaction mixtures were incubated at 30 °C for 10 min, stopped by injecting 300 μl of methanol, and mixed with the same volume of hexane. Retinoids were extracted and analyzed on a Hewlett Packard 1100 series HPLC system equipped with a diode array detector and a normal phase column (Agilent-Si; 5 μm, 4.5 × 250 mm) eluted with 10% ethyl acetate in hexane at a flow rate of 1.4 ml/min.Activities of RDH in bovine rod outer segments (ROS) and RPE microsomes were assayed by monitoring retinol production (reduction of retinal). Each reaction mixture (200 μl) contained 50 mm MES, pH 5.5, 1 mm dithiothreitol, 200 μg of UV-treated RPE microsomes or ROS, the test substrate, and a reducing agent (NADH or NADPH). For RDH5, the reaction was initiated by the addition of 11-cis-retinal (2 μm) followed by 60 μm NADH. To detect RDH activity in ROS, NADPH (60 μm) was added first, and the samples were exposed to a single flash of light from an electronic flash (40Palczewski K. Jager S. Buczylko J. Crouch R.K. Bredberg D.L. Hofmann K.P. Asson-Batres M.A. Saari J.C. Biochemistry. 1994; 33: 13741-13750Crossref PubMed Scopus (133) Google Scholar). Reaction mixtures were incubated at 37 °C for 20 min and terminated with 300 μlof methanol, and retinoids were extracted with 300 μl of hexane. The upper phase was removed and dried using a SpeedVac. The residue was dissolved in 200 μl of hexane, and 100 μl of this solution was analyzed by HPLC as described above.Isomerase assays were performed as previously described (41Stecher H. Gelb M.H. Saari J.C. Palczewski K. J. Biol. Chem. 1999; 274: 8577-8585Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 42Stecher H. Palczewski K. Methods Enzymol. 2000; 316: 330-344Crossref PubMed Google Scholar) with a few modifications. Reactions were carried out in 10 mm Tris/HCl buffer, pH 7.5, 1% bovine serum albumin, containing 1 mm ATP and 6 μm apo-cellular retinaldehyde-binding protein. Inhibition by test compounds was assessed by preincubating UV-treated RPE microsomes for 5 min at 37 °C with test compound delivered in 1 μl of DMF before the addition of apo-cellular retinaldehyde-binding protein and all-trans-retinol (10 μm). The same volume of DMF was added to control reactions. Experiments were performed three times in duplicates. For isomerization reaction assays in cell culture, NIH3T3 cells expressing LRAT and RPE65 were cultured in 6-well culture plates at a density of 1 × 106 cells/well for 20 h before each experiment. GM was removed, and 2 ml of fresh GM containing 10 μm all-trans-retinol and 3 μm test compound were added. Cells and medium were collected after 16 h of incubation. Samples were treated with 2 ml of methanol, homogenized, and saponified with 1 m KOH at 37 °C for 2 h prior to extraction with hexane. The resulting hexane phase was collected, dried using a SpeedVac, and redissolved in 250 μl of hexane, and retinoid composition was determined by normal phase HPLC as described above.Inhibitor Administration and Extraction/Analysis of Retinoids from Mouse Eyes—Typically, all compounds tested in mice were delivered in 50 μl of tissue culture grade dimethylsulfoxide by intraperitoneal injection. Procedures related to the analysis of dissected mouse eyes, derivatization of retinals with hydroxylamine, and separation of retinoids have been described (14Van Hooser J.P. Aleman T.S. He Y.G. Cideciyan A.V. Kuksa V. Pittler S.J. Stone E.M. Jacobson S.G. Palczewski K. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8623-8628Crossref PubMed Scopus (225) Google Scholar). Typically, two mice were used per assay, and assays were repeated three times.Expression and Purification of Human RPE65—Full-length human RPE65 containing a C-terminal 1D4 tag was cloned into the pFastBac HT A plasmid, and the resulting construct was used to produce baculovirus according to the manufacturer's instructions (Invitrogen Bac-to-Bac handbook). For protein expression, 50 ml of high titer P3 baculovirus was added to 600 ml of cultured Sf9 cells at a density of 2 × 106 cells/ml, and the cells were shaken at 27 °C. After 36–48 h, cells were harvested by centrifugation and resuspended in 10 ml of PBS, pH 7.4, containing one dissolved tablet of EDTA-free complete protease inhibitors (Roche Applied Science). Cell suspensions were flash-frozen in liquid nitrogen and stored at –80 °C. Suspensions were thawed with 40 ml of 20 mm bis-tris-propane, pH 7.0, containing 150 mm NaCl, 10 mm 2-mercaptoethanol, 5% glycerol, 2 mm CHAPS, and one dissolved tablet of EDTA-free protease inhibitors (Roche Applied Science). Cells were disrupted by Dounce homogenization, and lysates were centrifuged at 145,000 × g for 30 min. The supernatant was collected, diluted 2-fold with lysis buffer, and loaded onto a 3-ml Talon resin (Clontech) column equilibrated with lysis buffer. The column was washed with 30 column volumes of 20 mm BTP, pH 7.0, 500 mm NaCl, 10 mm 2-mercaptoethanol, 5% glycerol, 2 mm CHAPS, and 5 mm imidazole. Protein was eluted with a buffer consisting of 20 mm BTP, pH 7.0, 150 mm NaCl, 10 mm 2-mercaptoethanol, 5% glycerol, 2 mm CHAPS, and 150 mm imidazole, pH 7.0. Protein-containing fractions were pooled, TEV protease (43Kapust R.B. Tozser J. Fox J.D. Anderson D.E. Cherry S. Copeland T.D. Waugh D.S. Protein Eng. 2001; 14: 993-1000Crossref PubMed Scopus (623) Google Scholar) was added at a concentration of 3% (w/w) (based on protein concentration), and mixtures were incubated at 4 °C for ∼14 h to remove the N-terminal His6 tag, and protein was purified further on a Superdex 200 gel filtration column. Fractions containing RPE65 were identified by immunoblotting. RPE65 preparations were >99% pure after gel filtration chromatography based on Coomassie- and silver-stained SDS-PAGE.Tissue Extraction of Ret-NH2 and N-Retinylamides—Mouse liver (1 g) was homogenized in 10 ml of 50 mm Tris/HCl buffer, pH 9.0, and 10 ml of methanol. The retinoids were extracted with 20 ml of hexane. The organic phase containing retinoids was collected, dried down in a SpeedVac, and resuspended in 0.5 ml of 20% ethyl acetate/hexane containing 0.5% ammonia in methanol. N-Retinylamides were separated on a normal phase HPLC column (Agilent-Si; 5 μm, 4.5 × 250 mm) by a solution of 20% ethyl acetate in hexane at a flow rate of 2 ml/min, whereas Ret-NH2 was eluted with 100% ethyl acetate in the presence of 0.5% ammonia in methanol at a flow rate of 2.5 ml/min.Mouse A2E Analysis—Two whole mouse eyes were homogenized and extracted twice in 1.0 ml of CH3CN with a glass-glass homogenizer and dried using a SpeedVac. The residue was redissolved in 120 μl of 80% CH3CN in H2O with 0.1% trifluoroacetic acid, and 100 μl was analyzed by reverse phase HPLC with a C18 column (4.6 × 250 mm, 5 μm, Phenomenex, Torrance, CA) developed with a linear gradient of CH3CN (0–100%) in H2O with the addition of 0.1% trifluoroacetic acid at a 1.5 ml/min flow rate. Quantification of A2E and iso-A2E was performed by comparison

Referência(s)