Specific Kv1.3 blockade modulates key cholesterol-metabolism-associated molecules in human macrophages exposed to ox-LDL
2012; Elsevier BV; Volume: 54; Issue: 1 Linguagem: Inglês
10.1194/jlr.m023846
ISSN1539-7262
AutoresYong Yang, Yanfu Wang, Xiaofang Yang, Zhaohui Wang, Yi-tian Lian, Yongqiang Yang, Xiaowei Li, Xiang Gao, Jian Chen, Yan-Wen Shu, Longxian Cheng, Yuhua Liao, Kun Liu,
Tópico(s)Atherosclerosis and Cardiovascular Diseases
ResumoCholesterol-metabolism-associated molecules, including scavenger receptor class A (SR-A), lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1), CD36, ACAT1, ABCA1, ABCG1, and scavenger receptor class B type I, can modulate cholesterol metabolism in the transformation from macrophages to foam cells. Voltage-gated potassium channel Kv1.3 has increasingly been demonstrated to play an important role in the modulation of macrophage function. Here, we investigate the role of Kv1.3 in modulating cholesterol-metabolism-associated molecules in human acute monocytic leukemia cell-derived macrophages (THP-1 macrophages) and human monocyte-derived macrophages exposed to oxidized LDL (ox-LDL). Human Kv1.3 and Kv1.5 channels (hKv1.3 and hKv1.5) are expressed in macrophages and form a heteromultimeric channel. The hKv1.3-E314 antibody that we had generated as a specific hKv1.3 blocker inhibited outward delayed rectifier potassium currents, whereas the hKv1.5-E313 antibody that we had generated as a specific hKv1.5 blocker failed. Accordingly, the hKv1.3-E314 antibody reduced percentage of cholesterol ester and enhanced apoA-I-mediated cholesterol efflux in THP-1 macrophages and human monocyte-derived macrophages exposed to ox-LDL. The hKv1.3-E314 antibody downregulated SR-A, LOX-1, and ACAT1 expression and upregulated ABCA1 expression in THP-1 macrophages and human monocyte-derived macrophages. Our results reveal that specific Kv1.3 blockade represents a novel strategy modulating cholesterol metabolism in macrophages, which benefits the treatment of atherosclerotic lesions. Cholesterol-metabolism-associated molecules, including scavenger receptor class A (SR-A), lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1), CD36, ACAT1, ABCA1, ABCG1, and scavenger receptor class B type I, can modulate cholesterol metabolism in the transformation from macrophages to foam cells. Voltage-gated potassium channel Kv1.3 has increasingly been demonstrated to play an important role in the modulation of macrophage function. Here, we investigate the role of Kv1.3 in modulating cholesterol-metabolism-associated molecules in human acute monocytic leukemia cell-derived macrophages (THP-1 macrophages) and human monocyte-derived macrophages exposed to oxidized LDL (ox-LDL). Human Kv1.3 and Kv1.5 channels (hKv1.3 and hKv1.5) are expressed in macrophages and form a heteromultimeric channel. The hKv1.3-E314 antibody that we had generated as a specific hKv1.3 blocker inhibited outward delayed rectifier potassium currents, whereas the hKv1.5-E313 antibody that we had generated as a specific hKv1.5 blocker failed. Accordingly, the hKv1.3-E314 antibody reduced percentage of cholesterol ester and enhanced apoA-I-mediated cholesterol efflux in THP-1 macrophages and human monocyte-derived macrophages exposed to ox-LDL. The hKv1.3-E314 antibody downregulated SR-A, LOX-1, and ACAT1 expression and upregulated ABCA1 expression in THP-1 macrophages and human monocyte-derived macrophages. Our results reveal that specific Kv1.3 blockade represents a novel strategy modulating cholesterol metabolism in macrophages, which benefits the treatment of atherosclerotic lesions. cholesterol ester free cholesterol human monocyte-derived macrophage lectin-like oxidized low-density lipoprotein receptor-1 oil red O oxidized LDL scavenger receptor class A scavenger receptor class B type I total cholesterol Atherosclerosis contributes chiefly to ischemic diseases, including coronary heart disease, cerebral infarction, and intermittent claudication. Lipid plaque is the main pathological presentation and is characterized by abundant foam cells, which are derived mostly from macrophages. In the transformation, cholesterol ester accumulation accelerates foam cell formation. Macrophages possess an entrance-to-exit machinery for the modulation of cholesterol metabolism. Scavenger receptor class A (SR-A), CD36, and lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) are largely responsible for cholesterol influx (1Rensen P.C. Gras J.C. Lindfors E.K. van Dijk K.W. Jukema J.W. van Berkel T.J. Biessen E.A. Selective targeting of liposomes to macrophages using a ligand with high affinity for the macrophage scavenger receptor class A.Curr. Drug Discov. Technol. 2006; 3: 135-144Crossref PubMed Scopus (27) Google Scholar–8Mehta J.L. Chen J. Hermonat P.L. Romeo F. Novelli G. Lectin-like, oxidized low-density lipoprotein receptor-1 (LOX-1): a critical player in the development of atherosclerosis and related disorders.Cardiovasc. Res. 2006; 69: 36-45Crossref PubMed Scopus (386) Google Scholar), and ABCA1, ABCG1 and scavenger receptor class B type I (SR-B I) facilitate cholesterol efflux (9Mauldin J.P. Nagelin M.H. Wojcik A.J. Srinivasan S. Skaflen M.D. Ayers C.R. McNamara C.A. Hedrick C.C. Reduced expression of ATP-binding cassette transporter G1 increases cholesterol accumulation in macrophages of patients with type 2 diabetes mellitus.Circulation. 2008; 117: 2785-2792Crossref PubMed Scopus (100) Google Scholar–15Braun A. Trigatti B.L. Post M.J. Sato K. Simons M. Edelberg J.M. Rosenberg R.D. Schrenzel M. Krieger M. Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice.Circ. Res. 2002; 90: 270-276Crossref PubMed Scopus (425) Google Scholar). Free cholesterol inside macrophages is esterified by ACAT1, thereby promoting cholesterol ester accumulation (16Kusunoki J. Hansoty D.K. Aragane K. Fallon J.T. Badimon J.J. Fisher E.A. Acyl-CoA:cholesterol acyltransferase inhibition reduces atherosclerosis in apolipoprotein E-deficient mice.Circulation. 2001; 103: 2604-2609Crossref PubMed Scopus (100) Google Scholar–18Yoshinaka Y. Shibata H. Kobayashi H. Kuriyama H. Shibuya K. Tanabe S. Watanabe T. Miyazaki A. A selective ACAT-1 inhibitor, K-604, stimulates collagen production in cultured smooth muscle cells and alters plaque phenotype in apolipoprotein E-knockout mice.Atherosclerosis. 2010; 213: 85-91Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). All the molecules form an integrated modulating system or network to maintain cellular cholesterol homeostasis in macrophages. It is clinic-promising to modulate the expression of these cholesterol-metabolism-associated molecules in macrophages. In recent years, voltage-gated potassium channel Kv1.3 has increasingly been demonstrated to play a crucial role in controlling macrophage proliferation, activation, apoptosis (19Vicente R. Escalada A. Coma M. Fuster G. Sanchez-Tillo E. Lopez-Iglesias C. Soler C. Solsona C. Celada A. Felipe A. Differential voltage-dependent K+ channel responses during proliferation and activation in macrophages.J. Biol. Chem. 2003; 278: 46307-46320Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar–21Dallaporta B. Marchetti P. de Pablo M.A. Maisse C. Duc H.T. Metivier D. Zamzami N. Geuskens M. Kroemer G. Plasma membrane potential in thymocyte apoptosis.J. Immunol. 1999; 162: 6534-6542PubMed Google Scholar), and inflammatory cytokine secretion (22Price M. Lee S.C. Deutsch C. Charybdotoxin inhibits proliferation and interleukin 2 production in human peripheral blood lymphocytes.Proc. Natl. Acad. Sci. USA. 1989; 86: 10171-10175Crossref PubMed Scopus (178) Google Scholar–24Beeton C. Pennington M.W. Wulff H. Singh S. Nugent D. Crossley G. Khaytin I. Calabresi P.A. Chen C.Y. Gutman G.A. et al.Targeting effector memory T cells with a selective peptide inhibitor of Kv1.3 channels for therapy of autoimmune diseases.Mol. Pharmacol. 2005; 67: 1369-1381Crossref PubMed Scopus (215) Google Scholar). Notwithstanding preliminary evidence of selective Kv1.3 blockade by rMargatoxin, one selective Kv1.3 blocker, inhibited human monocytes derived macrophages differentiation into foam cells (25Lei X.J. Ma A.Q. Xi Y.T. Zhang W. Yao Y. Du Y. Inhibitory effects of blocking voltage-dependent potassium channel 1.3 on human monocyte-derived macrophage differentiation into foam cells.Beijing Da Xue Xue Bao. 2006; 38: 257-261PubMed Google Scholar), it remains uncertain whether Kv1.3 blockage modulates the cholesterol-metabolism-associated molecules in macrophages. This unraveling would hold a potential target for atherosclerosis therapy. To address the role of Kv1.3 in modulating the expression of SR-A, CD36, LOX-1, ACAT1, SR-B I, ABCG1, and ABCA1, we used the hKv1.3-E314 antibody as a novel and specific Kv1.3 blocker (26Yang X.F. Yang Y. Lian Y.T. Wang Z.H. Li X.W. Cheng L.X. Liu J.P. Wang Y.F. Gao X. Liao Y.H. et al.The antibody targeting the e314 Peptide of human kv1.3 pore region serves as a novel, potent and specific channel blocker.PLoS ONE. 2012; 7: e36379Crossref PubMed Scopus (18) Google Scholar) that we generated to block Kv1.3 channels in THP-1 macrophages and human monocyte-derived macrophages (HMDMs) exposed to oxidized LDL (ox-LDL), which are typically established cell models mimicking the formation of foam cells (27Auwerx J. The human leukemia cell line, THP-1: a multifacetted model for the study of monocyte-macrophage differentiation.Experientia. 1991; 47: 22-31Crossref PubMed Scopus (658) Google Scholar, 28Fogelman A.M. Shechter I. Seager J. Hokom M. Child J.S. Edwards P.A. Malondialdehyde alteration of low density lipoproteins leads to cholesteryl ester accumulation in human monocyte-macrophages.Proc. Natl. Acad. Sci. USA. 1980; 77: 2214-2218Crossref PubMed Scopus (696) Google Scholar). Our experiment involving fresh plasma and peripheral blood mononuclear cells of normolipidemic volunteers was approved by volunteers and Wuhan Blood Centre (authorizations: 2010-8) and conformed to the Declaration of Helsinki. The antibody targeting the E314 peptide of human Kv1.3 pore region (named the hKv1.3-E314 antibody; China Patent Application Number of the E314 peptide: 201110044416.x) was previously generated and used as a specific blocker of hKv1.3 channels (26Yang X.F. Yang Y. Lian Y.T. Wang Z.H. Li X.W. Cheng L.X. Liu J.P. Wang Y.F. Gao X. Liao Y.H. et al.The antibody targeting the e314 Peptide of human kv1.3 pore region serves as a novel, potent and specific channel blocker.PLoS ONE. 2012; 7: e36379Crossref PubMed Scopus (18) Google Scholar). In addition, we generated the antibody targeting the E313 peptide of human Kv1.5 pore region (named the hKv1.5-E313 antibody; China Patent Application Number of the E313 peptide: 201110293643.6) as a specific blocker of hKv1.5 channels following the same strategy as described previously (29Xu S.Z. Zeng F. Lei M. Li J. Gao B. Xiong C. Sivaprasadarao A. Beech D.J. Generation of functional ion-channel tools by E3 targeting.Nat. Biotechnol. 2005; 23: 1289-1293Crossref PubMed Scopus (109) Google Scholar–31Panyi G. Possani L.D. Rodriguez de la Vega R.C. Gaspar R. Varga Z. K+ channel blockers: novel tools to inhibit T cell activation leading to specific immunosuppression.Curr. Pharm. Des. 2006; 12: 2199-2220Crossref PubMed Scopus (90) Google Scholar). Native LDLs (densities ranging from 1.006 to 1.063 g/ml) were isolated from fresh plasma of normolipidemic volunteers by sequential preparative ultracentrifugation according to published standard protocols (32Wang Y.F. Yang X.F. Cheng B. Mei C.L. Li Q.X. Xiao H. Zeng Q.T. Liao Y.H. Liu K. Protective effect of Astragalus polysaccharides on ATP binding cassette transporter A1 in THP-1 derived foam cells exposed to tumor necrosis factor-alpha.Phytother. Res. 2010; 24: 393-398Crossref PubMed Scopus (41) Google Scholar). Then LDLs were oxidized with 10 μM CuSO4 to obtain ox-LDL. THP-1 cells were purchased from American Type Culture Collection (ATCC) and maintained in RPMI 1640 medium supplemented with 10% FBS at 37°C. To induce monocyte-to-macrophage differentiation, THP-1 cells were cultured in the presence of 160 nM phorbol 12-myristate 13-acetate for 72 h. Peripheral blood mononuclear cells were isolated from peripheral blood samples of normal volunteers by Ficoll density gradient centrifugation and cultured in RPMI 1640 medium with 10% FBS at 37°C in 5% CO2 for 7 days to induce differentiation into HMDMs. After differentiation, THP-1 macrophages or HMDMs were exposed to 100 μg/ml ox-LDL in the presence of the hKv1.3-E314 antibody at varying concentrations of 37.5, 75, or 300 nM for 2 h. THP-1 macrophages or HMDMs were exposed to 100 μg/ml ox-LDL for 24 h to accelerate foam cell formation with less toxicity or apoptosis (33Tian L. Luo N. Zhu X. Chung B.H. Garvey W.T. Fu Y. Adiponectin-AdipoR1/2-APPL1 signaling axis suppresses human foam cell formation: differential ability of AdipoR1 and AdipoR2 to regulate inflammatory cytokine responses.Atherosclerosis. 2012; 221: 66-75Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 34Yao S. Sang H. Song G. Yang N. Liu Q. Zhang Y. Jiao P. Zong C. Qin S. Quercetin protects macrophages from oxidized low-density lipoprotein-induced apoptosis by inhibiting the endoplasmic reticulum stress-C/EBP homologous protein pathway.Exp. Biol. Med. (Maywood). 2012; 237: 822-831Crossref PubMed Scopus (33) Google Scholar). Meanwhile, to observe the action of the hKv1.3-E314 antibody during the transformation, THP-1 macrophages or HMDMs were exposed to 100 μg/ml ox-LDL for up to 36 or 48 h in the presence of the 300 nM hKv1.3-E314 antibody. In the experiments, THP-1 macrophages and HMDMs exposed to the hKv1.3-E314 antibody alone and 100 μg/ml ox-LDL alone were cultured for 24 h. THP-1 macrophages were fixed and blocked with a solution containing 1% BSA and 10% goat serum (Invitrogen, Carlsbad, CA). Fixed cells were incubated with the hKv1.3-E314 antibody or the hKv1.5-E313 antibody and then with the FITC-conjugated secondary anti-rabbit goat antibody (Alomone, Israel). Nuclear chromatin was stained with DAPI (eBioscience, San Diego, CA). Negative control was prepared by the primary antibody preincubated with an excess of corresponding antigenic peptides. Cell samples were imaged with a Nikon A1si confocal laser microscope (Nikon, Tokyo, Japan). THP-1-derived macrophages preincubated with various concentrations of the hKv1.3-E314 antibody were plated onto glass coverlids for measuring whole cell currents using the patch clamp technique. An Axon-200B (Molecular Devices) amplifier with pClamp 9.0 software was used for data recording and analysis. Patch electrodes (filled resistance 2–5 MΩ) were fabricated in a P-97 puller (Sutter Instruments) from borosilicate glass (outer diameter 1.5 mm and inner diameter 1.05 mm; VitalSense Instruments, Wuhan, China) and filled with solution containing (in mM) 20 KCl, 110 K-aspartate, 1 MgCl2, 10 HEPES, 5 EGTA, 0.1 Na2-GTP, 5 Na2-phosphocreatine, and 5 Mg-ATP, adjusted to pH 7.2 with KOH. The extracellular solution contained (in mM) 120 NaCl, 5.4 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, and 10 D-glucose, adjusted to pH 7.4 with NaOH. Cells were counterstained with hematoxylin and oil red O (ORO) following the routine procedure. Cells with a lipid droplet area no less than the width of the nucleus were designated ORO positive (ORO+). The ORO+ cells were counted (35Wada Y. Sugiyama A. Yamamoto T. Naito M. Noguchi N. Yokoyama S. Tsujita M. Kawabe Y. Kobayashi M. Izumi A. et al.Lipid accumulation in smooth muscle cells under LDL loading is independent of LDL receptor pathway and enhanced by hypoxic conditions.Arterioscler. Thromb. Vasc. Biol. 2002; 22: 1712-1719Crossref PubMed Scopus (39) Google Scholar). HPLC was conducted as follows. Briefly, cells were sonicated and lysed before triglycerides and proteins were eliminated from cell lysates. Dissolved in a solution of n-hexane and isopropanol (4:1, V/V), free cholesterol (FC) was extracted. One aliquot sample was treated with cholesterol esterase to obtain total cholesterol (TC). Samples were dried through a vacuum degasser and dissolved in a mobile phase containing isopropanol:n-heptane:acetonitrile (35:12:52, v/v). TC and FC were measured by a chromatographer system (VARIAN Prostar 210). Cholesterol ester (CE) was calculated through the subduction of FC from TC. Percentage of cholesterol efflux was measured by liquid scintillation counting. Treated THP-1 macrophages or HMDMs were labeled with 1.0 μCi/ml [3H]cholesterol. ApoA-I (10 μg/ml), HDL2 (50 μg/ml), or HDL3 (50 μg/ml) was also added to media. The percentage of cholesterol efflux was calculated by dividing media-derived radioactivity by the sum of the radioactivity in media and cells: [media counts/ (media counts + cellular counts)] × 100%. Total cellular RNA was isolated, and cDNA was synthesized by reverse transcription reaction. Real-time quantitative PCR was performed with SYBR® Premix Ex TaqTM (Takara, Japan) using Applied Biosystems StepOne Realtime PCR System. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control. Fold changes in mRNA expression level normalized to GAPDH were calculated by the comparative Ct method formula 2−ΔΔCt. The sequences of the PCR primers are listed in Table 1.TABLE 1Sequences of Real-Time Quantitative RT-PCRMoleculesSequence (5′–3′)SR-A senseGCAGTTCTCATCCCTCTCATSR-A anti-senseGGTATTCTCTTGGATTTTGCCLOX-1 senseCGGCAACAAGCAGAAGAAGCLOX-1 anti-senseTGAGCCCGAGGAAAATAGGTAACD36 senseTGCCTCTCCAGTTGAAAACCCCD36 anti-senseGCAACAAACATCACCACACCAACAT1 senseTGGGCAATGGAGTCTTACTCTGCTACAT1 anti-senseAAACAGCTGGCTCCAAATCAGGGAABCA1 senseTACAGCCAGAAAGACACCAGABCA1 anti-senseCACAGTAGACTTTGGGAGAGABCG1 senseCAGGAAGATTAGACACTGTGGABCG1 anti-senseGAAAGGGGAATGGAGAGAAGASR-B I senseAACAACTCCGACTCTGGGCTCTSR-B I anti-senseCATTTGCCCAGAAGTTCCATTGGAPDH senseATGGTGGTGAAGACGCCAGTAGAPDH anti-senseGGCACAGTCAAGGCTGAG AATG Open table in a new tab Total protein extracts were prepared and subjected to Western blotting analysis. After SDS-PAGE, proteins were transferred onto nitrocellulose membrane and detected by the corresponding primary antibodies against human Kv1.3 (commercially from Abcam, Cambridge, UK, or the hKv1.3-E314 antibody), Kv1.5 (commercially from Millipore/Chemicon, Billerica, MA, or the hKv1.5-E313 antibody), SR-A (Santa Cruz Biotechnology, Santa Cruz, CA), LOX-1 (R&D, Minneapolis, MN), CD36 (Santa Cruz Biotechnology), ACAT1 (Cayman, Ann Arbor, MI), ABCA1 (Abcam), ABCG1 (Epitomics, Burlingame, CA) and SR-B I (Epitomics), and GAPDH (Beyotime, China), and the following HRP-conjugated secondary antibodies. The proteins were visualized with the Enhance chemiluminescence kit (Thermo, Rockford, IL). Semiquantitative analysis of film was performed with the Image-pro Plus analysis software. All data are presented as the means ± SEM. SPSS 13.0 software was used for statistical analysis. Direct comparisons between two groups were made using unpaired t-test. Data from more than two groups were available for ANOVA. P < 0.05 was considered as statistically significant. hKv1.3 and hKv1.5 expression in THP-1 macrophages and THP-1 derived foam cells were detected by Western blotting using the commercial antibodies (supplementary Fig. I). At the protein level, both channels were identified in THP-1 macrophages and THP-1-derived foam cells. In the transformation from macrophages to foam cells, hKv1.3 or hKv1.5 expression showed no significant difference. By Western blotting and immunofluorescent staining, we confirmed specificity and plasma membrane binding of both the antibodies (the hKv1.3-E314 antibody and the hKv1.5-E313 antibody) that we had generated in THP-1 macrophages. The hKv1.3-E314 antibody or the hKv1.5-E313 antibody, respectively, recognized 64 kDa or 75 kDa protein, whereas both the antibodies preincubated with corresponding antigenic peptides were unable to recognize identical molecular weight proteins (supplementary Fig. IIA, B). Immunofluorescent staining results indicated that only plasma membrane was stained with green fluorescence in THP-1 macrophages (supplementary Fig. IIC, D). The effect of the hKv1.3-E314 antibody or the hKv1.5-E313 antibody on outward delayed rectifier potassium currents in THP-1 macrophages was examined by the whole-cell patch clamp technique. THP-1 macrophages were exposed to the hKv1.3-E314 antibody or the hKv1.5-E313 antibody 37°C for 2 h before the patch clamp experiment. To evoke voltage-dependent potassium currents, all cells were clamped to a holding potential of −80 mV and stimulated with 400-ms square pulses ranging from −60 to +60 mV in 10-mV increments (supplementary Fig. IIIA). The hKv1.3-E314 antibody at varying concentrations of 37.5, 75, or 300 nM decreased current densities significantly compared with control. The inhibition showed concentration dependence (supplementary Fig. IIIA). At the depolarizing pulse +60 mV, the hKv1.3-E314 antibody at concentrations ranging from 37.5 nM to 300 nM decreased current densities by 44%, 56%, or 85% (8.4474 ± 0.9329 pA/pF, 6.6156 ± 0.6049 pA/pF, 2.3365 ± 0.3514 pA/pF, vs. 15.1561 ± 1.4485 pA/pF) (supplementary Fig. IIIB). In contrast, the hKv1.5-E313 antibody at a concentration of 300 nM, which was identical to the hKv1.3-E314 antibody, exerted no significant effect on outward delayed rectifier potassium currents in THP-1 macrophages (supplementary Fig. IIIC, D). We had a direct-viewing of cholesterol content in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL in the presence or absence of the hKv1.3-E314 antibody by ORO staining. When THP-1 macrophages and HMDMs were exposed to 100 μg/ml ox-LDL, lipid droplets increased (Fig. 1C, K). In the presence of the 300 nM hKv1.3-E314 antibody, lipid droplets in THP-1 macrophages and HMDMs decreased markedly (Fig. 1D, L). The amount of ORO+ cells increased when THP-1 macrophages and HMDMs were exposed to 100 μg/ml ox-LDL(Fig. 1G, O), and the amount decreased significantly in the presence of the 300 nM hKv1.3-E314 antibody (Fig. 1H, P, Q). By HPLC, TC, FC, and CE in treated THP-1 macrophages and HMDMs were quantified. In THP-1 macrophages and HMDMs, there were significant decreases of TC and CE in the presence of the hKv1.3-E314 antibody in a concentration-dependent manner, compared with the absence of the hKv1.3-E314 antibody. Increases of FC were also observed in the presence of the hKv1.3-E314 antibody, whereas TC decreased. The homeostasis of FC, TC, and CE did not alter with ox-LDL exposure times ranging from 24 h to 48 h (Table 2).TABLE 2Effect of the hKv1.3-E314 antibody on TC, FC, and CE in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDLE314 Ab (nM)0300037.575300300300Exposure time inox-LDL (h)——242424243648TC (mg/dl) THP-1226.3 ± 9.5226.0 ± 15.5488.7 ± 15.0445.0 ± 13.3*426.3 ± 9.8**298.3 ± 7.4**316.3 ± 13.0**306.3 ± 11.0** HMDM165.3 ± 27.5177.3 ± 15.5277.7 ± 33.3232.7 ± 24.1*209.6 ± 20.4*188.3 ± 19.9*226.3 ± 33.5*209.9 ± 31.9*FC (mg/dl) THP-1182.0 ± 10.1178.7 ± 13.3188.7 ± 11.3230.0 ± 7.2*263.3 ± 11.9**223.0 ± 7.5*234.0 ± 4.4**232.0 ± 11.4* HMDM106.5 ± 25.8119.4 ± 13.3106.4 ± 19.3115.8 ± 19.5121.2 ± 21.9*129.7 ± 7.5*138.1 ± 21.3*140.6 ± 30.1*CE (mg/dl) THP-144.3 ± 1.247.3 ± 2.7300.0 ± 9.6215.0 ± 12.0**163.0 ± 3.8**75.3 ± 5.0**82.3 ± 8.7**74.3 ± 4.5** HMDM58.8 ± 11.157.9 ± 12.8171.3 ± 24.6116.9 ± 29.7*88.4 ± 13.9**58.6 ± 15.0**88.2 ± 18.2**69.3 ± 23.7**Percentage of CE and FC in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL in the absence (macrophages and macrophages exposed to 100 μg/ml ox-LDL or the 300 nM hKv1.3-E314 antibody alone) or presence of the hKv1.3-E314 antibody at a varying concentrations of 37.5, 75, or 300 nM. In the presence of the 300 nM hKv1.3-E314 antibody, macrophages were exposed to 100 μg/ml ox-LDL, respectively, for 24, 36, or 48 h. HPLC was performed to determine TC, FC, and CE. Data represent the means ± SEM of three independent experiments (n = 3). *P > 0.05, **P < 0.01 versus macrophages exposed to 100 μg/ml ox-LDL alone. There was no significant difference in percentage of cholesterol ester when macrophages were exposed to 100 μg/ml ox-LDL for 24, 36, or 48 h in the presence of the 300 nM hKv1.3-E314 antibody. Open table in a new tab Percentage of CE and FC in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL in the absence (macrophages and macrophages exposed to 100 μg/ml ox-LDL or the 300 nM hKv1.3-E314 antibody alone) or presence of the hKv1.3-E314 antibody at a varying concentrations of 37.5, 75, or 300 nM. In the presence of the 300 nM hKv1.3-E314 antibody, macrophages were exposed to 100 μg/ml ox-LDL, respectively, for 24, 36, or 48 h. HPLC was performed to determine TC, FC, and CE. Data represent the means ± SEM of three independent experiments (n = 3). *P > 0.05, **P < 0.01 versus macrophages exposed to 100 μg/ml ox-LDL alone. There was no significant difference in percentage of cholesterol ester when macrophages were exposed to 100 μg/ml ox-LDL for 24, 36, or 48 h in the presence of the 300 nM hKv1.3-E314 antibody. With CE and FC alterations, there were significant enhancements of apoA-I-mediated [3H]cholesterol efflux in THP-1 macrophages and HMDMs (Fig. 2A, C), whereas there was no significant alteration of mature HDL(HDL2 or HDL3)-mediated [3H]cholesterol efflux (Fig. 2B, D). The enhancement showed a concentration-dependent manner and did not change with ox-LDL exposure time from 24 h to 48 h (Fig. 2A, C). By real-time PCR and Western blotting, we assayed the mRNA and protein level of cholesterol-metabolism-associated molecules in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL in the absence or presence of the hKv1.3-E314 antibody, which include SR-A, CD36, LOX-1, ACAT1, ABCA1, ABCG1, and SR-B I. Some of these molecules were downregulated or upregulated. Compared with SR-A and LOX-1 expression levels in THP-1 macrophages or HMDMs exposed to 100 μg/ml ox-LDL alone, which were elevated in THP-1 macrophages and in HMDMs, the mRNA and protein levels of SR-A and LOX-1 were downregulated in the presence of the hKv1.3-E314 antibody in a concentration-dependent manner. The SR-A and LOX-1 expressions did not change with ox-LDL exposure time ranging from 24 h to 48 h. The mRNA and protein level of CD36 were elevated in HMDMs but not in THP-1 macrophages. There was no significant alteration of CD36 expression level in cells preincubated with various concentrations of the hKv1.3-E314 antibody (Fig. 3). The hKv1.3-E314 antibody also downregulated, in a concentration-dependent manner, ACAT1 expression in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL. The ACAT1 expression did not alter with ox-LDL exposure time ranging from 24 h to 48 h (Fig. 4). Of all the molecules mediating cholesterol efflux, including ABCA1, ABCG1, and SR-B I, only ABCA1 expression was upregulated in THP-1 macrophages and HMDMs exposed to 100 μg/ml ox-LDL in the absence or presence of the hKv1.3-E314 antibody in a concentration-dependent manner. In line with ABCA1 mRNA level, ABCA1 protein level was significantly elevated compared with its level in THP-1 macrophages exposed to 100 μg/ml ox-LDL alone. The hKv1.3-E314 antibody at a varying concentration caused a 1.5- to 3-fold increase in THP-1 macrophages and a 1.3 to 3.1-fold increase in HMDMs. And the ABCA1 expression did not alter with ox-LDL exposure time ranging from 24 h to 48 h (Fig. 5). Our study confirms that blockade of Kv1.3 prevents foam cell formation. We have, using a novel antibody-based approach, provided the first evidence for some of the molecular changes that contribute to this effect. Outward delayed rectifier potassium currents are elicited and elevated when membranes are depolarized accompanied by macrophage activation (19Vicente R. Escalada A. Coma M. Fuster G. Sanchez-Tillo E. Lopez-Iglesias C. Soler C. Solsona C. Celada A. Felipe A. Differential voltage-dependent K+ channel responses during proliferation and activation in macrophages.J. Biol. Chem. 2003; 278: 46307-46320Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 36Vicente R. Escalada A. Soler C. Grande M. Celada A. Tamkun M.M. Solsona C. Felipe A. Pattern of Kv beta subunit expression in macrophages depends upon proliferation and the mode of activation.J. Immunol. 2005; 174: 4736-4744Crossref PubMed Scopus (49) Google Scholar). The currents were long thought to be carried by the Kv1.3 channel (19Vicente R. Escalada A. Coma M. Fuster G. Sanchez-Tillo E. Lopez-Iglesias C. Soler C. Solsona C. Celada A. Felipe A. Differential voltage-dependent K+ channel responses during proliferation and activation in macrophages.J. Biol. Chem. 2003; 278: 46307-46320Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 20Mackenzie A.B. Chirakkal H. North R.A. Kv1.3 potassium channels in human alveolar macrophages.Am. J. Physiol. Lung Cell Mol. Physiol. 2003; 285: L862-L868Crossref PubMed Scopus (50) Google Scholar). However, in recent years, the Kv1.3 and Kv1.5 channels have been identified, forming a heteromultimeric complex in mouse macrophages (37Vicente R. Villalonga N. Calvo M. Escalada A. Solsona C. Soler C. Tamkun M.M. Felipe A. Kv1.5 association modifies Kv1.3 traffic and membrane localization.J. Biol. Chem. 2008; 283: 8756-8764Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar–39Vicente R. Escalada A. Villalonga N. Texido L. Roura-Ferrer M. Martin-Satue M. Lopez-Iglesias C. Soler C. Solsona C. Tamkun M.M. et al.Association of Kv1.5 and Kv1.3 contributes to the major voltage-dependent K+ channel in macrophages.J. Biol. Chem. 2006; 281: 37675-37685Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Herein our data provide supportive evidence that the complex is present in THP-1 macrophages. Owing to the homogeneous structural features of the entire voltage-gated potassium channel superfamily and the conservation of drug-binding sites of the Kv1.3 and Kv1.5 channels (40Wulff H. Beeton C. Chandy K.G. Potassium channels as therapeutic targets for autoimmune disorders.Curr. Opin. Drug Discov.
Referência(s)