Junctional Adhesion Molecule A Promotes Epithelial Tight Junction Assembly to Augment Lung Barrier Function
2014; Elsevier BV; Volume: 185; Issue: 2 Linguagem: Inglês
10.1016/j.ajpath.2014.10.010
ISSN1525-2191
AutoresLeslie A. Mitchell, Chris Ward, Mike Kwon, Patrick O. Mitchell, David Quintero, Asma Nusrat, Charles A. Parkos, Michael Koval,
Tópico(s)Neuroscience of respiration and sleep
ResumoEpithelial barrier function is maintained by tight junction proteins that control paracellular fluid flux. Among these proteins is junctional adhesion molecule A (JAM-A), an Ig fold transmembrane protein. To assess JAM-A function in the lung, we depleted JAM-A in primary alveolar epithelial cells using shRNA. In cultured cells, loss of JAM-A caused an approximately 30% decrease in transepithelial resistance, decreased expression of the tight junction scaffold protein zonula occludens 1, and disrupted junctional localization of the structural transmembrane protein claudin-18. Consistent with findings in other organs, loss of JAM-A decreased β1 integrin expression and impaired filamentous actin formation. Using a model of mild systemic endoxotemia induced by i.p. injection of lipopolysaccharide, we report that JAM-A−/− mice showed increased susceptibility to pulmonary edema. On injury, the enhanced susceptibility of JAM-A−/− mice to edema correlated with increased, transient disruption of claudin-18, zonula occludens 1, and zonula occludens 2 localization to lung tight junctions in situ along with a delay in up-regulation of claudin-4. In contrast, wild-type mice showed no change in lung tight junction morphologic features in response to mild systemic endotoxemia. These findings support a key role of JAM-A in promoting tight junction homeostasis and lung barrier function by coordinating interactions among claudins, the tight junction scaffold, and the cytoskeleton. Epithelial barrier function is maintained by tight junction proteins that control paracellular fluid flux. Among these proteins is junctional adhesion molecule A (JAM-A), an Ig fold transmembrane protein. To assess JAM-A function in the lung, we depleted JAM-A in primary alveolar epithelial cells using shRNA. In cultured cells, loss of JAM-A caused an approximately 30% decrease in transepithelial resistance, decreased expression of the tight junction scaffold protein zonula occludens 1, and disrupted junctional localization of the structural transmembrane protein claudin-18. Consistent with findings in other organs, loss of JAM-A decreased β1 integrin expression and impaired filamentous actin formation. Using a model of mild systemic endoxotemia induced by i.p. injection of lipopolysaccharide, we report that JAM-A−/− mice showed increased susceptibility to pulmonary edema. On injury, the enhanced susceptibility of JAM-A−/− mice to edema correlated with increased, transient disruption of claudin-18, zonula occludens 1, and zonula occludens 2 localization to lung tight junctions in situ along with a delay in up-regulation of claudin-4. In contrast, wild-type mice showed no change in lung tight junction morphologic features in response to mild systemic endotoxemia. These findings support a key role of JAM-A in promoting tight junction homeostasis and lung barrier function by coordinating interactions among claudins, the tight junction scaffold, and the cytoskeleton. To support efficient gas exchange, the lung must maintain a barrier between the atmosphere and fluid-filled tissues. Without this crucial barrier, the air spaces would flood, and gas exchange would be severely limited.1Matthay M.A. Zemans R.L. The acute respiratory distress syndrome: pathogenesis and treatment.Annu Rev Pathol. 2011; 6: 147-163Crossref PubMed Scopus (795) Google Scholar, 2Ware L.B. Matthay M.A. The acute respiratory distress syndrome.N Engl J Med. 2000; 342: 1334-1349Crossref PubMed Scopus (4611) Google Scholar In acute lung injury and acute respiratory distress syndrome, fluid leakage into the lung air space is associated with increased patient mortality and morbidity.3Rubenfeld G.D. Caldwell E. Peabody E. Weaver J. Martin D.P. Neff M. Stern E.J. Hudson L.D. Incidence and outcomes of acute lung injury.N Engl J Med. 2005; 353: 1685-1693Crossref PubMed Scopus (2973) Google Scholar, 4Ware L.B. Matthay M.A. Alveolar fluid clearance is impaired in the majority of patients with acute lung injury and the acute respiratory distress syndrome.Am J Respir Crit Care Med. 2001; 163: 1376-1383Crossref PubMed Scopus (758) Google Scholar Lung fluid clearance is maintained, in part, by tight junctions that regulate paracellular flux between cells.5Wilson T.A. Anafi R.C. Hubmayr R.D. Mechanics of edematous lungs.J Appl Physiol (1985). 2001; 90: 2088-2093PubMed Google Scholar, 6Pittet J.F. Griffiths M.J. Geiser T. Kaminski N. Dalton S.L. Huang X. Brown L.A. Gotwals P.J. Koteliansky V.E. Matthay M.A. Sheppard D. TGF-beta is a critical mediator of acute lung injury.J Clin Invest. 2001; 107: 1537-1544Crossref PubMed Scopus (418) Google Scholar, 7Bechara R.I. Brown L.A. Roman J. Joshi P.C. Guidot D.M. Transforming growth factor beta1 expression and activation is increased in the alcoholic rat lung.Am J Respir Crit Care Med. 2004; 170: 188-194Crossref PubMed Google Scholar Tight junctions are multiprotein complexes located at sites of cell-cell contact and are composed of transmembrane, cytosolic, and cytoskeletal proteins that together produce a selective barrier to water, ions, and soluble molecules. Among the transmembrane proteins required for epithelial barrier function is the Ig superfamily protein junctional adhesion molecule A (JAM-A).8Vogelmann R. Amieva M.R. Falkow S. Nelson W.J. Breaking into the epithelial apical-junctional complex: news from pathogen hackers.Curr Opin Cell Biol. 2004; 16: 86-93Crossref PubMed Scopus (53) Google Scholar, 9Weber C. Fraemohs L. Dejana E. The role of junctional adhesion molecules in vascular inflammation.Nat Rev Immunol. 2007; 7: 467-477Crossref PubMed Scopus (413) Google Scholar, 10Mandell K.J. Parkos C.A. The JAM family of proteins.Adv Drug Deliv Rev. 2005; 57: 857-867Crossref PubMed Scopus (177) Google Scholar, 11Severson E.A. Parkos C.A. Structural determinants of Junctional Adhesion Molecule A (JAM-A) function and mechanisms of intracellular signaling.Curr Opin Cell Biol. 2009; 21: 701-707Crossref PubMed Scopus (49) Google Scholar JAM-A is ubiquitously expressed and regulates several processes related to cell-cell and cell-matrix interactions, including cell migration and proliferation in addition to barrier function regulation. Specific mechanistic roles for JAM-A in regulating tight junctions continue to be elucidated. JAM-A signaling is stimulated by cis-dimerization, which provides a platform for multiple proteins to cluster in close apposition.12Severson E.A. Jiang L. Ivanov A.I. Mandell K.J. Nusrat A. Parkos C.A. Cis-dimerization mediates function of junctional adhesion molecule A.Mol Biol Cell. 2008; 19: 1862-1872Crossref PubMed Scopus (63) Google Scholar In particular, JAM-A has been shown to recruit scaffold proteins, such as zonula occludens 1 (ZO-1), ZO-2, and Par3, to tight junctions, where these proteins enhance the assembly of multiprotein junctional complexes.13Itoh M. Sasaki H. Furuse M. Ozaki H. Kita T. Tsukita S. Junctional adhesion molecule (JAM) binds to PAR-3: a possible mechanism for the recruitment of PAR-3 to tight junctions.J Cell Biol. 2001; 154: 491-497Crossref PubMed Scopus (326) Google Scholar, 14Bazzoni G. Martinez-Estrada O.M. Orsenigo F. Cordenonsi M. Citi S. Dejana E. Interaction of junctional adhesion molecule with the tight junction components ZO-1, cingulin, and occludin.J Biol Chem. 2000; 275: 20520-20526Crossref PubMed Scopus (388) Google Scholar More recently, it was demonstrated that JAM-A directly interacts with ZO-2, which then recruits other scaffold proteins, including ZO-1.15Monteiro A.C. Sumagin R. Rankin C.R. Leoni G. Mina M.J. Reiter D.M. Stehle T. Dermody T.S. Schaefer S.A. Hall R.A. Nusrat A. Parkos C.A. JAM-A associates with ZO-2, Afadin and PDZ-GEF1 to activate Rap2c and regulate epithelial barrier function.Mol Biol Cell. 2013; 24: 2849-2860Crossref PubMed Scopus (97) Google Scholar This nucleates a core complex that includes afadin, PDZ-GEF1, and Rap2c and that stabilizes filamentous actin by repressing rhoA.15Monteiro A.C. Sumagin R. Rankin C.R. Leoni G. Mina M.J. Reiter D.M. Stehle T. Dermody T.S. Schaefer S.A. Hall R.A. Nusrat A. Parkos C.A. JAM-A associates with ZO-2, Afadin and PDZ-GEF1 to activate Rap2c and regulate epithelial barrier function.Mol Biol Cell. 2013; 24: 2849-2860Crossref PubMed Scopus (97) Google Scholar Together, all of these activities of JAM-A promote tight junction formation and barrier function. Although JAM-A is part of the tight junction complex, the main structural determinants of the paracellular barrier are proteins known as claudins. Claudins are a family of transmembrane proteins that interact to form paracellular channels that either promote or limit paracellular ion and water flux.16Angelow S. Ahlstrom R. Yu A.S. Biology of claudins.Am J Physiol Renal Physiol. 2008; 295: F867-F876Crossref PubMed Scopus (268) Google Scholar, 17Koval M. Claudin heterogeneity and control of lung tight junctions.Annu Rev Physiol. 2012; 75: 551-567Crossref PubMed Scopus (111) Google Scholar, 18Furuse M. Tsukita S. Claudins in occluding junctions of humans and flies.Trends Cell Biol. 2006; 16: 181-188Abstract Full Text Full Text PDF PubMed Scopus (471) Google Scholar Claudins that promote flux are known collectively as pore-forming claudins, whereas claudins that limit flux are known as sealing claudins.19Krause G. Winkler L. Mueller S.L. Haseloff R.F. Piontek J. Blasig I.E. Structure and function of claudins.Biochim Biophys Acta. 2008; 1778: 631-645Crossref PubMed Scopus (627) Google Scholar In fact, there is a link between JAM-A and claudin expression because it was demonstrated that JAM-A–deficient intestinal epithelium has increased expression of two pore-forming claudins, claudin-10 and claudin-15.20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar Critically, increased claudin-10 and claudin-15 leads to a compromised intestinal barrier, as demonstrated by an enhanced susceptibility of JAM-A−/− mice to dextran sulfate sodium–induced colitis.20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar However, it is not known whether this relationship between JAM-A and claudin expression occurs in other classes of epithelia. Several claudins are expressed by the alveolar epithelium. The most prominent alveolar claudins are claudin-3, claudin-4, and claudin-18; several additional claudins are expressed by alveolar epithelium and throughout the lung as well.21Soini Y. Claudins in lung diseases.Respir Res. 2011; 12: 70Crossref PubMed Scopus (87) Google Scholar, 22Ohta H. Chiba S. Ebina M. Furuse M. Nukiwa T. Altered expression of tight junction molecules in alveolar septa in lung injury and fibrosis.Am J Physiol Lung Cell Mol Physiol. 2012; 302: L193-L205Crossref PubMed Scopus (98) Google Scholar A central role for claudin-18 in regulating lung barrier function was demonstrated in two independently derived strains of claudin-18–deficient mice that showed altered alveolar tight junction morphologic features and increased paracellular permeability.23Lafemina M.J. Sutherland K.M. Bentley T. Gonzales L.W. Allen L. Chapin C.J. Rokkam D. Sweerus K.A. Dobbs L.G. Ballard P.L. Frank J.A. Claudin-18 deficiency results in alveolar barrier dysfunction and impaired alveologenesis in mice.Am J Respir Cell Mol Biol. 2014; 51: 550-558Crossref PubMed Scopus (77) Google Scholar, 24Li G. Flodby P. Luo J. Kage H. Sipos A. Gao D. Ji Y. Beard L.L. Marconett C.N. Demaio L. Kim Y.H. Kim K.J. Laird-Offringa I.A. Minoo P. Liebler J.M. Zhou B. Crandall E.D. Borok Z. Knockout mice reveal key roles for claudin 18 in alveolar barrier properties and fluid homeostasis.Am J Respir Cell Mol Biol. 2014; 51: 210-222Crossref PubMed Scopus (214) Google Scholar Claudin-4 also is an important part of the lung response to acute lung injury because it improves barrier function by limiting alveolar epithelial permeability and promoting lung fluid clearance.25Mitchell L.A. Overgaard C.E. Ward C. Margulies S.S. Koval M. Differential effects of claudin-3 and claudin-4 on alveolar epithelial barrier function.Am J Physiol Lung Cell Mol Physiol. 2011; 301: L40-L49Crossref PubMed Scopus (86) Google Scholar, 26Wray C. Mao Y. Pan J. Chandrasena A. Piasta F. Frank J.A. Claudin 4 augments alveolar epithelial barrier function and is induced in acute lung injury.Am J Physiol Lung Cell Mol Physiol. 2009; 297: L219-L227Crossref PubMed Scopus (139) Google Scholar Although claudin-4–deficient mice show a relatively mild baseline phenotype, these mice have impaired fluid clearance in response to ventilator-induced lung injury.27Kage H. Flodby P. Gao D. Kim Y.H. Marconett C.N. DeMaio L. Kim K.J. Crandall E.D. Borok Z. Claudin 4 knockout mice: normal physiologic phenotype with increased susceptibility to lung injury.Am J Physiol Lung Cell Mol Physiol. 2014; 307: L524-L536Crossref PubMed Scopus (66) Google Scholar An analysis of ex vivo perfused human donor lungs revealed that increased claudin-4 was linked to increased rates of alveolar fluid clearance and decreased physiologic respiratory impairment,28Rokkam D. Lafemina M.J. Lee J.W. Matthay M.A. Frank J.A. Claudin-4 levels are associated with intact alveolar fluid clearance in human lungs.Am J Pathol. 2011; 179: 1081-1087Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar further underscoring the importance of claudin regulation in promoting efficient barrier function in response to injury. Although JAM-A has a clear role in regulating gut permeability,20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar a recent report that wild-type and JAM-A−/− mice show comparable levels of pulmonary edema in response to intratracheal endotoxin challenge29Lakshmi S.P. Reddy A.T. Naik M.U. Naik U.P. Reddy R.C. Effects of JAM-A deficiency or blocking antibodies on neutrophil migration and lung injury in a murine model of ALI.Am J Physiol Lung Cell Mol Physiol. 2012; 303: L758-L766Crossref PubMed Scopus (38) Google Scholar raises questions about potential roles for JAM-A in lung barrier function. Herein we used a combination of in vivo and in vitro approaches to assess the contributions of JAM-A to alveolar barrier function. Using a model of mild systemic endotoxemia induced by i.p. injection of Escherichia coli–derived lipopolysaccharide (LPS), we found that JAM-A−/− mice showed greater lung edema than comparably treated wild-type mice. Greater sensitivity to injury was due to aberrant regulation of tight junction protein expression, which was recapitulated by JAM-A–depleted alveolar epithelial cells. JAM-A depletion also resulted in decreased β1 integrin protein levels and disrupted cytoskeletal assembly. Together, these effects indicated that the loss of JAM-A impaired tight junction formation, thus rendering the lung more susceptible to edema and injury. Unless otherwise specified, materials were from Sigma-Aldrich (St. Louis, MO). Anti–JAM-A, claudin-3, claudin-4, claudin-5, claudin-7, claudin-10, claudin-15, claudin-18, occludin, ZO-1, ZO-1 actin, and β1 integrin were from Life Technologies (Grand Island, NY). E-cadherin antibodies were from Cell Signaling Technology Inc. (Danvers, MA). Minimally cross-reactive fluorescent and horseradish peroxidase secondary antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA). The animal protocols were reviewed and authorized by the Institutional Animal Care and Use Committee of Emory University (Atlanta, GA). Sprague-Dawley rat type II alveolar epithelial cells were isolated from lungs lavaged and perfused with elastase as described elsewhere,30Dobbs L.G. Gonzalez R. Williams M.C. An improved method for isolating type II cells in high yield and purity.Am Rev Respir Dis. 1986; 134: 141-145PubMed Google Scholar with modifications.31Abraham V. Chou M.L. DeBolt K.M. Koval M. Phenotypic control of gap junctional communication by cultured alveolar epithelial cells.Am J Physiol. 1999; 276: L825-L834PubMed Google Scholar Preparations routinely contained >90% to 95% type II alveolar epithelial cells. Freshly isolated cells were cultured in Eagle's minimal essential medium (Life Technologies, Rockville, MD) containing 10% fetal bovine serum, 25 μg/mL gentamicin, and 0.25 μg/mL amphotericin B (Life Technologies) in Transwells coated with rat tail type I collagen (Roche Diagnostics GmbH, Mannheim, Germany) at 7.5 × 105 cells/mL, as described elsewhere.32Koval M. Ward C. Findley M.K. Roser-Page S. Helms M.N. Roman J. Extracellular matrix influences alveolar epithelial claudin expression and barrier function.Am J Respir Cell Mol Biol. 2010; 42: 172-180Crossref PubMed Scopus (57) Google Scholar Transepithelial resistance of cells in medium cultured on permeable supports was measured using an ohmmeter (World Precision Instruments, Sarasota, FL), as previously described.33Wang F. Daugherty B. Keise L.L. Wei Z. Foley J.P. Savani R.C. Koval M. Heterogeneity of claudin expression by alveolar epithelial cells.Am J Respir Cell Mol Biol. 2003; 29: 62-70Crossref PubMed Scopus (129) Google Scholar, 34Daugherty B.L. Mateescu M. Patel A.S. Wade K. Kimura S. Gonzales L.W. Guttentag S. Ballard P.L. Koval M. Developmental regulation of claudin localization by fetal alveolar epithelial cells.Am J Physiol Lung Cell Mol Physiol. 2004; 287: L1266-L1273Crossref PubMed Scopus (84) Google Scholar Lentiviral shRNA shuttle vector pFH1+U6-UG-W was modified from pFH1UGW35Fasano C.A. Dimos J.T. Ivanova N.B. Lowry N. Lemischka I.R. Temple S. shRNA knockdown of Bmi-1 reveals a critical role for p21-Rb pathway in NSC self-renewal during development.Cell Stem Cell. 2007; 1: 87-99Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar using standard molecular techniques to include the H1 and U6 promoters to drive shRNA production (Table 1). Lentiviral particles were produced by the Emory Neuroscience National Institute of Neurological Disorders and Stroke Viral Vector Core Facility. For shRNA knockdown, freshly isolated rat alveolar epithelial cells were cultured, with lentiviral vector constructs added to the apical and basal sides, and were incubated for 24 hours, followed by a medium change. Lentiviral titers were adjusted to maximize JAM-A repression and cell viability.Table 1shRNA Constructs Used in This StudyJAM-A shRNA1616–624 Sense5′-(NheI)CCCCGCCTTCATCAATTCTTCATTTCAAGAGAATGAAGAATTGATGAAGGC TTTTTGG(PacI)-3′ Antisense5′-(PacI)CCAAAAAGCCTTCATCAATTCTTCATTCTCTTGAAATGAAGAATTGATGAAGGC GGGG(NheI)-3′JAM-A shRNA21594–1612 Sense5′-(NheI)CCCCGTGGCTGTTAGTCACTTCATTCAAGAGATGAAGTGACTAACAGCCACTTTTTGG(PacI) -3′ Antisense5′-(PacI)CCAAAAAGTGGCTGTTAGTCACTTCATCTCTTGAATGAAGTGACTAACAGCCACGGGG(NheI)-3′Scrambled Sense5′-(NheI)CCCCAGTCATTGACGACAGCGTATTCAAGAGATACGCTGTCGTCAATGACTTTTTTGG(PacI)-3′ Antisense5′-(PacI)CCAAAAAAGTCATTGACGACAGCGTATCTCTTGAATACGCTGTCGTCAATGACTGGGG(NheI)-3′ Open table in a new tab After 6 days in culture, cells on permeable supports were harvested and lyzed in 2× sample buffer containing 50 mmol/L dithiothreitol, resolved by SDS-PAGE, transferred to Immobilon membranes (Millipore, Billerica, MA), and blotted using primary antibodies and horseradish peroxidase–conjugated goat anti-rabbit IgG or goat anti-mouse IgG. Specific signals corresponding to a given protein were detected by immunoblot analysis using enhanced chemiluminescence reagent (GE Healthcare, Pittsburgh, PA) and were quantified using Image Lab software version 2.0.1, build 18 (Bio-Rad Laboratories, Hercules, CA). Normalization for protein content was performed using parallel samples analyzed for actin. Statistical significance was determined by Student's t-test or analysis of variance as appropriate. Immunofluorescence staining was performed as described elsewhere.33Wang F. Daugherty B. Keise L.L. Wei Z. Foley J.P. Savani R.C. Koval M. Heterogeneity of claudin expression by alveolar epithelial cells.Am J Respir Cell Mol Biol. 2003; 29: 62-70Crossref PubMed Scopus (129) Google Scholar, 34Daugherty B.L. Mateescu M. Patel A.S. Wade K. Kimura S. Gonzales L.W. Guttentag S. Ballard P.L. Koval M. Developmental regulation of claudin localization by fetal alveolar epithelial cells.Am J Physiol Lung Cell Mol Physiol. 2004; 287: L1266-L1273Crossref PubMed Scopus (84) Google Scholar After 6 days in culture, the cells were washed with phosphate-buffered saline (PBS) three times, fixed in methanol/acetone 1:1 for 2 minutes at room temperature, and washed three times with PBS, once with PBS + 0.5% Triton X-100 (Roche Diagnostics GmbH), and then once with PBS + 0.5% Triton X-100 + 2% normal goat serum. Cells were incubated with primary anti-rabbit and/or anti-mouse antibodies in PBS + 2% normal goat serum for 1 hour, washed, incubated with Cy2-conjugated goat anti-rabbit IgG and Cy3-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories) in PBS + 2% normal goat serum, washed, and then mounted in Mowiol medium (Kuraray America Inc., Houston, TX) under a glass coverslip. Cells were imaged by phase-contrast and fluorescence microscopy using an Olympus IX70 microscope with a U-MWIBA filter pack (BP460–490, DM505, BA515–550) or a U-MNG filter pack (BP530–550, DM570, BA590–800+) or by confocal immunofluorescence microscopy using an Olympus Fluoview FV1000 system (Olympus America Inc., Center Valley, PA). Minimum and maximum intensity were adjusted for images in parallel so that the intensity scale remained linear to maximize dynamic range. The mice used consisted of C57BL/6 (wild-type) mice (The Jackson Laboratory, Bar Harbor, ME) or JAM-A−/− mice36Cera M.R. Del Prete A. Vecchi A. Corada M. Martin-Padura I. Motoike T. Tonetti P. Bazzoni G. Vermi W. Gentili F. Bernasconi S. Sato T.N. Mantovani A. Dejana E. Increased DC trafficking to lymph nodes and contact hypersensitivity in junctional adhesion molecule-A-deficient mice.J Clin Invest. 2004; 114: 729-738Crossref PubMed Scopus (148) Google Scholar backcrossed onto C57BL/6 for seven generations as described elsewhere.20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar C57BL/6 or JAM-A−/− mice at 6 to 8 weeks of age were either untreated or i.p. injected with either control saline (PBS) or PBS containing 1 mg/kg LPS from E. coli strain O111:B6 (Sigma-Aldrich). Lungs were collected 0, 6, 24, and 48 hours after treatment and were processed for total lung protein analysis, histologic analysis, or determination of the wet/dry ratio. Lungs from mice were removed and snap frozen using liquid nitrogen. The samples were homogenized in 1 mL of radioimmunoprecipitation assay buffer (20 mmol/L Tris, pH 7.4, 2 mmol/L EDTA, 2 mmol/L EGTA, 150 mmol/L NaCl, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS) containing 1 tablet per 10 mL complete protease inhibitors.25Mitchell L.A. Overgaard C.E. Ward C. Margulies S.S. Koval M. Differential effects of claudin-3 and claudin-4 on alveolar epithelial barrier function.Am J Physiol Lung Cell Mol Physiol. 2011; 301: L40-L49Crossref PubMed Scopus (86) Google Scholar The samples were microfuged at 5000 × g for 5 minutes, and the supernatant was analyzed by immunoblot as described in Biochemical Analysis. Lung sections (6 μm) were fixed with 4% paraformaldehyde for 10 minutes, processed for frozen thin sections, and then stained with hematoxylin and eosin or immunostained as described elsewhere.33Wang F. Daugherty B. Keise L.L. Wei Z. Foley J.P. Savani R.C. Koval M. Heterogeneity of claudin expression by alveolar epithelial cells.Am J Respir Cell Mol Biol. 2003; 29: 62-70Crossref PubMed Scopus (129) Google Scholar, 37Mitchell P.O. Jensen J.S. Ritzenthaler J.D. Roman J. Pelaez A. Guidot D.M. Alcohol primes the airway for increased interleukin-13 signaling.Alcohol Clin Exp Res. 2009; 33: 505-513Crossref PubMed Scopus (16) Google Scholar, 38Pelaez A. Force S.D. Gal A.A. Neujahr D.C. Ramirez A.M. Naik P.M. Quintero D.A. Pileggi A.V. Easley K.A. Echeverry R. Lawrence E.C. Guidot D.M. Mitchell P.O. Receptor for advanced glycation end products in donor lungs is associated with primary graft dysfunction after lung transplantation.Am J Transplant. 2010; 10: 900-907Crossref PubMed Scopus (40) Google Scholar For determination of pulmonary edema, lungs were removed, placed on a preweighed piece of aluminum foil, and weighed. Lungs were then heated to 65°C for 24 hours and weighed again. The ratio of wet lung mass/dry lung mass was calculated to give a measure of the water content of the tissue.39Yoseph B.P. Breed E. Overgaard C.E. Ward C.J. Liang Z. Wagener M.E. Lexcen D.R. Lusczek E.R. Beilman G.J. Burd E.M. Farris A.B. Guidot D.M. Koval M. Ford M.L. Coopersmith C.M. Chronic alcohol ingestion increases mortality and organ injury in a murine model of septic peritonitis.PLoS One. 2013; 8: e62792Crossref PubMed Scopus (45) Google Scholar JAM-A−/− mice have previously been shown to have a defect in intestinal permeability linked to changes in tight junction protein expression.15Monteiro A.C. Sumagin R. Rankin C.R. Leoni G. Mina M.J. Reiter D.M. Stehle T. Dermody T.S. Schaefer S.A. Hall R.A. Nusrat A. Parkos C.A. JAM-A associates with ZO-2, Afadin and PDZ-GEF1 to activate Rap2c and regulate epithelial barrier function.Mol Biol Cell. 2013; 24: 2849-2860Crossref PubMed Scopus (97) Google Scholar, 20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar Therefore, we characterized tight junction protein content of whole lungs of JAM-A−/− mice (Figure 1). We examined two PDZ scaffold proteins, ZO-1 and ZO-2, which are regulated by JAM-A.15Monteiro A.C. Sumagin R. Rankin C.R. Leoni G. Mina M.J. Reiter D.M. Stehle T. Dermody T.S. Schaefer S.A. Hall R.A. Nusrat A. Parkos C.A. JAM-A associates with ZO-2, Afadin and PDZ-GEF1 to activate Rap2c and regulate epithelial barrier function.Mol Biol Cell. 2013; 24: 2849-2860Crossref PubMed Scopus (97) Google Scholar Only ZO-1 showed a significant decrease in lung expression compared with that observed in wild-type mice (Figure 1). There was a mean ± SD 34% ± 15% decrease (n = 4) in total lung ZO-1 expression in JAM-A−/− mice compared with controls. In contrast, levels of total lung ZO-2 were unchanged in JAM-A−/− mice. Occludin expression was also unchanged in lungs of JAM-A−/− mice. We then focused on claudin expression. Of the claudins examined, only claudin-5 and claudin-7 showed small, but statistically significant, changes when comparing total lysates of lungs from JAM-A−/− mice with those from littermate controls. Claudin-5 levels increased by a mean ± SD of approximately 17% ± 10% (n = 4), whereas claudin-7 levels decreased by 15% ± 3% (n = 4). Claudin-4, claudin-10, and claudin-18 levels trended downward in response to loss of JAM-A, and the remaining claudins examined (claudin-1, claudin-2, claudin-3, claudin-4, claudin-8, claudin-10, claudin-15, claudin-18, and claudin-23) did not show significant differences between JAM-A–deficient lungs and lungs from littermate controls. Levels of pore-forming claudin-10 and claudin-15), which are up-regulated in the intestine of JAM-A−/− mice and contribute to an increase in gut permeability,20Laukoetter M.G. Nava P. Lee W.Y. Severson E.A. Capaldo C.T. Babbin B.A. Williams I.R. Koval M. Peatman E. Campbell J.A. Dermody T.S. Nusrat A. Parkos C.A. JAM-A regulates permeability and inflammation in the intestine in vivo.J Exp Med. 2007; 204: 3067-3076Crossref PubMed Scopus (395) Google Scholar were not increased in the lungs of JAM-A−/− mice. These results suggest that JAM-A deficiency has different effects on claudin expression in the lungs than in the gut. Consistent with small changes to total tight junction protein expression at baseline, lungs of wild-type and JAM-A−/− mice had comparable mean ± SD fluid content as determined by lung wet/dry weight ratios [wild type: 3.6 ± 0.1 (n = 3) versus JAM-A−/−: 3.6 ± 0.2 (n = 5)]. Because the lung is composed of many types of cells, we sought to characterize the effect of depleting JAM-A specifically in alveolar epithelial cells. We chose to analyze rat alveolar epithelial cells because this is a well-established system that we have used to characterize several different aspects of alveolar barrier function at a molecular level.25Mitchell L.A. Overgaard C.E. Ward C. Margulies S.S. Koval M. Differential effects of claudin-3 and claudin-4 on alveolar epithelial barrier function.Am J Physiol Lung Cell Mol Physiol. 2011; 301: L40-L49Crossref PubMed Scopus (86) Google Scholar, 31Abraham V. Chou M.L. DeBolt K.M. Koval M. Phenotypic control of gap junctional communication by cultured alveolar epithelial cells.Am J Physiol. 1999; 276: L825-L834PubMed Google Scholar, 32Koval M. Ward C. Findley M.K. Roser-Page S. Helms M.N. Roman J. Extracellular matrix influences alveolar epithelial claudin expression and barrier function.Am J Respir Cell Mol Biol. 2010; 42: 1
Referência(s)