Portal de Periódicos da CAPES

Mycobacterial Cells Have Dual Nickel-Cobalt Sensors

2007; Elsevier BV; Volume: 282; Issue: 44 Linguagem: Inglês

10.1074/jbc.m703451200

1083-351X

Duncan R. Campbell, Kaye E. Chapman, Kevin J. Waldron, Stephen Tottey, Sharon L. Kendall, Gabriele Cavallaro, Claudia Andreini, Jason Hinds, Neil G. Stoker, Nigel J. Robinson, Jim Cavet,

Corrosion Behavior and Inhibition

A novel ArsR-SmtB family transcriptional repressor, KmtR, has been characterized from mycobacteria. Mutants of Mycobacterium tuberculosis lacking kmtR show elevated expression of Rv2025c encoding a deduced CDF-family metal exporter. KmtR-dependent repression of the cdf and kmtR operator-promoters was alleviated by nickel and cobalt in minimal medium. Electrophoretic mobility shift assays and fluorescence anisotropy show binding of purified KmtR to nucleotide sequences containing a region of dyad symmetry from the cdf and kmtR operator-promoters. Incubation of KmtR with cobalt inhibits DNA complex assembly and metal-protein binding was confirmed. KmtR is the second, to NmtR, characterized ArsR-SmtB sensor of nickel and cobalt from M. tuberculosis suggesting special significance for these ions in this pathogen. KmtR-dependent expression is elevated in complete medium with no increase in response to metals, whereas NmtR retains a response to nickel and cobalt under these conditions. KmtR has tighter affinities for nickel and cobalt than NmtR consistent with basal levels of these metals being sensed by KmtR but not NmtR in complete medium. More than a thousand genes encoding ArsR-SmtB-related proteins are listed in databases. KmtR has none of the previously defined metal-sensing sites. Substitution of His88, Glu101, His102, His110, or His111 with Gln generated KmtR variants that repress the cdf and kmtR operator-promoters even in elevated nickel and cobalt, revealing a new sensory site. Importantly, ArsR-SmtB sequence groupings do not correspond with the different sensory motifs revealing that only the latter should be used to predict metal sensing. A novel ArsR-SmtB family transcriptional repressor, KmtR, has been characterized from mycobacteria. Mutants of Mycobacterium tuberculosis lacking kmtR show elevated expression of Rv2025c encoding a deduced CDF-family metal exporter. KmtR-dependent repression of the cdf and kmtR operator-promoters was alleviated by nickel and cobalt in minimal medium. Electrophoretic mobility shift assays and fluorescence anisotropy show binding of purified KmtR to nucleotide sequences containing a region of dyad symmetry from the cdf and kmtR operator-promoters. Incubation of KmtR with cobalt inhibits DNA complex assembly and metal-protein binding was confirmed. KmtR is the second, to NmtR, characterized ArsR-SmtB sensor of nickel and cobalt from M. tuberculosis suggesting special significance for these ions in this pathogen. KmtR-dependent expression is elevated in complete medium with no increase in response to metals, whereas NmtR retains a response to nickel and cobalt under these conditions. KmtR has tighter affinities for nickel and cobalt than NmtR consistent with basal levels of these metals being sensed by KmtR but not NmtR in complete medium. More than a thousand genes encoding ArsR-SmtB-related proteins are listed in databases. KmtR has none of the previously defined metal-sensing sites. Substitution of His88, Glu101, His102, His110, or His111 with Gln generated KmtR variants that repress the cdf and kmtR operator-promoters even in elevated nickel and cobalt, revealing a new sensory site. Importantly, ArsR-SmtB sequence groupings do not correspond with the different sensory motifs revealing that only the latter should be used to predict metal sensing. Tuberculosis is a leading killer worldwide causing 2 million deaths and 9 million new cases each year. It is estimated that one-third of the world's population is latently infected with Mycobacterium tuberculosis (1Ginsberg A.M. Kim M. Nat. Med. 2007; 13: 290-294Crossref PubMed Scopus (222) Google Scholar). This organism infects macrophages and somehow survives within phagosomes, despite the antimicrobial mechanisms in this compartment (2Warner D.F. Kim V. Nat. Med. 2007; 13: 282-284Crossref PubMed Scopus (60) Google Scholar). The action of natural resistance-associated macrophage protein 1 (Nramp1, alias SLC11A1) is one such phagosome mechanism that is effective against M. tuberculosis and must be evaded by the more virulent pathogens (3Malik S. Kim L. Tooker H. Poon A. Simkin L. Girard M. Adams G.J. Starke J.R. Smith K.C. Graviss E.A. Musser J.M. Schurr E. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 12183-12188Crossref PubMed Scopus (111) Google Scholar, 4Hoal E.G. Kim L.A. Jamieson S.E. Tanzer F. Rossouw M. Victor T. Hillerman R. Beyers N. Blackwell J.M. Van Helden P.D. Int. J. Tuberc. Lung Dis. 2004; 8: 1464-1471PubMed Google Scholar, 5Zhang W. Kim L. Weng X. Hu Z. Jin A. Chen S. Pang M. Chen Z.W. Clin. Infect. Dis. 2005; 40: 1232-1236Crossref PubMed Scopus (46) Google Scholar). Nramp1 is a divalent cation pump that is recruited to late endosomal-phagosomal membranes (6Jabado N. Kim A. Dougaparsad S. Picard V. Grinstein S. Gros P. J. Exp. Med. 2000; 192: 1237-1248Crossref PubMed Scopus (328) Google Scholar, 7Goswami T. Kim A. Babal P. Searle S. Moore E. Li M. Blackwell J.M. Biochem. J. 2001; 354: 511-519Crossref PubMed Scopus (189) Google Scholar). The metal substrates, direction of flux, and precise basis of pathogen killing by Nramp1 are not fully understood. To survive inside phagosomes M. tuberculosis must adapt to metal fluxes, and pathogen proteins involved in metal detection and homeostasis are known virulence factors (8Rodriguez G.M. Kim I. J. Bacteriol. 2006; 188: 424-430Crossref PubMed Scopus (187) Google Scholar, 9Manabe Y.C. Kim B.J. Sun L. Murphy J.R. Bishai W.R. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12844-12848Crossref PubMed Scopus (82) Google Scholar, 10Agranoff D. Kim S. Front. Biosci. 2004; 9: 2996-3006Crossref PubMed Scopus (53) Google Scholar). Sensors, such as ArsR-SmtB family repressors, detect surplus metal ions and modulate transcription of genes involved in metal uptake, efflux, sequestration, or detoxification (11Lucarelli D. Kim S. Garman E. Milano A. Meyer-Klaucke W. Pohl E. J. Biol. Chem. 2007; 282: 9914-9922Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 12Tottey S. Kim D.R. Robinson N.J. Acc. Chem. Res. 2005; 38: 775-783Crossref PubMed Scopus (135) Google Scholar). DNA binding by these sensors is weakened upon metal binding, alleviating repression in elevated metal (12Tottey S. Kim D.R. Robinson N.J. Acc. Chem. Res. 2005; 38: 775-783Crossref PubMed Scopus (135) Google Scholar). Genes encoding ArsR-SmtB sensors occur in many bacteria, but intriguingly the M. tuberculosis genome encodes an atypically large number (twelve identified by the Pfam data base, HTH_5 family). It is tempting to speculate that these proteins enable this pathogen to respond rapidly to metal-fluxes in the phagosome. Effectors for three of the M. tuberculosis sensors are known: Ni(II)-Co(II) for NmtR (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar), Cd(II)-Pb(II) for CmtR (14Cavet J.S. Kim A.I. Meng W. Robinson N.J. J. Biol. Chem. 2003; 278: 44560-44566Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), and Zn(II) for Rv2358 (herein designated MtSmtB) (15Canneva F. Kim M. Riccardi G. Provvedi R. Milano A. J. Bacteriol. 2005; 187: 5837-5840Crossref PubMed Scopus (38) Google Scholar). NmtR and CmtR regulate the nmt and cmt operator-promoters triggering expression of metal transporting P1-type ATPases (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 14Cavet J.S. Kim A.I. Meng W. Robinson N.J. J. Biol. Chem. 2003; 278: 44560-44566Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), while MtSmtB regulates the Rv2358-furB operon with FurB (Zur) acting as a sensor of Zn(II) deficiency (11Lucarelli D. Kim S. Garman E. Milano A. Meyer-Klaucke W. Pohl E. J. Biol. Chem. 2007; 282: 9914-9922Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). The effectors of the remaining nine M. tuberculosis sensors are unknown, concealing vital clues about the nature of metal adaptation by this pathogen. Indeed it is unclear at this time whether or not all of these proteins do detect metals. Prediction of the metals sensed by ArsR-SmtB homologues has often been crudely made, notably in databases, from overall sequence similarity to sensors for which effectors are known. In other bacteria these include: Zn(II) for SmtB and ZiaR (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 16Thelwell C. Kim N.J. Turner-Cavet J.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10728-10733Crossref PubMed Scopus (161) Google Scholar); As(III), Sb(III), and Bi(III) for ArsR (17Xu C. Kim W. Rosen B.P. J. Biol. Chem. 1996; 271: 2427-2432Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar); Cd(II), Pb(II), and Zn(II) for CadC and AztR (18Ye J. Kim A. Martin P. Rosen B.P. J. Bacteriol. 2005; 187: 4214-4221Crossref PubMed Scopus (77) Google Scholar, 19Liu T. Kim J.W. Giedroc D.P. Biochemistry. 2005; 44: 8673-8683Crossref PubMed Scopus (51) Google Scholar); Zn(II) and Co(II) for CzrA (20Singh V.K. Kim A. Usgaard T.R. Chakrabarti S. Deora R. Misra T.K. Jayaswal R.K. Mol. Microbiol. 1999; 33: 200-207Crossref PubMed Scopus (71) Google Scholar, 21Kuroda M. Kim H. Ohta T. Microbiol. Immunol. 1999; 43: 115-125Crossref PubMed Scopus (69) Google Scholar); and Cu(I), Ag(I), Zn(II), and Cd(II) for BmxR (22Liu T. Kim S. Hirose K. Shibasaka M. Katsuhara M. Ezaki B. Giedroc D.P. Kasamo K. J. Biol. Chem. 2004; 279: 17810-17818Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). Cyanobacterial SmtB was the first shown to be a winged helix homo-dimer with helices α3 and α4 predicted to form the DNA-associating helix-turn-helix (23Cook W.J. Kim S.R. Taylor K.B. Hall L.M. J. Mol. Biol. 1998; 275: 337-347Crossref PubMed Scopus (126) Google Scholar). In vitro and in vivo studies revealed two pairs of metal-binding sites per dimer: one pair associated with the α3 helices, including two ligands contributed by the amino-terminal region of the opposing monomer (α3N sites), and a second pair associated with carboxyl-terminal α5 helices (α5 sites) (24Turner J.S. Kim P.D. Samson A.C. R. Robinson N.J. Nucleic Acids Res. 1996; 24: 3714-3721Crossref PubMed Scopus (86) Google Scholar, 25VanZile M.L. Kim X. Giedroc D.P. Biochemistry. 2002; 41: 9776-9786Crossref PubMed Scopus (52) Google Scholar, 26Eicken C. Kim M.A. Chen X. Koshlap K.M. VanZile M.L. Sacchettini J.C. Giedroc D.P. J. Mol. Biol. 2003; 333: 683-695Crossref PubMed Scopus (113) Google Scholar). Site-directed mutagenesis established that only the α5 sites are required for inducer recognition (24Turner J.S. Kim P.D. Samson A.C. R. Robinson N.J. Nucleic Acids Res. 1996; 24: 3714-3721Crossref PubMed Scopus (86) Google Scholar, 25VanZile M.L. Kim X. Giedroc D.P. Biochemistry. 2002; 41: 9776-9786Crossref PubMed Scopus (52) Google Scholar). In contrast to SmtB, cysteine ligands associated with α3 helices (α3 sites) are required for inducer responsiveness of ArsR (27Shi W. Kim J. Scott R.A. Ksenzenko M.Y. Rosen B.P. J. Biol. Chem. 1996; 271: 9291-9297Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Further diversity in the effector-binding sites has been described as a "themes and variations" model (28Busenlehner L.S. Kim M.A. Giedroc D.P. FEMS Microbiol. Rev. 2003; 27: 131-143Crossref PubMed Scopus (322) Google Scholar), with variations known on at least three themes: (i) α3 with (CadC and AztR) or without (ArsR) aminoterminal ligands (19Liu T. Kim J.W. Giedroc D.P. Biochemistry. 2005; 44: 8673-8683Crossref PubMed Scopus (51) Google Scholar, 27Shi W. Kim J. Scott R.A. Ksenzenko M.Y. Rosen B.P. J. Biol. Chem. 1996; 271: 9291-9297Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 29Busenlehner L.S. Kim T.C. Penner-Hahn J.E. Giedroc D.P. J. Mol. Biol. 2003; 319: 685-701Crossref Scopus (92) Google Scholar), (ii) α5 with (NmtR) or without (SmtB and CzrA) additional carboxyl-terminal ligands (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 26Eicken C. Kim M.A. Chen X. Koshlap K.M. VanZile M.L. Sacchettini J.C. Giedroc D.P. J. Mol. Biol. 2003; 333: 683-695Crossref PubMed Scopus (113) Google Scholar), and (iii) direct metal binding at α4 helices with an additional ligand from the carboxyl terminus (CmtR) (14Cavet J.S. Kim A.I. Meng W. Robinson N.J. J. Biol. Chem. 2003; 278: 44560-44566Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Both α5 and α3N are obligatory for inducer recognition by the Zn(II) sensor ZiaR (16Thelwell C. Kim N.J. Turner-Cavet J.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10728-10733Crossref PubMed Scopus (161) Google Scholar). Permutations in the metal ligand sets (cysteinylthiol, histidine-imidazole, and glutamate/aspartate-carboxyl) and metal coordination geometries (trigonal, tetrahedral, and octahedral) influence which metals are sensed. At least two correct predictions of metal specificity of previously uncharacterized ArsR-SmtB sensors have been made based on deduced metal-sensing sites (30Harvie D.R. Kim C. Cavallaro G. Meng W. Connolly B.A. Yoshida K. Fujita Y. Harwood C.R. Radford D.S. Tottey S. Cavet J.S. Robinson N.J. Mol. Microbiol. 2006; 59: 1341-1356Crossref PubMed Scopus (37) Google Scholar). Do overall sequence similarity and deduced sensory sites always coincide and predict the same metal specificities? Are all of the possible sensory sites now known? Here we have reduced the catalogue of ArsR-SmtB homologues (in the Pfam HTH_5 family) from 1024 (30Harvie D.R. Kim C. Cavallaro G. Meng W. Connolly B.A. Yoshida K. Fujita Y. Harwood C.R. Radford D.S. Tottey S. Cavet J.S. Robinson N.J. Mol. Microbiol. 2006; 59: 1341-1356Crossref PubMed Scopus (37) Google Scholar) to an ensemble of 554 sequences by systematically excluding the most distant relatives. These form eight major groups based on sequence similarity. Importantly, several groups contain sequences with different metal-binding motifs. Furthermore, sequences that share the same metal-binding motif are scattered among different groups. The deduced product of M. tuberculosis Rv0827c (hereafter called kmtR) is grouped with NmtR, CmtR, and MtSmtB. KmtR lacks any of the previously described sensory sites. We generated a kmtR mutant of M. tuberculosis and used whole genome microarrays to identify KmtR-regulated genes. KmtR specifically binds to the promoter of Rv2025c (cdf), and its own promoter, but not of Rv0826, which also showed altered expression in the gene profiles. In complex medium KmtR- and MtSmtB-dependent gene expression is elevated and is not responsive to metals. However, in cells grown in metal-limited medium KmtR mediates repression of the cdf and kmtR promoters, and repression is alleviated only by elevated Ni(II) or Co(II), whereas MtSmtB-mediated repression is alleviated by Zn(II). For both proteins, metals corresponding to their in vivo effectors, Co(II) for KmtR and Zn(II) for MtSmtB, impaired DNA binding in vitro. Unexpectedly, KmtR represents the second Ni(II)/Co(II)-sensing ArsR-SmtB repressor, along with NmtR, in M. tuberculosis. However, in contrast to KmtR, NmtR retains Ni(II) and Co(II) responsiveness in the complex medium, which correlates with a lower affinity for these metals. Site-directed mutagenesis has defined the KmtR residues essential for detecting metals, and these compose an original sensory motif (designated α5-3). This motif is shared among a sub-group of sequences with no previously defined sensory site. Another sequence signature (α2α5) that is common to a large ArsR-SmtB sub-group, not known to detect metals, is also reported. Implications of these findings for identifying ArsR-SmtB metal sensors and correctly predicting the metals they detect are discussed, as are the properties of this new sensor especially in relation to metal adaptation by a devastating pathogen. Bacterial Strains, Culture Conditions, and DNA Manipulations—M. tuberculosis H37Rv was used as the parental strain to construct the kmtR mutant and for microarray experiments. Mycobacterium smegmatis mc2155 and Mycobacterium bovis BCG 4The abbreviations used are: BCG, Bacille Calmette-Guérin; DTT, dithiothreitol; PAR, 4-(2-pyridylazo)resorcinol. (Pasteur) were used as mycobacterial hosts for reporter gene assays. Cells were grown at 37 °C with shaking (M. smegmatis and M. bovis) or rolling (M. tuberculosis) in Middlebrook 7H9 medium (Difco) containing 0.05% Tween 80 and 10% oleic acid/albumin/dextrose/catalase enrichment (Difco) or on 7H10 agar medium supplemented with 0.5% glycerol and 10% oleic acid/albumin/dextrose/catalase enrichment. For some reporter gene assays (refer to individual experiments) cells were grown in Sauton medium, supplemented with 0.025% tyloxapol (Sigma), that had been treated overnight at 4 °C with Chelex 100 resin (10 g liter-1) prior to filtration, the addition of MgSO4 (2 mm) and sterilization. Elemental analysis of the media by inductively coupled plasma mass spectrometry revealed: 2.760 and 0.296 μm zinc, 3.078 and 0.027 μm copper, 0.031 and 0.053 μm nickel, 0.012 and 0.005 μm cobalt, 134.981 and 113.099 μm iron, and 0.057 and 0.061 μm manganese in Middlebrook 7H9 media and Chelex-treated Sauton media, respectively. Hygromycin (50 μgml-1) and kanamycin (25 μgml-1) were added where appropriate. Escherichia coli strains JM109 (Stratagene) and BL21(DE3) were used and grown at 37 °C in Luria-Bertani broth and agar containing hygromycin (150 μgml-1), kanamycin (50 μgml-1), or carbenicillin (200 μg ml-1) where appropriate. Cells were transformed to antibiotic resistance as described previously (31Sambrook J. Kim E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar, 32Timm J. Kim E.M. Gicquel B. J. Bacteriol. 1994; 176: 6749-6753Crossref PubMed Google Scholar). All generated plasmid constructs were checked by sequence analysis. Generation of a kmtR Mutant—M. tuberculosis genomic DNA was used as template for PCR with primers I (5′-GAAAAGCTTACCAACGGCACGCACC-3′) and II (5′-GAATCTAGAGGTCCACTATCTGCGTAC-3′) or III (5′-GAATCTAGACCTTAGGGCAGTAGTGCG-3′) and IV (5′-GAAGCGGCCGCTGGGTTACGAATCGCC-3′) to amplify 1024 bp of kmtR upstream sequences (including the first seven codons of kmtR) and 944 bp of kmtR downstream sequences, respectively, and the products were ligated into pGEM-T (Promega, Madison, WI). The kmtR upstream sequences were excised from pGEM-T and ligated into the HindIII/SalI site of p2NIL (33Parish T. Kim N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (409) Google Scholar) to generate p2NIL0827A. The kmtR downstream sequences were then excised and ligated into the XbaI/NotI site of p2NIL0827A, generating p2NIL0827B. A hyg-lacZ-sacB marker cassette from pGOAL19 (33Parish T. Kim N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (409) Google Scholar) was ligated into the PacI site of p2NIL0827B to form the final deletion construct p2NIL0827C. M. tuberculosis mutant selection was performed as described (33Parish T. Kim N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (409) Google Scholar), and deletion of 425 bp, which includes kmtR (but retaining the first seven codons), was confirmed by PCR and Southern blot analyses (31Sambrook J. Kim E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). RNA Extraction, cDNA Labeling, and Microarray Experiments—RNA was extracted from exponential phase cultures, labeled cDNA and DNA produced by incorporation of either Cy3 or Cy5 dCTP (Amersham Biosciences), and hybridizations on M. tuberculosis H37Rv whole genome PCR-product microarrays (Bacterial Microarray Group at St George's: TBv2.1.1; ArrayExpress accession no.: A-BUGS-23) performed as previously described (34Stewart G.R. Kim L. Stabler R. Mangan J.A. Hinds J. Laing K.G. Young D.B. Butcher P.D. Microbiology. 2002; 148: 3129-3138Crossref PubMed Scopus (295) Google Scholar). Three independent RNA samples were used, and hybridizations were performed in duplicate in competition with labeled genomic DNA. Feature extraction was performed with ImaGene v5.5 (BioDiscovery), and data from multiple photomultiplier amplification settings were processed using the MAVI Pro 2.6.0 software (MWG Biotech). Statistical analyses were performed using Genespring GX v7 (Agilent Technologies) by analysis of variance one-way analysis with a Benjamini and Hochberg false discovery rate of 0.05. Cloning, Expression, and Purification of M. tuberculosis KmtR, MtSmtB, and NmtR—The kmtR and MtsmtB coding regions were amplified from M. tuberculosis genomic DNA, using primers V (5′-CATATGTACGCAGATAGTGGACCTGACCCGTTGCC-3′) and VI (5′-CCGAATTCTTATTACCCGACATCCTTGGTAGCCG-3′) for kmtR or VII (5′-CATATGGTGACGTCCCCCTCAACG-3′) and VIII (5′-GAATTCTCATATTGCGTCCTCACCGGCGTGCGC-3′) for MtsmtB, ligated to pGEM-T prior to sub-cloning into the NdeI/EcoRI sites of pET29a (Novagen). The proteins were expressed in E. coli BL21(DE3) for 4 h at 37 °C using 1.0 mm or 0.5 mm isopropyl 1-thio-β-d-galactopyranoside for KmtR and MtSmtB, respectively. Crude cell lysates were prepared in buffer A (10 mm HEPES, pH 7.8, 1 mm EDTA, 1 mm DTT, 4The abbreviations used are: BCG, Bacille Calmette-Guérin; DTT, dithiothreitol; PAR, 4-(2-pyridylazo)resorcinol. and 50 mm NaCl) and applied to a Heparin-affinity column (CL-4B Amersham Biosciences) pre-equilibrated with buffer A, and bound proteins were eluted using a linear gradient to 1 m NaCl. KmtR-containing fractions were then diluted to 50 mm NaCl in 20 mm Tris, pH 8.8, 1 mm EDTA, 1 mm DTT and concentrated using a HiTrap Q HP anion-exchange column (Amersham Biosciences), washed with 20 mm Tris, pH 8.8, 50 mm NaCl, and eluted with 400 mm NaCl (this anion-exchange step was omitted during MtSmtB purification). Fractions containing KmtR or MtSmtB were then applied to a Superdex 75 size-exclusion column (Amersham Biosciences) pre-equilibrated in buffer A containing 200 mm NaCl, prior to concentration using a HiTrap Q HP column. The column was washed with 20 mm Tris, pH 8.8, 50 mm NaCl (for KmtR) or 20 mm HEPES, pH 7.8 (for MtSmtB), and protein was eluted with 400 mm NaCl. NmtR was expressed and purified essentially as described previously (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). Gel-retardation Assays—Operator-promoter regions were amplified from M. tuberculosis genomic DNA, using primers IX (5′-TACCGGTTCCGGCAGGAACCC-3′) and X(5′-CACCAAGCAGACCTGATC-3′) for PkmtR, XI(5′-GAAGGATCCGGTGATCGTCGTCCGTCC-3′) and XII (5′-GGTACCATCGGGCGCAGGCCCTTTG-3′) for Pcdf, or XIII (5′-GAAGGATCCAAGGGGACACCGGACCAG-3′) and XIV (5′-GAAGGTACCGTATCTTGGGTCACTGGTGG-3′) for PRv0286, and ligated to pGEM-T. Truncated versions of the cdf operator-promoter region were also amplified using primers XI and XV (5′-GACCACCAAGCAAGCTC-3′) for T1, primers XV and XVI (5′-CCGGCGAGAGCATCCGC-3′) for T2, and primers XI and XVII (5′-GATGCTCTCGCCGGTTC-3′) for T3, and ligated to pGEM-T. Competitor DNA and the various operator-promoter regions were amplified from re-circularized pGEM-T or the operator-promoter constructs with primers designed to anneal to the plasmid backbone either site of the cloning site (14Cavet J.S. Kim A.I. Meng W. Robinson N.J. J. Biol. Chem. 2003; 278: 44560-44566Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Equal quantities of target and competitor DNA were then used in binding reactions (30Harvie D.R. Kim C. Cavallaro G. Meng W. Connolly B.A. Yoshida K. Fujita Y. Harwood C.R. Radford D.S. Tottey S. Cavet J.S. Robinson N.J. Mol. Microbiol. 2006; 59: 1341-1356Crossref PubMed Scopus (37) Google Scholar). Products were separated on native 9% polyacrylamide gels in TBE buffer (0.089 m Tris, 0.089 m boric acid, 0.002 m EDTA) at 4 °C, stained with ethidium bromide, and visualized under UV light. Analyses of Nickel, Zinc, and Cobalt Binding—Microtiter plate competition analyses were performed using 2 μm protein incubated with up to 10 μm metal in 10 mm HEPES, pH 7.8, 250 mm NaCl, 1 mm DTT, for 30 min at room temperature, followed by addition of the metallochromic indicator 4-(2-pyridylazo)resorcinol (PAR). PAR-bound metal was detected at 492 nm in a microtiter plate reader. Control reactions lacking protein were performed in parallel. Analysis of metal binding via tryptophan (KmtR) or tyrosine (NmtR) fluorescence was performed using a 1-cm light path, 1-ml cell with a Carey Eclipse fluorescence spectrometer. Fluorescence Anisotropy Analysis of Protein-DNA Interaction—Complementary oligonucleotides were produced corresponding to regions of dyad symmetry within PkmtR (5′-TCTATTGTTTGCGTATGTACGCAGATAGTGGA-3′), Pcdf (5′-CGCTATTATCTGCGTATGAATGCAGATAAAAGAG-3′), PRv0286 (5′-TCCATAGTGACAACGTGCGTAGTCAGAATTCG-3′), and PMtsmtB (5′-CTTTGACATGCATCATCATGCATGTGACAG-3′). One oligonucleotide of each pair was 5′-labeled with 6-hexachlorofluorescein, and complementary pairs were annealed in 10 mm HEPES, pH 7.8, 150 mm NaCl, by heating to 95 °C followed by cooling slowly to 10 °C. For standard reactions, protein was desalted into anisotropy buffer (10 mm HEPES, pH 7.8, 250 mm NaCl) containing 1 mm DTT using a Sephadex G25 column (Amersham Biosciences), and binding reactions were performed by adding increasing concentrations of protein to 5 nm double-stranded DNA, in anisotropy buffer with 1 mm DTT, in a 1-ml quartz cuvette (10-mm path length). To examine the effects of metal ions on DNA binding, the protein was desalted into anisotropy buffer using a Sephadex G25 column in an anaerobic chamber and incubated overnight at 4 °C under anaerobic conditions with Co(II), Zn(II), or 1 mm EDTA. A gas-tight Hamilton syringe was then used to add increasing concentrations of protein to anaerobic cuvettes containing DNA in anisotropy buffer with 1 mm EDTA or a molar excess of Co(II) or Zn(II). The anisotropy of the solution was measured using an 8100 fluorometer (SLM-Aminco, Urbana, IL) (30Harvie D.R. Kim C. Cavallaro G. Meng W. Connolly B.A. Yoshida K. Fujita Y. Harwood C.R. Radford D.S. Tottey S. Cavet J.S. Robinson N.J. Mol. Microbiol. 2006; 59: 1341-1356Crossref PubMed Scopus (37) Google Scholar). Construction of Promoter-lacZ Fusions, Site-directed Mutagenesis, and β-Galactosidase Assays—kmtR upstream sequences and coding region (1378 bp) were amplified from M. tuberculosis genomic DNA, using primers XVIII (5′-GAAGTCGACGACACTCGTCGCGAGATCC-3′) and XIX (5′-GAAGGATCCAAGCTTCACTACTGCCCTAAGGTCTGACC-3′), and ligated to pGEM-T generating pGEM-TkmtR.Pcdf (159 bp) was amplified using primers XX (5′-GAAAAGCTTGGTGATCGTCGTCCGTCC-3′) and XXI (5′-GAAGGATCCATCGGGCGCAGGCCCTTTG-3′) and ligated into the HindIII/BamHI site of pGEM-TkmtR, immediately downstream of kmtR, generating pGEM-TkmtR-Pcdf. The kmtR and Pcdf sequences were then released and ligated into the ScaI/BamHI site of pJEM15 (32Timm J. Kim E.M. Gicquel B. J. Bacteriol. 1994; 176: 6749-6753Crossref PubMed Google Scholar) creating pJEM15kmtR-Pcdf. QuikChange mutagenesis (Stratagene) was subsequently used to generate derivatives of pJEM15kmtR-Pcdf with codon substitutions in kmtR: Met24 to a UAG stop codon; Glu41, Glu101, His88, His102, His110, and His111 to Gln, Asp95 to Ala, and Cys16 to Ser. To generate a construct with kmtR fused to lacZ (pJEM15kmtR), QuikChange was used to introduce a BamHI site immediately after the kmtR stop codon in pJEM15kmtR-Pcdf, Pcdf was released, and the construct was re-ligated. Constructs pJEM15kmtR-tT4-Pcdf and pJEM15kmtR-tT4-PRv0286 were also generated containing the transcriptional terminator of coliphage T4 (tT4) immediately downstream of kmtR. For the former, tT4 was amplified using primers XXII (5′-GCCAAGCTTATGACCTTTAATAGATTATATTACTAATTAATTGGGGACCCTAGAGGTC-3′) and XXIII (5′-GCCAAGCTTTATGCTTGTAAACCG-3′) with pJEM15 as template and ligated into the HindIII site of pGEM-TkmtR-Pcdf, between kmtR and Pcdf. The kmtR, tT4, and Pcdf sequences were then released and ligated into the ScaI/BamHI site of pJEM15. For pJEM15kmtR-tT4-PRv0286, an SnaBI site was introduced at the 5′-end of the kmtR sequences in pGEM-TkmtR, creating pGEM-TkmtR2, and a fragment containing tT4 and PRv0286 was amplified from M. tuberculosis DNA with a primer incorporating the tT4 sequence (5′-GCCTACGTAAAGCTTATGACCTTTAATAGATTATATTACTAATTAATTGGGGACCCTAGGGTCCCCTTTTTTATTTTAAAAATTTTTTCACAAAACGGTTTACAAGCATAAAGGGGACACCGGACCAGCGG-3′) and primer XIV, and ligated into the HindIII/BamHI site of pGEM-TkmtR2, immediately downstream of kmtR. The DNA fragment containing kmtR, tT4, and PRv0286 was released and ligated into the ScaI/BamHI site of pJEM15. Derivatives of pJEM15kmtR, pJEM15kmtR-tT4-Pcdf, and pJEM15kmtR-tT4-PRv0286 were also generated in which Met24 within kmtR was substituted with a UAG stop codon by QuikChange. To construct an MtsmtB-lacZ fusion, M. tuberculosis DNA was used as template with primers 5′-GAAGATATCACTCCCTTCGAGGGATCG-3′ and 5′-GAAGGATCCGGACACCGGCTGCACTC-3′, and the amplification product was ligated to pGEM-T prior to subcloning into the ScaI/BamHI site of pJEM15. The lacZ fusion constructs were introduced into M. smegmatis mc2155 or M. bovis BCG. M. smegmatis mc2155 containing nmtR and the nmtA operator-promoter in pJEM15 (13Cavet J.S. Kim W. Pennella M.A. Appelhoff R.J. Giedroc D.P. Robinson N.J. J. Biol. Chem. 2002; 277: 38441-38448Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) was also used to