Delayed Chain Termination Protects the Anti-hepatitis B Virus Drug Entecavir from Excision by HIV-1 Reverse Transcriptase
2008; Elsevier BV; Volume: 283; Issue: 49 Linguagem: Inglês
10.1074/jbc.m806797200
ISSN1083-351X
AutoresEgor P. Tchesnokov, Aleksandr Obikhod, Raymond F. Schinazi, Matthias Götte,
Tópico(s)HIV/AIDS drug development and treatment
ResumoEntecavir (ETV) is a potent antiviral nucleoside analogue that is used to treat hepatitis B virus (HBV) infection. Recent clinical studies have demonstrated that ETV is also active against the human immunodeficiency virus type 1 (HIV-1). Unlike all approved nucleoside analogue reverse transcriptase RT) inhibitors (NRTIs), ETV contains a 3′-hydroxyl group that allows further nucleotide incorporation events to occur. Thus, the mechanism of inhibition probably differs from classic chain termination. Here, we show that the incorporated ETV-monophosphate (MP) can interfere with three distinct stages of DNA synthesis. First, incorporation of the next nucleotide at position n + 1 following ETV-MP is compromised, although DNA synthesis eventually continues. Second, strong pausing at position n + 3 suggests a long range effect, referred to as "delayed chain-termination." Third, the incorporated ETV-MP can also act as a "base pair confounder" during synthesis of the second DNA strand, when the RT enzyme needs to pass the inhibitor in the template. Enzyme kinetics revealed that delayed chain termination is the dominant mechanism of action. High resolution foot-printing experiments suggest that the incorporated ETV-MP "repels" the 3′-end of the primer from the active site of HIV-1 RT, which, in turn, diminishes incorporation of the natural nucleotide substrate at position n + 4. Most importantly, delayed chain termination protects ETV-MP from phosphorolytic excision, which represents a major resistance mechanism for approved NRTIs. Collectively, these findings provide a rationale and important tools for the development of novel, more potent delayed chain terminators as anti-HIV agents. Entecavir (ETV) is a potent antiviral nucleoside analogue that is used to treat hepatitis B virus (HBV) infection. Recent clinical studies have demonstrated that ETV is also active against the human immunodeficiency virus type 1 (HIV-1). Unlike all approved nucleoside analogue reverse transcriptase RT) inhibitors (NRTIs), ETV contains a 3′-hydroxyl group that allows further nucleotide incorporation events to occur. Thus, the mechanism of inhibition probably differs from classic chain termination. Here, we show that the incorporated ETV-monophosphate (MP) can interfere with three distinct stages of DNA synthesis. First, incorporation of the next nucleotide at position n + 1 following ETV-MP is compromised, although DNA synthesis eventually continues. Second, strong pausing at position n + 3 suggests a long range effect, referred to as "delayed chain-termination." Third, the incorporated ETV-MP can also act as a "base pair confounder" during synthesis of the second DNA strand, when the RT enzyme needs to pass the inhibitor in the template. Enzyme kinetics revealed that delayed chain termination is the dominant mechanism of action. High resolution foot-printing experiments suggest that the incorporated ETV-MP "repels" the 3′-end of the primer from the active site of HIV-1 RT, which, in turn, diminishes incorporation of the natural nucleotide substrate at position n + 4. Most importantly, delayed chain termination protects ETV-MP from phosphorolytic excision, which represents a major resistance mechanism for approved NRTIs. Collectively, these findings provide a rationale and important tools for the development of novel, more potent delayed chain terminators as anti-HIV agents. Co-infection with the hepatitis B virus (HBV) 3The abbreviations used are: HBV, hepatitis B virus; HIV-1, human immunodeficiency virus, type 1; RT, reverse transcriptase; NRTI, nucleoside-analogue RT inhibitor; ETV, entecavir; TAM, thymidine analogue-associated mutation; 3TC, lamivudine; MP, monophosphate; HPLC, high performance liquid chromatography; DTT, dithiothreitol; RNase H, ribonuclease H; PFA, foscarnet. and the human immunodeficiency virus, type 1 (HIV-1) is common and complicates treatment (1Sulkowski M.S. J. Hepatol. 2008; 48: 353-367Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar). Although both viruses share a highly related target for pharmaceutical intervention, there are few drugs that are approved to treat HBV and HIV-1 infection simultaneously (1Sulkowski M.S. J. Hepatol. 2008; 48: 353-367Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, 2De Clercq E. Nat. Rev. Drug Discov. 2007; 6: 1001-1018Crossref PubMed Scopus (386) Google Scholar). HBV and HIV replicate through a reverse transcription step, carried out by the virally encoded HBV DNA polymerase and the HIV-1 reverse transcriptase (RT), respectively (3Telesnitsky A. Goff S.P. Coffin J.M. Hughes S.H. Varmus H.E. Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York1997: 121-160Google Scholar, 4Seeger C. Mason W.S. Microbiol. Mol. Biol. Rev. 2000; 64: 51-68Crossref PubMed Scopus (1223) Google Scholar). Lamivudine (3TC) and emtricitabine are cytidine analogues that exert potent antiviral effects against HBV and HIV-1, targeting their DNA polymerase (5Nassal M. Virus Res. 2008; 134: 235-249Crossref PubMed Scopus (298) Google Scholar, 6Schinazi R.F. McMillan A. Cannon D. Mathis R. Lloyd R.M. Peck A. Sommadossi J.P. St. Clair M. Wilson J. Furman P.A. Painter G. Choi W.-B. Liotta S. Antimicrob. Agents Chemother. 1992; 36: 2423-2431Crossref PubMed Scopus (283) Google Scholar, 7Severini A. Liu X.Y. Wilson J.S. Tyrrell D.L. Antimicrob. Agents Chemother. 1995; 39: 1430-1435Crossref PubMed Scopus (130) Google Scholar). Once intracellularly phosphorylated to their triphosphate forms, these drugs act as chain terminators. However, the development of resistance can limit their clinical utility (8Boucher C.A. Cammack N. Schipper P. Schuurman R. Rouse P. Wainberg M.A. Cameron J.M. Antimicrob. Agents Chemother. 1993; 37: 2231-2234Crossref PubMed Scopus (297) Google Scholar, 9Schinazi R.F. Lloyd Jr., R.M. Nguyen M.H. Cannon D.L. McMillan A. Ilksoy N. Chu C.K. Liotta D.C. Bazmi H.Z. Mellors J.W. Antimicrob. Agents Chemother. 1993; 37: 875-881Crossref PubMed Scopus (347) Google Scholar, 10Ling R. Mutimer D. Ahmed M. Boxall E.H. Elias E. Dusheiko G.M. Harrison T.J. Hepatology. 1996; 24: 711-713Crossref PubMed Google Scholar). In HIV-1, both 3TC and emtricitabine can select for the M184V mutation in the conserved YMDD motif at the active site of RT (11Wainberg M.A. Salomon H. Gu Z. Montaner J.S. Cooley T.P. McCaffrey R. Ruedy J. Hirst H.M. Cammack N. Cameron J. Nicholson W. AIDS. 1995; 9: 351-357Crossref PubMed Scopus (110) Google Scholar). A structurally and functionally equivalent mutation (i.e. M204V) is selected in HBV (10Ling R. Mutimer D. Ahmed M. Boxall E.H. Elias E. Dusheiko G.M. Harrison T.J. Hepatology. 1996; 24: 711-713Crossref PubMed Google Scholar, 12Gutfreund K.S. Williams M. George R. Bain V.G. Ma M.M. Yoshida E.M. Villeneuve J.P. Fischer K.P. Tyrrel D.L. J. Hepatol. 2000; 33: 469-475Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 13Allen M.I. Deslauriers M. Andrews C.W. Tipples G.A. Walters K.A. Tyrrell D.L. Brown N. Condreay L.D. Hepatology. 1998; 27: 1670-1677Crossref PubMed Scopus (785) Google Scholar, 14Benhamou Y. Bochet M. Thibault V. Di Martino V. Caumes E. Bricaire F. Opolon P. Katlama C. Poynard T. Hepatology. 1999; 30: 1302-1306Crossref PubMed Scopus (388) Google Scholar, 15Thibault V. Benhamou Y. Seguret C. Bochet M. Katlama C. Bricaire F. Opolon P. Poynard T. Agut H. J. Clin. Microbiol. 1999; 37: 3013-3016Crossref PubMed Google Scholar, 16Fontaine H. Thiers V. Pol S. Ann. Intern. Med. 1999; 131: 716-717Crossref PubMed Scopus (5) Google Scholar). This mutation is often accompanied with other mutations, that appear to compensate for fitness deficits that are introduced by the primary mutation (17Villet S. Pichoud C. Villeneuve J.-P. Trépo C. Zoulim F. Gastroenterology. 2006; 131: 1253-1261Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). The incidence of 3TC resistance is high in part because 3TC has been for a long time the only small molecule approved for the treatment of HBV, and 3TC has also been and remains an important component in recommended drug regimens for the treatment of HIV (2De Clercq E. Nat. Rev. Drug Discov. 2007; 6: 1001-1018Crossref PubMed Scopus (386) Google Scholar). The acyclic phosphonate tenofovir is active against 3TC-resistant HIV and HBV strains (18Miller M.D. Margot N.A. Hertogs K. Larder B. Miller V. Nucleosides Nucleotides Nucleic Acids. 2001; 20: 1025-1028Crossref PubMed Scopus (84) Google Scholar, 19Nunez M. Perez-Olmeda M. Diaz B. Rios P. Gonzalez-Lahoz J. Soriano V. AIDS. 2002; 16: 2352-2354Crossref PubMed Scopus (117) Google Scholar, 20van Bommel F. Wunsche T. Schurmann D. Berg T. Hepatology. 2002; 36: 507-508Crossref PubMed Scopus (82) Google Scholar, 21Benhamou Y. Tubiana R. Thibault V. N. Engl. J. Med. 2003; 348: 177-178Crossref PubMed Scopus (144) Google Scholar), whereas the structurally related compound adefovir has been approved for HBV treatment only, although it has activity against HIV (22Manolakopoulos S. Bethanis S. Koutsounas S. Goulis J. Vlachogiannakos J. Christias E. Saveriadis A. Pavlidis C. Triantos C. Christidou A. Papatheodoridis G. Karamanolis D. Tzourmakliotis D. Aliment. Pharmacol. Ther. 2008; 27: 266-273Crossref PubMed Scopus (44) Google Scholar, 23Yuan H.J. Lee W.M. Curr. Mol. Med. 2007; 7: 185-197Crossref PubMed Scopus (14) Google Scholar). Entecavir (ETV) belongs to the few available drugs that retain potency against 3TC-resistant HBV (24Sherman M. Yurdaydin C. Sollano J. Silva M. Liaw Y.F. Cianciara J. Boron-Kaczmarska A. Martin P. Goodman Z. Colonno R. Cross A. Denisky G. Kreter B. Hindes R. Gastroenterology. 2006; 130: 2039-2049Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar, 25Lai C.L. Shouval D. Lok A.S. Chang T.T. Cheinquer H. Goodman Z. DeHertogh D. Wilber R. Zink R.C. Cross A. Colonno R. Fernandes L. N. Engl. J. Med. 2006; 354: 1011-1020Crossref PubMed Scopus (1071) Google Scholar). This compound does not appear to select for M204 and L180M in HBV, although the preexistence of the two mutations can decrease susceptibility to ETV (26Colonno R.J. Rose R. Baldick C.J. Levine S. Pokornowski K. Yu C.F. Walsh A. Fang J. Hsu M. Mazzucco C. Eggers B. Zhang S. Plym M. Klesczewski K. Tenney D.J. Hepatology. 2006; 44: 1656-1665Crossref PubMed Scopus (321) Google Scholar, 27Tenney D.J. Rose R.E. Baldick C.J. Levine S.M. Pokornowski K.A. Walsh A.W. Fang J. Yu C.F. Zhang S. Mazzucco C.E. Eggers B. Hsu M. Plym M.J. Poundstone P. Yang J. Colonno R.J. Antimicrob. Agents Chemother. 2007; 51: 902-911Crossref PubMed Scopus (208) Google Scholar). Other additional mutations can further amplify clinically relevant levels of resistance to this drug (28Tenney D.J. Levine S.M. Rose R.E. Walsh A.W. Weinheimer S.P. Discotto L. Plym M. Pokornowski K. Yu C.F. Angus P. Ayres A. Bartholomeusz A. Sievert W. Thompson G. Warner N. Locarnini S. Colonno R.J. Antimicrob. Agents Chemother. 2004; 48: 3498-3507Crossref PubMed Scopus (499) Google Scholar). In contrast, it has recently been demonstrated that ETV can select for the M184V mutation in HBV/HIV-co-infected individuals (29McMahon M.A. Jilek B.L. Brennan T.P. Shen L. Zhou Y. Wind-Rotolo M. Xing S. Bhat S. Hale B. Hegarty R. Chong C.R. Liu J.O. Siliciano R.F. Thio C.L. N. Engl. J. Med. 2007; 356: 2614-2621Crossref PubMed Scopus (237) Google Scholar). These data showed unambiguously that ETV can exert antiretroviral effects, which led to the recommendation that ETV should not be administered in co-infected individuals unless these persons are simultaneously on highly active antiretroviral therapy (29McMahon M.A. Jilek B.L. Brennan T.P. Shen L. Zhou Y. Wind-Rotolo M. Xing S. Bhat S. Hale B. Hegarty R. Chong C.R. Liu J.O. Siliciano R.F. Thio C.L. N. Engl. J. Med. 2007; 356: 2614-2621Crossref PubMed Scopus (237) Google Scholar, 30Sulkowski M.S. J. Infect. Dis. 2008; 197: 279-293Crossref PubMed Scopus (71) Google Scholar). Subsequent case reports and clinical studies with smaller cohorts are consistent with the original study, and in vitro selection experiments as well as phenotypic susceptibility measurements with HIV-1 strains containing the M184V mutation confirmed the clinical data (31Soriano V. Vispo E. Labarga P. Barreiro P. AIDS. 2008; 22: 911-912Crossref PubMed Scopus (6) Google Scholar, 32Sasadeusz J. Audsley J. Mijch A. Baden R. Caro J. Hunter H. Matthews G. McMahon M.A. Olender S.A. Siliciano R.F. Lewin S.R. Thio C.L. AIDS. 2008; 22: 947-955Crossref PubMed Scopus (42) Google Scholar, 33Lin P.F. Nowicka-Sans B. Terry B. Zhang S. Wang C. Fan L. Dicker I. Gali V. Higley H. Parkin N. Tenney D. Krystal M. Colonno R. Antimicrob. Agents Chemother. 2008; 52: 1759-1767Crossref PubMed Scopus (23) Google Scholar, 34Sasadeusz J. J. Hepatol. 2007; 47: 872-874Abstract Full Text Full Text PDF PubMed Scopus (4) Google Scholar, 35Hirsch M.S. N. Engl. J. Med. 2007; 356: 2641-2643Crossref PubMed Scopus (15) Google Scholar). Moreover, pre-steady-state kinetics with wild type HIV-1 RT demonstrated that the enzyme can incorporate ETV-monophosphate (MP) (36Domaoal R.A. McMahon M. Thio C.L. Bailey C.M. Tirado-Rives J. Obikhod A. Detorio M. Rapp K.L. Siliciano R.F. Schinazi R.F. Anderson K.S. J. Biol. Chem. 2008; 283: 5452-5459Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The M184V mutant appears to be able to discriminate against the inhibitor, since the efficiency of incorporation of ETV-MP is severely diminished. Aside from the clinical importance of these findings, the observation that ETV exhibits antiretroviral activity has potential implications for the development of novel drugs that may evade major resistance pathways in HIV. Unlike all approved nucleoside analogue RT inhibitors that lack the 3′-hydroxyl group of the sugar moiety and act as chain terminators, ETV contains this group, which can attack the next incoming nucleotide on its ;-phosphate (Fig. 1). Thus, DNA synthesis may be inhibited at several steps after incorporation of ETV-MP. In vitro studies with HBV replication complexes (37Seifer M. Hamatake R.K. Colonno R.J. Standring D.N. Antimicrob. Agents Chemother. 1998; 42: 3200-3208Crossref PubMed Google Scholar) and purified HIV-1 RT (36Domaoal R.A. McMahon M. Thio C.L. Bailey C.M. Tirado-Rives J. Obikhod A. Detorio M. Rapp K.L. Siliciano R.F. Schinazi R.F. Anderson K.S. J. Biol. Chem. 2008; 283: 5452-5459Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar), respectively, indicated pausing of DNA synthesis immediately following incorporation of ETV-MP and later following incorporation of up to three additional nucleotides. Such late pausing is referred to as "delayed chain termination." Very few nucleotide analogues have been described that show this type of inhibition of HIV-1 RT (38Boyer P.L. Julias J.G. Marquez V.E. Hughes S.H. J. Mol. Biol. 2005; 345: 441-450Crossref PubMed Scopus (52) Google Scholar); however, these compounds are toxic and/or are not converted intracellularly into their triphosphate form (39Marquez V.E. Ben-Kasus T. Barchi Jr., J.J. Green K.M. Nicklaus M.C. Agbaria R. J. Am. Chem. Soc. 2004; 126: 543-549Crossref PubMed Scopus (101) Google Scholar). ETV may therefore be exploited as a model compound for the study of delayed chain termination and its implications in current drug development efforts. Of note, ETV is fully susceptible against a background of thymidine analogue-associated mutations (TAMs) (36Domaoal R.A. McMahon M. Thio C.L. Bailey C.M. Tirado-Rives J. Obikhod A. Detorio M. Rapp K.L. Siliciano R.F. Schinazi R.F. Anderson K.S. J. Biol. Chem. 2008; 283: 5452-5459Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar), which reduce susceptibility to literally all approved nucleotide analogue RT inhibitors (NRTIs), albeit at different degrees (40Menendez-Arias L. Virus Res. 2008; 134: 124-146Crossref PubMed Scopus (119) Google Scholar). TAMs include changes at positions 41, 67, 70, 210, 215, and 219 that were shown to increase the phosphorolytic excision of incorporated nucleotide analogues (41Goldschmidt V. Marquet R. Int. J. Biochem. Cell Biol. 2004; 36: 1687-1705Crossref PubMed Scopus (65) Google Scholar, 42Meyer P.R. Matsuura S.E. Mian A.M. So A.G. Scott W.A. Mol. Cell. 1999; 4: 35-43Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar). These mutations are able to recruit ATP as a PPi donor, which ultimately removes the inhibitor from the primer terminus and leads to the rescue of DNA synthesis. ETV may evade this resistance mechanism through delayed chain termination. Here, we demonstrate that delayed chain termination at position n + 3(i.e. three nucleotides following incorporation of ETV-MP) is the major mechanism of inhibition. Although ETV-MP is efficiently excised with TAMs containing RT enzymes, the inhibitor is not excised when the primer was extended by three additional nucleotides. These proof-of-principle studies show that delayed chain terminators are protected from excision. Enzymes and Nucleic Acids—Heterodimeric reverse transcriptase p66/p51 was expressed and purified as described (43Le Grice S.F. Cameron C.E. Benkovic S.J. Methods Enzymol. 1995; 262: 130-144Crossref PubMed Scopus (121) Google Scholar). Mutant enzymes were generated through site-directed mutagenesis using the Stratagene QuikChange kit according to the manufacturer's protocol. TAM refers to HIV1 RT containing the following substitutions: M41L, D67N, L210W, and T215Y. Oligodeoxynucleotides used in this study were chemically synthesized and purchased from Invitrogen and from Integrated DNA Technologies. The following sequences were used as templates: T45, 5′-ATTGAGTATGAAGGATTGATATCTATTCACTCCACTATACCACTC; T50, 5′-CCAATATTCACCATCAAGGCTTGACGTCACTTCACTCCACTATACCACTC; T50A, 5′-CCAATATTCACCATCAAGGCTTGACGTGACTTCACTCCACTATACCACTC; T50A6, 5′-CCAATATTCACCATCAAGGCTTGATGAAACTTCACTCCACTATACCACTC. The underlined nucleotides are the portion of the templates annealed to the primer. The following primers were used in this study: P1, 5′-GAGTGGTATAGTGGAGTGAA; P1b, 5′-GAGTGGTATAGTGGAGTGAATA; P2, 5′-ATTGAGTATGAAGGATTGAT. Synthesis of ETV-TP—2-Amino-9-[4-hydroxy-3-(hydroxymethyl)-2-methylidene-cyclopentyl]-3H-purin-6-one (4.71 mg, 1.7 mmol) was dissolved in 200 ml of dry 1,3-dimethyl-2-oxohexahydropyrimidine N,N′-dimethylpropylene urea with 15 molecular sieves under nitrogen and stirred for 24 h. The mixture was chilled with an ice-water bath and stirred for 1 h, followed by the slow addition of phosphorus oxychloride (3 eq) and stirred for another 50 min. A solution of tributylammonium pyrophosphate (4 eq) in 200 ;l of 1,3-Dimethyl-3,4,5,6-tetrahydro-2(1H)-pyrimidinone and tributyl amine (15 eq) were simultaneously added to the reaction. After 2 h, the reaction was quenched with ice-cold water and slowly brought to room temperature. The solution was washed with chloroform, and the aqueous layer was collected and co-evaporated with water three times. The product was resuspended in 100 ml of water and purified by high performance liquid chromatography (HPLC), followed by co-evaporation with water, giving a total yield of 9% with 98% purity. ETV-TP was finally purified by ion exchange HPLC. DNA Synthesis at Position n—150 nm DNA/DNA template-primer hybrid T50A/P1 was incubated with 50 nm of HIV-1 RT in a buffer containing 50 mm Tris-HCl, pH 7.8, 50 mm NaCl, in the presence of increasing concentrations of dGTP or ETV-TP or both. The concentrations of dGTP ranged from 0.008 to 2 ;m, and the concentrations of ETV-TP covered the range of 0.039–10 ;m in a series of 2-fold dilutions. In the experiments where both nucleotides were present, only ETV-TP concentrations were varied from 0.16 to 50 ;m in the series of 2-fold dilutions, whereas the concentration of dGTP was kept constant at 0.05, 0.1, or 0.5 ;m. Nucleotide incorporation was initiated by the addition of MgCl2 to a final concentration of 10 mm, and the reactions were allowed to proceed for 3 min. The reaction conditions were optimized such that the rate of the product formation was within its linear range with respect to the enzyme concentration and time point, which is consistent with the steady-state approach. The reactions were stopped by the addition of 3 reaction volumes of formamide containing traces of bromphenol blue and xylene cyanol. The samples were then subjected to 18% denaturing PAGE followed by phosphorimaging. The incorporation of single nucleotides was quantified as the fraction of the DNA substrate (template-primer) converted to product (template-primer + 1 nucleotide). The rate of the reaction was plotted versus the concentration of nucleotide substrate. The data were fitted to the Michaelis-Menten equation by use of GraphPad Prism (version 4.0) to determine Km and kcat values for dGTP and ETV-TP. Significant figures for the fitted data are as reported by the software. kcat was defined as the maximal rate of single nucleotide incorporation. Km was defined as the concentration of dNTP at which the rate of single nucleotide incorporation equals half of the maximal rate. In the experiments where both dGTP and ETV-TP were present for the incorporation at position n, the concentration of ETV-TP at which the incorporation of dGTP was reduced by 50% (IC50) was determined by plotting the percentage incorporation of dGTP versus the concentration of ETV-TP. The data were fit to a sigmoidal curve (variable slope). DNA Synthesis at Position n + 1—The reactions were conducted as described above, except that (i) T50A/P1 was used as the DNA/DNA hybrid, (ii) 1 ;m dGTP or 10 ;m ETV-TP was used for the incorporation at position n, and (iii) the time point was extended to 30 min to ensure maximum product formation at position n. Then increasing concentrations of dTTP from 0.02 to 2 ;m with n = dGMP and 0.078 to 10 ;m were allowed to proceed for 4 min. DNA Synthesis at Position n + 4—The reactions were conducted as described, except that (i) T50A6/P1 was used as the DNA/DNA hybrid and (ii) increasing concentrations of dCTP from 0.03 to 256 ;m were added in a series of 2-fold dilutions. Reactions were allowed to proceed for 4 min. In the experiment where dGTP, ETV-TP, dTTP, and dCTP were present at the same time, only dGTP concentrations were varied from 0.03 to 2 ;m, whereas the concentrations of ETV-TP, dTTP, and dCTP were kept constant at 5 and 0.5 ;m, respectively. In addition, the concentrations of HIV-RT and DNA substrate were adjusted to 100 nm, and the reactions were stopped after 5 min to enhance the signal at the pausing sites. Site-specific Footprinting—In preparation of the footprinting reaction, the 5′-end-labeled template T50A was heat-annealed with the primer P1. 50 nm DNA/DNA hybrid was incubated with 750 nm HIV-RT for 10 min in a reaction mixture containing sodium cacodylate, pH 7 (120 mm), NaCl (20 mm), DTT (0.5 mm), MgCl2 (10 mm), and 25 ;m ddGTP or ETV-TP in a final volume of 15 ;l. At the 10 min time point, increasing concentrations of foscarnet (PFA) or dTTP from 0.8 to 500 ;m were added to the reactions in a series of 5-fold dilutions, followed by an incubation of 5 min at 37 °C. The complex was treated with 0.1 mm ammonium Fe(II) sulfate hexahydrate (44Marchand B. Gotte M. J. Biol. Chem. 2003; 278: 35362-35372Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The reactions were allowed to proceed for 5 min and were processed and analyzed as described. Ribonuclease H (RNase H) Activity Assays—Primer P1, annealed to T50A or T50A6 templates, was extended by 2 or 4 nucleotides, respectively, such that dGMP or ETV-MP were incorporated at position n, followed by 1 or 3 more nucleotides. These primers with n = dGMP or ETV-MP were gel-purified and reannealed to T50A or T50A6 RNA templates, respectively. 3′-End-labeling with [32P]pCp and T4 RNA ligase was carried out as described (45Gotte M. Fackler S. Hermann T. Perola E. Cellai L. Gross H.J. Le Grice S.F. Heumann H. EMBO J. 1995; 14: 833-841Crossref PubMed Scopus (80) Google Scholar). The RNA/DNA hybrid (50 nm) was incubated with 750 nm HIV-RT in a reaction buffer containing 50 mm Tris-HCl, pH 7.8, 50 mm NaCl, and 0.3 mm EDTA at 37 °C for 10 min. Heparin (4 mg/ml, final) was added to the reaction mixture and allowed to incubate for variable time ranging from 0 to 60 s, after which MgCl2 (10 mm, final) was added to initiate the RNase H activity. The reactions were stopped by the addition of 3 reaction volumes of formamide containing traces of bromphenol blue and xylene cyanol. The samples were subjected to 18% denaturing PAGE, followed by phosphorimaging. RNase H activity was monitored and quantified based on the appearance of the 3′-end-labeled RNA template degradation products. RNase H-specific products were identified based on the experiments controlling for the efficiency of the heparin trap as well as for RNase H activity in the absence of MgCl2. The rate of the dissociation of the RNA/DNA hybrid from the RNase H active site of the HIV-1 RT (koff) was determined by plotting the percentage of remaining RNase H activity versus incubation time with heparin and fitting the data points to a single exponential decay function. Inhibition of DNA Synthesis with Primer-Templates Containing dGMP, ddGMP, or ETV-MP at the 3′-end of the primer—The rate constant (kcat) for dGTP incorporation using 150 nm T50A/P1 primer-template was determined from the slope of the linear portion of product formation versus time. Reactions were carried out in the presence of 50 nm HIV-RT and 1 ;m dGTP. The effect of the addition of 300 nm primer-templates already containing dGMP, ddGMP, or ETV-MP at the 3′-end of the primer on the kcat was monitored to assess potential differences in relative affinities of dGMP-, ddGMP-, or ETV-containing primer-templates. DNA Synthesis across a Template Containing ETV-MP—The T45/P1 RNA/DNA hybrid was used to generate a template containing ETV-MP. The RT-associated RNase H activity degraded the original T45 RNA template. The newly synthesized DNA template containing ETV-MP was annealed to 5′-end-labeled primer P2 and incubated with 500 nm HIV-1 RT in the presence of an MgCl2 (10 mm) and dNTP mix (0.5 ;m). Aliquots were taken at time points 1, 2, 5, 20 min, and data were processed and analyzed as described. ATP-dependent Phosphorolysis— The radiolabeled T50A6/P1 DNA/DNA hybrid was extended by a single nucleotide to generate an oligonucleotide with ETV-MP or dGMP at the 3′-end. Primers were also further extended by three residues, gel-purified, and annealed with T50A6. The 50 nm DNA/DNA template-primer hybrid with ETV-MP at the 3′-end of the primer or ETV-MP followed by an additional 3 nucleotides was incubated with 750 nm HIV-1 RT in a buffer containing 50 mm Tris-HCl, pH 7.8, 50 mm NaCl, 10 mm MgCl2, and 3.5 mm ATP (pyrophosphatase-treated). Aliquots were taken at time points 1, 3, 6, 12, 25, 40, and 60 min and analyzed as described. ETV-TP Is Able to Compete with dGTP—In order to assess the efficiency with which ETV-MP is incorporated in comparison with its natural counterpart dGMP, we determined the concentration of ETV-TP required for 50% inhibition (IC50) of incorporation of dGMP (Fig. S1). High resolution polyacrylamide gels allowed us to distinguish between primers extended by dGMP or ETV-MP, respectively (Fig. S1A). As expected for a competitive inhibitor, we found that the IC50 (ETV-TP) value increased with increasing concentrations of dGTP (Fig. S1B). Concentrations of dGTP as low as 0.5 ;m, which is within the physiologically relevant range, require relatively high concentrations of 19 ;m ETV-TP to obtain 50% inhibition. These data are in good agreement with steady-state kinetics that show 14–18-fold differences in efficiencies of incorporation (Table 1).TABLE 1Summary of the single nucleotide incorporation kinetic constants for HIV-RT at position n Km is in ;m dGTP or ETV-TP. kcat is in min–1. Selectivity is defined as a ratio of kcat/Km for dGTP over kcat/Km for ETV-TP. S.D. was determined on the basis of at least three independent experiments.SubstrateSelectivitydGTPETV-TPkcatKmkcat/KmkcatKmkcat/Kmmin–1;mmin–1;m0.51 ± 0.0680.041 ± 0.0075130.34 ± 0.110.45 ± 0.0750.7418 Open table in a new tab Incorporation of ETV-MP Causes Pausing at Positions n and n + 3— The effects of incorporation of ETV-MP at position n were analyzed by studying the efficiency of subsequent nucleotide incorporation events (Fig. 2). Enzyme pausing is evident at positions n and n + 3 and to a lesser extent also at position n + 2 (Fig. 2B). Pausing at positions n and n + 2 can be overcome, whereas pausing at position n + 3 represents the final product when DNA synthesis was limited to four nucleotide incorporation events (Fig. 2C). Increasing the concentrations of dCTP reduced pausing and resulted in increased product formation at position n + 4 (Fig. 2D). Thus, incorporation of ETV-MP appears to exert an immediate effect on the next nucleotide at position n + 1, and pausing at position n + 3 points to long range effects of the inhibitor that can affect nucleotide incorporation at position n + 4. To translate these findings into quantitative terms, we devised primer-template substrates that allowed us to determine the efficiency of nucleotide incorporation at positions n + 1 and n + 4. The primer strands contained either ETV-MP or dGMP at position n. Steady-state kinetics revealed that the incorporation of the next complementary nucleotide was ∼7-fold reduced when the primer was terminated with ETV-MP (Table 2). Nucleotide incorporation at position n + 4 was measured with primers that were further extended by 3 nucleotides to yield the n + 3 substrate. The measurements revealed substantially higher reductions (i.e. >1000-fold) in efficiency of nucleotide incorporation with ETV-MP at position n. Thus, inhibition at position n + 4 was more than 2 orders of mag
Referência(s)