Functional Characterization and Expression Analysis of Members of the UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Family from Drosophila melanogaster
2003; Elsevier BV; Volume: 278; Issue: 37 Linguagem: Inglês
10.1074/jbc.m303836200
ISSN1083-351X
AutoresKelly G. Ten Hagen, Duy Tran, Thomas Gerken, David Stein, Zhenyu Zhang,
Tópico(s)Cancer-related gene regulation
ResumoHere we report the cloning and functional characterization of eight members of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase gene family from Drosophila melanogaster (polypeptide GalNAc transferase = pgant1–8). Full-length cDNAs were isolated from a Drosophila embryonic library based on homology to known ppGaNTases. Alignments with characterized mammalian isoforms revealed strong sequence similarities between certain fly and mammalian isoforms, highlighting putative orthologues between the species. In vitro activity assays demonstrated biochemical transferase activity for each gene, with three isoforms requiring glycosylated substrates. Comparison of the activities of Drosophila and mammalian orthologues revealed conservation of substrate preferences against a panel of peptide and glycopeptide substrates. Furthermore, Edman degradation analysis demonstrated that preferred sites of GalNac addition were also conserved between certain fly and mammalian orthologues. Semi-quantitative PCR amplification of Drosophila cDNA revealed expression of most isoforms at each developmental stage, with some isoforms being less abundant at certain stages relative to others. In situ hybridization to Drosophila embryos revealed specific staining of pgant5 and pgant6 in the salivary glands and pgant5 in the developing hindgut. Additionally, pgant5 and pgant6 expression within the egg chamber was restricted to the follicle cells, cells known to be involved in egg formation and subsequent embryonic patterning. The characterization reported here provides additional insight into the use of this model system to dissect the biological role of this enzyme family in vivo during both fly and mammalian development. Here we report the cloning and functional characterization of eight members of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase gene family from Drosophila melanogaster (polypeptide GalNAc transferase = pgant1–8). Full-length cDNAs were isolated from a Drosophila embryonic library based on homology to known ppGaNTases. Alignments with characterized mammalian isoforms revealed strong sequence similarities between certain fly and mammalian isoforms, highlighting putative orthologues between the species. In vitro activity assays demonstrated biochemical transferase activity for each gene, with three isoforms requiring glycosylated substrates. Comparison of the activities of Drosophila and mammalian orthologues revealed conservation of substrate preferences against a panel of peptide and glycopeptide substrates. Furthermore, Edman degradation analysis demonstrated that preferred sites of GalNac addition were also conserved between certain fly and mammalian orthologues. Semi-quantitative PCR amplification of Drosophila cDNA revealed expression of most isoforms at each developmental stage, with some isoforms being less abundant at certain stages relative to others. In situ hybridization to Drosophila embryos revealed specific staining of pgant5 and pgant6 in the salivary glands and pgant5 in the developing hindgut. Additionally, pgant5 and pgant6 expression within the egg chamber was restricted to the follicle cells, cells known to be involved in egg formation and subsequent embryonic patterning. The characterization reported here provides additional insight into the use of this model system to dissect the biological role of this enzyme family in vivo during both fly and mammalian development. The recent completion of genome sequencing for many eukaryotic organisms as well as advances in proteomic analysis have placed new emphasis on the study of post-translation modifications. Glycosylation is by far the most abundant modification seen in nature. Protein substrates may be modified by the addition of N-linked oligosaccharides, O-linked fucose, O-linked xylose, O-linked galactose, O-linked mannose, O-linked GlcNAc, or O-linked GalNAc followed by subsequent sugar additions, resulting in the formation of very complex structures (1Ten Hagen K.G. Fritz T.A. Tabak L.A. Glycobiology. 2003; 13: R1-R16Crossref PubMed Scopus (420) Google Scholar, 2Varki A. Cummings R. Esko J. Freeze H. Hart G. Marth J. Essentials of Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1999Google Scholar, 3Varki A. Trends Cell Biol. 1998; 8: 34-40Abstract Full Text PDF PubMed Scopus (132) Google Scholar). Mucin-type O-linked glycosylation involves the transfer of GalNAc from the nucleotide sugar UDP-GalNAc to the hydroxyl group of either serine or threonine in protein substrates. A large, evolutionarily conserved family of enzymes, known as the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (ppGaNTases) 1The abbreviations used are: ppGaNTase, UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase; aa, amino acids; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. (EC 2.4.1.41), is responsible for this catalysis (reviewed in Ref. 1Ten Hagen K.G. Fritz T.A. Tabak L.A. Glycobiology. 2003; 13: R1-R16Crossref PubMed Scopus (420) Google Scholar). To date, 13 distinct mammalian isoforms of this enzyme family have been functionally characterized, with each displaying a unique combination of expression patterns and well as substrate specificity. These enzymes have been shown to fall into two general categories as follows: those that will transfer GalNAc onto unmodified (as well as modified) peptide substrates (peptide transferases) and those that require the prior addition of a GalNAc on a peptide substrate before they will add additional GalNAc moieties (glycopeptide transferases) (4Ten Hagen K.G. Bedi G.S. Tetaert D. Kingsley P.D. Hagen F.K. Balys M.M. Beres T.M. Degand P. Tabak L.A. J. Biol. Chem. 2001; 276: 17395-17404Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Estimates based on homology searches of the human and mouse genome data bases predict a total of 24 members of this enzyme family in mammals (1Ten Hagen K.G. Fritz T.A. Tabak L.A. Glycobiology. 2003; 13: R1-R16Crossref PubMed Scopus (420) Google Scholar). A total of nine genes are predicted in Caenorhabditis elegans, with four being functionally confirmed as transferases (5Hagen F.K. Nehrke K. J. Biol. Chem. 1998; 273: 8268-8277Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). Searches of the Drosophila genome data base indicate that up to 14 polypeptide GalNAc transferase (pgants) may be present. Of those, two have been cloned and functionally characterized (6Ten Hagen K.G. Tran D.T. J. Biol. Chem. 2002; 277: 22616-22622Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 7Schwientek T. Bennett E.P. Flores C. Thacker J. Hollmann M. Reis C.A. Behrens J. Mandel U. Keck B. Schafer M.A. Haselmann K. Zubarev R. Roepstorff P. Burchell J.M. Taylor-Papadimitriou J. Hollingsworth M.A. Clausen H. J. Biol. Chem. 2002; 277: 22623-22638Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). One of these genes, pgant35A, was found to be required for viability in Drosophila (6Ten Hagen K.G. Tran D.T. J. Biol. Chem. 2002; 277: 22616-22622Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 7Schwientek T. Bennett E.P. Flores C. Thacker J. Hollmann M. Reis C.A. Behrens J. Mandel U. Keck B. Schafer M.A. Haselmann K. Zubarev R. Roepstorff P. Burchell J.M. Taylor-Papadimitriou J. Hollingsworth M.A. Clausen H. J. Biol. Chem. 2002; 277: 22623-22638Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). Studies are currently underway to delete the mouse orthologue of pgant35A (ppGaNTase-T11) in hopes of gaining insight into the function of this gene in mammals. However, mouse strains deficient in ppGaNTase-T1 (8Westerman E.L. Ellies L.G. Hagen F.K. Marek K.W. Sutton-Smith M. Dell A. Tabak L.A. Marth J.D. Glycobiology. 1999; 9: 1121Google Scholar) and -T13 (9Hennet T. Hagen F.K. Tabak L.A. Marth J.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12070-12074Crossref PubMed Scopus (232) Google Scholar, 10Zhang Y. Iwasaki H. Wang H. Kudo T. Kalka T.B. Hennet T. Kubota T. Cheng L. Inaba N. Gotoh M. Togayachi A. Guo J. Hisatomi H. Nakajima K. Nishihara S. Nakamura M. Marth J.D. Narimatsu H. J. Biol. Chem. 2003; 278: 573-584Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar) do not display definitive phenotypes that would provide information as to the biological function of these gene products in vivo. Given the potentially large size of the mammalian ppGaNTase family as well as overlapping substrate preferences and expression patterns, individual gene knockouts may not show distinct phenotypes. This potential problem necessitates the use of model organisms (where the family size is smaller and genetic analysis more tractable) to aid in dissecting the role of this enzyme family in vivo. In an effort to begin to use Drosophila as a model system in which to study the ppGaNTases, we performed genome data base searches and screened cDNA libraries to identify and characterize potential members of the ppGaNTase enzyme family. Sequence analysis of fly and mammalian transferases indicates that certain isoforms were present prior to the divergence of these species. In vitro analysis of the cloned isoforms demonstrates biochemical activity and reveals functional conservation between certain Drosophila and mammalian orthologues. Isolation of ppGaNTase Full-length cDNAs—The amino acid consensus sequence SPTMAGGLFAVNRKYFQHLGEY, derived from the conserved region of previously characterized mammalian ppGaNTases, was used to perform a tBLASTn search against the existing Drosophila melanogaster genome data base present in NCBI to identify all potential members of this enzyme family. The 14 predicted D. melanogaster ppGaNTase gene sequences obtained were aligned to identify highly conserved regions on which to base degenerate probes to screen cDNA libraries. The primers MAGGLF-S (dATGGCCGGCGGNCTGTTTGCCAT) and WGGEN-AS (dATCTCCANATTCTCGCCGCCCCA) were used to amplify a 100-bp fragment from D. melanogaster genomic DNA that should hybridize to all 14 predicted isoforms. This amplified genomic fragment was then radioactively labeled using the Random Primers DNA Labeling System (Invitrogen) and used to probe a D. melanogaster Canton-S embryo (2–14-h-old) UniZap XR cDNA library (Stratagene catalog no. 937602). Hybridizations were performed in 5× SSPE, 50% formamide at 42 °C with washes in 2×SSC, 0.5% SDS for 5 min at room temperature and for 15 min at 65 °C. Positively hybridizing clones were further screened with isoform-specific primers to eliminate duplicate clones, hybridizing in 5× SSPE, 50% formamide at 30 °C with washes in 2×SSC, 0.5% SDS for 5 min at room temperature and 15 min at 42 °C. Isoform-specific primers were as follows: FlyA (dAGCGCGAATCGCCACGGGGGATG) for pgant1, FlyC (dTGCGGATGCAGCTGTGAGTAGTG) for pgant2, FlyE (dTGCCGAGCATGTGAGCGGTGAGG) for pgant5, FlyF (dCGCAAGGAATGCCACTGCAGAGG) for pgant6, FlyG (dTGCTTTGCATCCCGCAGGTGAGG) for pgant7, and FlyI (dAGCCTCAAGTATTTTGTGGCAAG) for CG30463. Clones were then sequenced using the T3 and T7 primers to identify each isoform obtained. Clones containing complete open reading frames were completely sequenced on both strands (Lark Technologies, Inc.). cDNA clones of pgant3 (GH09147) (GenBank™ accession number AF145655), pgant4 (AT-25481) and pgant8 (RE06471) (GenBank™ accession number) were purchased from Research Genetics (Invitrogen). Amino Acid Alignments and Similarity Determinations—Amino acid sequences were aligned, one pair at a time, using the pairwise ClustalW (1.4) algorithm in MacVector (Oxford Molecular Group). The following alignment modes and parameters were used: slow alignment, open gap penalty = 10, extended gap penalty = 0.1, similarity matrix = blosum, delay divergence = 40%, hydrophilic penalties, and residue-specific penalties. Best tree and bootstrap analyses were performed using the following parameters: neighbor joining; tie breaking = systematic; Poisson-correction; proportional gap distribution. Numbers at the nodes (Fig. 2B) represent reproducibility of particular groupings and are expressed as percentage of recovery in 1000 replicates. Nodes that appeared less than 50% of the time were not retained. Sequences comprising the conserved domains used in Figs. 1 and 2 begin with the consensus sequence FNXXXSD in the putative catalytic domain (aa position 84 in ppGaNTase-mT1 (11Hagen F.K. VanWuyckhuyse B. Tabak L.A. J. Biol. Chem. 1993; 268: 18960-18965Abstract Full Text PDF PubMed Google Scholar), 104 in ppGaNTase-hT2 (12White T. Bennett E.P. Takio K. Sørensen T. Bonding N. Clauser H. J. Biol. Chem. 1995; 270: 24156-24165Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar), 150 in ppGaNTase-mT3 (13Zara J. Hagen F.K. Ten Hagen K.G. VanWuyckhuyse B.C. Tabak L.A. Biochem. Biophys. Res. Commun. 1996; 228: 38-44Crossref PubMed Scopus (52) Google Scholar), 102 in ppGaNTase-mT4 (14Hagen F.K. Ten Hagen K.G. Beres T.M. Balys M.M. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1997; 272: 13843-13848Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar), 454 in ppGaNTase-rT5 (15Ten Hagen K.G. Hagen F.K. Balys M.M. Beres T.M. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1998; 273: 27749-27754Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar), 142 in ppGaNTase-hT6 (16Bennett E.P. Hassan H. Mandel U. Hollingsworth M.A. Akisawa N. Ikematsu Y. Merkx G. van Kessel A.G. Olofsson S. Clausen H. J. Biol. Chem. 1999; 274: 25362-25370Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar), 175 in ppGaNTase-rT7 (17Ten Hagen K.G. Tetaert D. Hagen F.K. Richet C. Beres T.M. Gagnon J. Balys M.M. VanWuyckhuyse B. Bedi G.S. Degand P. Tabak L.A. J. Biol. Chem. 1999; 274: 27867-27874Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar), 149 in ppGaNTase-hT8 (18White K.E. Lorenz B. Evans W.E. Meitinger T. Strom T.M. Econs M.J. Gene (Amst.). 2000; 246: 347-356Crossref PubMed Scopus (75) Google Scholar), 119 in ppGaNTase-hT9 (19Toba S. Tenno M. Konishi M. Mikami T. Itoh N. Kurosaka A. Biochim. Biophys. Acta. 2000; 1493: 264-268Crossref PubMed Scopus (64) Google Scholar), 113 in ppGaNTase-rT10 (4Ten Hagen K.G. Bedi G.S. Tetaert D. Kingsley P.D. Hagen F.K. Balys M.M. Beres T.M. Degand P. Tabak L.A. J. Biol. Chem. 2001; 276: 17395-17404Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), 119 in ppGaNTase-hT11 (7Schwientek T. Bennett E.P. Flores C. Thacker J. Hollmann M. Reis C.A. Behrens J. Mandel U. Keck B. Schafer M.A. Haselmann K. Zubarev R. Roepstorff P. Burchell J.M. Taylor-Papadimitriou J. Hollingsworth M.A. Clausen H. J. Biol. Chem. 2002; 277: 22623-22638Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar), 103 in ppGaNTase-h12 (20Guo J.M. Zhang Y. Cheng L. Iwasaki H. Wang H. Kubota T. Tachibana K. Narimatsu H. FEBS Lett. 2002; 524: 211-218Crossref PubMed Scopus (79) Google Scholar), 83 in ppGaNTase-h13 (10Zhang Y. Iwasaki H. Wang H. Kudo T. Kalka T.B. Hennet T. Kubota T. Cheng L. Inaba N. Gotoh M. Togayachi A. Guo J. Hisatomi H. Nakajima K. Nishihara S. Nakamura M. Marth J.D. Narimatsu H. J. Biol. Chem. 2003; 278: 573-584Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar), 79 in ppGaNTase-h14 (21Wang H. Tachibana K. Zhang Y. Iwasaki H. Kameyama A. Cheng L. Guo J. Hiruma T. Togayachi A. Kudo T. Kikuchi N. Narimatsu H. Biochem. Biophys. Res. Commun. 2003; 300: 738-744Crossref PubMed Scopus (83) Google Scholar), 114 in PGANT35A (6Ten Hagen K.G. Tran D.T. J. Biol. Chem. 2002; 277: 22616-22622Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar), 116 in PGANT1, 152 in PGANT2, 118 in PGANT3, 161 in PGANT4, 142 in PGANT5, 170 in PGANT6, 110 in PGANT7, 95 in PGANT8, 176 in CG30463, 75 in CG10000, 75 in CG7304, 103 in CG31776, and 18 in CG7579 and end at a conserved residue (amino acid position 421 in ppGaNTase-mT1, 436 in ppGaNTase-hT2, 495 in ppGaNTase-mT3, 434 in ppGaNTase-mT4, 792 in ppGaNTase-rT5, 487 in ppGaNTase-hT6, 520 in ppGaNTase-rT7, 490 in ppGaNTase-hT8, 458 in ppGaNTase-hT9, 445 in ppGaNTase-rT10, 454 in ppGaNTase-hT11, 435 in ppGaNTase-hT12, 420 in ppGaNTase-hT13, 410 in ppGaNTase-hT14, 452 in PGANT35A, 463 in PGANT1, 484 in PGANT2, 459 in PGANT3, 497 in PGANT4, 479 in PGANT5, 504 in PGANT6, 454 in PGANT7, 432 in PGANT8, 512 in CG30463, 425 in CG10000, 420 in CG7304, 440 in CG31776, and 351 in CG7579). The segment of conserved sequences is ∼340 amino acids in length in the various isoforms and corresponds to the putative catalytic domain based on structural modeling and mutagenesis studies (22Hagen F.K. Hazes B. Raffo R. deSa D. Tabak L.A. J. Biol. Chem. 1999; 274: 6797-6803Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar).Fig. 1Amino acid sequence alignments of Drosophila PGANT proteins and murine ppGaNTase-T1 (mT1). Amino acid sequences were aligned within the putative catalytic domain, beginning with the consensus sequence FNXXXSD and extending to the C terminus. Shaded blocks indicate regions of similarity or identity. A consensus sequence is given below the alignments for positions that are greater than 50% conserved among the isoforms displayed. The GT1 and Gal/GalNAc-T motifs are shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) PCR Analysis—cDNA panels at four different dilutions (1, 10, 100, and 1000×) from various D. melanogaster tissues and stages of development were obtained from OriGene Technologies, Inc. The following regions were amplified from each gene using the specified primer pairs: a 335-bp region of pgant1 using primers FlyA-1230S (dGGCTCTGGTTTGGATGGATGAG) and FlyA-1565AS (dAGGACATTTGTGTTGGTGAAGGAG); a 282-bp region of pgant3 using primers FlyB-1489S (dTTGTCACGAGAGTGGAAGCGAG) and FlyB-1771AS (dCGTTGCGGTTCTTTAGCATCTTG); a 255-bp region of pgant2 using primers FlyC-724S (dCGAGTGATTCGCAACGACAAG) and FlyC-979AS (dTCAGGTTCCAGTCAAAGCCG); a 259-bp region of pgant4 using primers FlyD-981S (dTAGCGGAAATAAGGACGGAGC) and FlyD-1241AS (dCAGGGAACATCCAACAGCATACC); a 334-bp region of pgant5 using primers FlyE-1085S (dATGAGATTGGCTCCTACGACGAGG) and FlyE-1419AS (dCAGATACCAGCGGAAACTCTTGC); a 259-bp region of pgant6 using primers FlyF-633S (dCAACGAATACCTGAGCGTGCTG) and FlyF-892AS (dCGTGGGAATCAAGGAAGATGAG); a 357-bp region of pgant7 using primers FlyG-966S (dCCTGTTCGCCATCAATAGGGAG) and FlyG-1323AS (dGCAGTTCAGTCGCTTCTTCAGC); an 845-bp region of pgant35A using primers FlyH-1330-S (dCCTCATCAAGTCGGAGAACG) and FlyH-2175-AS (dAGGCACAGCAACTTGTCCAG); a 213-bp region of pgant8 using primers FlyJ-1496S (dGATTCTATTGCTTGGAGGTGCG) and FlyJ-1709AS (dCACTGTTGCTTATGGTTCTTCGG). Primers pairs were used under the following PCR conditions: 35 cycles of 95 °C for 1 min, 5 °C below the lowest Tm for the primer pair for 1 min, and 72 °C for 1 min followed by 1 cycle of 72 °C for 10 min. rp49 control PCR amplifications were performed according to the manufacturer's primers and instructions. Reaction products were electrophoresed in a 1% TAE-agarose gel and photographed on a Bio-Rad Fluor-S™ MultiImager. Generation of Secretion Constructs for Drosophila ppGaNTases— Each cDNA was cloned into an SV40 expression vector (pIMKF4) to generate a recombinant fusion protein containing an insulin secretion signal, a metal-binding site, a heart muscle kinase site, a FLAG™ epitope tag, and the transferase gene of interest. Fusions of each transferase gene begin after the transmembrane domain by introduction of an MluI site, so that the recombinant protein is efficiently secreted into the media. PCR products used in the cloning of each gene were sequenced to verify that no PCR-induced mutation had occurred. To clone pgant1, an MluI site was introduced into a fragment of the pgant1 cDNA (Fly-4a) by PCR amplification using the primers FlyA-59S (dATAACGCGTTGCAGCAGAATGGTTCACCA) and FlyA-925AS (dGAAGATCTGTACTGAAAGTCGTTGGCATCG); after digestion with MluI, the product was cloned into the MluI/BglII (blunt) sites of pIMKF4 to generate pF4-FlyA700. A 1.7-kb BsmBI/SacI fragment was isolated from the original cDNA clone for pgant1 (Fly-4a) and cloned into the same sites of pF4-FlyA700 to generate the pgant1 expression vector, pF4-FlyA. The expression vector for pgant3 was constructed by PCR amplification of a fragment from the pgant3 cDNA (GH09147) using the primers FlyB-MluI-S (dATAACGCGTTCCAGGGCGGGGACGCGGAG) and FlyB-BglII-AS (dGAAGATCTTGGGCGTCGAGGAAGGTCAGCAC); this fragment was digested with MluI/BglII and cloned into the MluI/BglII sites of pIMKF4 to generate the vector pF4FlyB-640. A BspTI/XbaI(blunt) fragment from the pgant3 cDNA clone was then cloned into the BspTI/SacI(blunt) sites pF4FlyB-640 to generate the expression vector pF4-FlyB. The expression vector for pgant2 was generated by PCR amplification of a 374-bp fragment from the pgant2 cDNA clone (FlyC-1a) using the primers FlyC-MluIS (dATAACGCGTCAAGTGGTCGTGGCACCGAGGT) and FlyC-BglIIAS (dGAAGATCTCACTCGCACCTTGTCAATCTTCGCCA); after digestion with MluI, this product was cloned into the MluI/BglII(blunt) sites of pIMKF4 to generate the vector, pF4FlyC-374. A 1.7-kb Bsu36I/XbaI(blunt) fragment from the pgant2 cDNA clone was then cloned into the Bsu36I/SacI(blunt) sites of pF4FlyC-374 to generate the expression vector pF4-FlyC. To generate the pgant4 expression vector, an MluI site was introduced into a fragment of the pgant4 cDNA (AT25481) by PCR amplification using the primers FlyD-185S (ATAACGCGTTGAAAAATGCGGCGGAGCTGA) and FlyD-1000AS (dAATCTTCATGCGAAATAGTATCCACCA); this product was digested with MluI/BglII and cloned into the MluI/BglII sites of pIMKF4 to generate the vector, pF4-FlyD820. A 1.9-kb AflII/SmaI fragment from AT25481 was then cloned into the AflII/BglII(blunt) sites of pF4-FlyD820 to generate the expression vector, pF4-FlyD. The expression vector for pgant5 was generated by amplification of an 800-bp fragment from the pgant5 cDNA clone, pBSFlyE, using the primers FlyE-82S (dATAACGCGTACTCGGACTGCATCGGCA) and FlyE-900AS (dGAAGATCTAATCACATCAATAATCGGGCAC). This fragment was then digested with MluI/BglII and cloned into the MluI/BglII sites of pIMKF4 to generate the vector, pF4FlyE-819. A 1.4-kb BsmBI/BglII fragment from pBSFlyE was then cloned into the BsmBI/BglII sites of pF4FlyE-819 to generate the expression vector, pF4-FlyE. The pgant6 expression vector was constructed by cloning the 570-bp MluI/BglII PCR fragment, obtained using primers FlyF-MluIS (dATAACGCGTTCTCATCTACTCCGGACACCAACA) and FlyF-BglIIAS (dGAAGATCTGCATCAGCACGCTCAGGTATTC) with the pgant6 cDNA (FlyF-1a), into the MluI/BglII sites of pIMKF4 to generate the vector, pF4FlyF-570. Then a 1.9-kb BstBI/NdeI(blunt) from pBSFlyE was cloned into the BstBI/NotI(blunt) sites of pF4FlyF-570 to generate the expression vector, pF4-FlyF. The expression vector for pgant7 was generated by amplification of a 350-bp fragment from the pgant7 cDNA (Fly-42a) using the primers FlyG-MluIS (dATAACGCGTACAAGCGCGTCCAGGAGGCGTAT) and FlyG-BglIIAS (dGAAGATCTTGGAAGACAATGATGACGCTCGTGC); this fragment was digested with MluI/BglII and cloned into the MluI/BglII sites of pIMKF4 to generate the vector, pF4FlyG-349. A 1.7-kb PciI/XhoI(blunt) fragment from Fly-42a was then inserted into the PciI/SacI(blunt) sites of pF4FlyG-349 to generate the expression vector, pF4-FlyG. A fragment from the pgant8 cDNA (RE06471) was amplified using the primers FlyJ-191S (dATAACGCGTTGGAGGGGGAGCGTGATG) and FlyJ-596AS (dGAGGATCCCGTCCACCAGGATAACCTCTCG); after digestion with MluI/BamHI, this fragment was cloned into the MluI/BglII sites of pIMKF4 to generate the vector, pF4FlyJ-405. A 1.7-kb BstBI/BamHI(blunt) fragment from RE06471 was then cloned into the BstBI/SacI(blunt) sites of pF4FlyJ-405 to generate the expression vector, pF4-FlyJ. Functional Expression Assays of Secreted Recombinant ppGaNTases in COS7 Cells—COS7 cells were grown to 90% confluency and transfected with pIMKF4, pF1-rT7, pF3-mT2, pF3-mT1, pF3-mT11, pF4-FlyA, pF4-FlyB, pF4-FlyC, pF4-FlyD, pF4-FlyE, pF4-FlyF, pF4-FlyG, or pF4-FlyJ and 64 μl of LipofectAMINE (Invitrogen) as described previously (14Hagen F.K. Ten Hagen K.G. Beres T.M. Balys M.M. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1997; 272: 13843-13848Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Recombinant enzymes were purified using FLAG-affinity agarose (Sigma), labeled with [γ-32P]ATP using heart muscle kinase (Sigma) and quantitated by Tricine SDS-PAGE as described previously (15Ten Hagen K.G. Hagen F.K. Balys M.M. Beres T.M. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1998; 273: 27749-27754Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). Gels were dried under vacuum, exposed to film (XAR, Eastman Kodak Co.), and quantitated on a Personal Molecular Imager FX (Bio-Rad). Enzyme assays were conducted using equivalent amounts of FLAG-purified PGANT1, -2, and -5–7 based on gel densitometric measurements. Maximal amounts of FLAG-purified PGANT4 were used in assays as its activity was low relative to the other FLAG-purified isoforms. Assays for PGANT3 and PGANT8 were performed using cell media, as FLAG purification resulted in no detectable protein and loss of activity (likely due to an N-terminal cleavage of the recombinant proteins, resulting in loss of the FLAG site). All enzymes were tested against the following peptide and glycopeptide substrates: EA2 (PTTDSTTPAPTTK) (23Albone E.F. Hagen F.K. VanWuyckhuyse B.C. Tabak L.A. J. Biol. Chem. 1994; 269: 16845-16852Abstract Full Text PDF PubMed Google Scholar); MUC1b (PDTRPAPGSTAPPAC) (24Gendler S.J. Lancaster C.A. Taylor-Papadimitriou J. Duhig T. Peat N. Burchell J. Pemberton L. Lalani E.-N. Wilson D. J. Biol. Chem. 1990; 265: 15268-15293Abstract Full Text PDF Google Scholar); rMUC-2 (SPTTSTPISSTPQPTS) (25Ohmori H. Dohrman A.F. Gallup M. Tsuda T. Kai H. Gum Jr., J.R. Kim Y.S. Basbaum C.B. J. Biol. Chem. 1994; 269: 17833-17840Abstract Full Text PDF PubMed Google Scholar); mG-MUC (QTSSPNTGKTSTISTT) (26Shekels L.L. Lyftogt C. Kieliszewski M. Filie J.D. Kozak C.A. Ho S.B. Biochem. J. 1995; 311: 775-785Crossref PubMed Scopus (74) Google Scholar); MUC5AC (GTTPSPVPTTSTTSAP) (27Guyonnet-Dupérat V. Audié J.P. Debailleul V. Laine A. Buisine M.P. Galiegue-Zouitina S. Pigny P. Degand P. Aubert J.P. Porchet N. Biochem. J. 1995; 305: 211-219Crossref PubMed Scopus (190) Google Scholar); MUC5AC-3 (GTT*PSPVPTTSTTSAP) (where the * denotes a GalNAc modified residue); MUC5AC-13 (GTTPSPVPTTSTT*SAP); MUC5AC-3/13 (GTT*PSPVPTTSTT*SAP); IgAh (PSTPPTPSPSTPPTPSPS) (28Hiki Y. Odani H. Takahashi M. Yasuda Y. Nishimoto A. Iwase H. Shinzato T. Kobayashi Y. Maeda K. Kidney Int. 2001; 59: 1077-1085Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar); and Drosocin (GKPRPYSPRPTSHPRPIRV) (29McManus A.M. Otvos Jr., L. Hoffman R. Craik D.L. Biochemistry. 1999; 38: 705-714Crossref PubMed Scopus (68) Google Scholar). Glycopeptide substrates were the kind gift of H. Hang and C. Bertozzi. All reactions were performed in duplicate at 37 °C for 1 h. Reactions were performed in 25-μl final volumes consisting of the following: 500 μm acceptor substrate, 7.3 μm [14C]UDP-GalNAc (54.7 mCi/mmol; 0.02mCi/ml), 44 μm cold UDP-GalNAc, 10 mm MnCl2, 40 mm cacodylate (pH 6.5), 40 mm 2-mercaptoethanol, and 0.1% Triton X-100. Reaction products were purified using anion exchange chromatography (AG 1-X8, Bio-Rad). Reactions using media or FLAG-purified material from cells transfected with vector alone yielded background values for each substrate that were subtracted from each experimental value. Adjusted experimental values for each substrate were then averaged, and standard deviations were calculated. Enzyme activity is expressed as dpm/h. Amino Acid Sequencing—Reactions used to determine the position of GalNAc addition were performed over 96 h at 37 °C under the following conditions: 15 μg of acceptor substrate, 1 mm leupeptin, 1 mm aprotinin, 1 mm E-64, 1 mm phenylmethylsulfonyl fluoride, 1.25 mm AMP, 10 mm MnCl2, 40 mm cacodylate (pH 6.5), 40 mm 2-mercaptoethanol, 0.1% Triton X-100, 440 μm UDP-GalNAc. Additional enzyme and UDP-GalNAc (44 nmol) were added after each 24-h period. Reactions were purified over an AG 1-X8 and then over a G-15 Sephadex column in 15 mm acetic acid (pH 4) (Amersham Biosciences). Pulsed liquid phase Edman degradation amino acid sequencing was performed on an Applied Biosystems Procise 494 protein sequencer (Applied Biosystems, Foster City, CA). The extent of serine and threonine glycosylation by GalNAc was determined as described previously (30Gerken T.A. Gilmore M. Zhang J. J. Biol. Chem. 2002; 277: 7736-7751Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) after correcting for the relative recoveries and overlap of the individual amino acid phenylthiohydantoin derivatives. RNA in Situ Hybridizations to Embryos and Ovaries—Whole mount in situ hybridizations to overnight collections of embryos and to dissected ovaries from Oregon R wild-type females were performed according to Tautz and Pfeifle (31Tautz D. Pfeifle C. Chromosoma. 1989; 98: 81-85Crossref PubMed Scopus (2095) Google Scholar). Digoxigenin-labeled DNA probes were prepared by random primed labeling of purified DNA fragments derived from cDNAs corresponding to the various pgant genes under study. Embryo staging was performed according to Ref. 32Campos-Ortega J.A. Hartenstein V. The Embryonic Development of Drosophila Melanogasterm. Springer-Verlag, Berlin1985Crossref Google Scholar. Egg chamber staging is from Ref. 33King R.C. Ovarian Development in Drosophila melanogaster. Academic Press, New York1970Google Scholar). cDNA clones for eight novel D. melanogaster UPD-GalNAc: polypeptide N-acetylgalactosaminyltransferase genes were obtained from either the D. melanogaster
Referência(s)