13-cis Retinoic Acid Inhibits Development and Progression of Chronic Allograft Nephropathy
2005; Elsevier BV; Volume: 167; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)62973-2
ISSN1525-2191
AutoresJudith E. Adams, Éva Kiss, Ana Belén Vicente Arroyo, Mahnaz Bonrouhi, Qiang Sun, Zhen Li, Norbert Gretz, Anna Schnitger, Christos C. Zouboulis, M. Wiesel, Jürgen Wagner, Peter J. Nelson, Hermann-Josef Gröne,
Tópico(s)Pregnancy and Medication Impact
ResumoChronic allograft nephropathy is characterized by chronic inflammation and fibrosis. Because retinoids exhibit anti-proliferative, anti-inflammatory, and anti-fibrotic functions, the effects of low and high doses of 13-cis-retinoic acid (13cRA) were studied in a chronic Fisher344→Lewis transplantation model. In 13cRA animals, independent of dose (2 or 20 mg/kg body weight/day) and start (0 or 14 days after transplantation) of 13cRA administration, serum creatinine was significantly lower and chronic rejection damage was dramatically reduced, including subendothelial fibrosis of preglomerular vessels and chronic tubulointerstitial damage. The number of infiltrating mononuclear cells and their proliferative activity were significantly diminished. The mRNA expression of chemokines (MCP-1/CCL2, MIP-1α/CCL3, IP-10/CXCL10, RANTES/CCL5) and proteins associated with fibrosis (plasminogen activator inhibitor-1, transforming growth factor-β1, and collagens I and III) were strikingly lower in treated allografts. In vitro, activated peritoneal macrophages of 13cRA-treated rats showed a pronounced decrease in protein secretion of inflammatory cytokines (eg, tumor necrosis factor-α, interleukin-6). The suppression of the proinflammatory chemokine RANTES/CCL5 × 13cRA in fibroblasts could be mapped to a promoter module comprising IRF-1 and nuclear factor-κB binding elements, but direct binding of retinoid receptors to promoter elements could be excluded. In summary, 13cRA acted as a potent immunosuppressive and anti-fibrotic agent able to prevent and inhibit progression of chronic allograft nephropathy. Chronic allograft nephropathy is characterized by chronic inflammation and fibrosis. Because retinoids exhibit anti-proliferative, anti-inflammatory, and anti-fibrotic functions, the effects of low and high doses of 13-cis-retinoic acid (13cRA) were studied in a chronic Fisher344→Lewis transplantation model. In 13cRA animals, independent of dose (2 or 20 mg/kg body weight/day) and start (0 or 14 days after transplantation) of 13cRA administration, serum creatinine was significantly lower and chronic rejection damage was dramatically reduced, including subendothelial fibrosis of preglomerular vessels and chronic tubulointerstitial damage. The number of infiltrating mononuclear cells and their proliferative activity were significantly diminished. The mRNA expression of chemokines (MCP-1/CCL2, MIP-1α/CCL3, IP-10/CXCL10, RANTES/CCL5) and proteins associated with fibrosis (plasminogen activator inhibitor-1, transforming growth factor-β1, and collagens I and III) were strikingly lower in treated allografts. In vitro, activated peritoneal macrophages of 13cRA-treated rats showed a pronounced decrease in protein secretion of inflammatory cytokines (eg, tumor necrosis factor-α, interleukin-6). The suppression of the proinflammatory chemokine RANTES/CCL5 × 13cRA in fibroblasts could be mapped to a promoter module comprising IRF-1 and nuclear factor-κB binding elements, but direct binding of retinoid receptors to promoter elements could be excluded. In summary, 13cRA acted as a potent immunosuppressive and anti-fibrotic agent able to prevent and inhibit progression of chronic allograft nephropathy. Chronic allograft nephropathy (CAN) is an important cause of graft loss in renal transplantation.1Häyry P Aavik E Savolainen H Mechanisms of chronic rejection.Transplant Proc. 1999; 31: 5S-8SAbstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 2Kouwenhoven EA Ijzermans JNM de Bruin RWE Etiology and pathophysiology of chronic transplant dysfunction.Transpl Int. 2000; 13: 385-401Crossref PubMed Google Scholar It is a complex disease resulting from interactions between humoral and cellular immune responses and nonimmunological factors.1Häyry P Aavik E Savolainen H Mechanisms of chronic rejection.Transplant Proc. 1999; 31: 5S-8SAbstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 2Kouwenhoven EA Ijzermans JNM de Bruin RWE Etiology and pathophysiology of chronic transplant dysfunction.Transpl Int. 2000; 13: 385-401Crossref PubMed Google Scholar, 3Libby P Pober JS Chronic rejection.Immunity. 2001; 14: 387-397Abstract Full Text Full Text PDF PubMed Scopus (368) Google Scholar Clinically, CAN is manifested by a gradual deterioration of renal function often accompanied by hypertension and proteinuria. Histopathologically, it is characterized by hyalinosis and fibrosis of preglomerular vessels, transplant glomerulopathy, glomerulosclerosis, interstitial fibrosis with a variable degree of mononuclear cell infiltrate, and tubular atrophy.2Kouwenhoven EA Ijzermans JNM de Bruin RWE Etiology and pathophysiology of chronic transplant dysfunction.Transpl Int. 2000; 13: 385-401Crossref PubMed Google Scholar, 3Libby P Pober JS Chronic rejection.Immunity. 2001; 14: 387-397Abstract Full Text Full Text PDF PubMed Scopus (368) Google Scholar The cellular and molecular mechanisms involved in development of CAN have not been elucidated in detail. A number of proinflammatory and fibrogenic mediators such as interleukin (IL)-1, interferon (IFN)-γ, transforming growth factor (TGF)-β, platelet-derived growth factor, endothelin, and angiotensin II are thought to be involved in various stages of the chronic inflammatory and reparative process.1Häyry P Aavik E Savolainen H Mechanisms of chronic rejection.Transplant Proc. 1999; 31: 5S-8SAbstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar There are indications that chemokines such as RANTES/CCL5 and IP-10/CXCL10 also contribute to chronic rejection.4Haskell CA Ribeiro S Horuk R Chemokines in transplant rejection.Curr Opin Investig Drugs. 2002; 3: 399-405PubMed Google Scholar These proteins are synthesized and secreted by both tissue-infiltrating inflammatory cells as well as by activated graft parenchymal cells.3Libby P Pober JS Chronic rejection.Immunity. 2001; 14: 387-397Abstract Full Text Full Text PDF PubMed Scopus (368) Google Scholar It may be postulated that master switches or transcription factors regulate this inflammatory network. The anti-inflammatory and anti-proliferative actions of retinoids (derivatives of vitamin A) have long been known.5Chambon P A decade of molecular biology of retinoic acid receptors.FASEB J. 1996; 10: 940-954Crossref PubMed Scopus (2606) Google Scholar, 6Zouboulis CC Orfanos CE Retinoids.in: Millikan LE Drug Therapy in Dermatology. Marcel Dekker, New York2000: pp 171-233Google Scholar Retinoids have predominantly been used for treatment of hyperplastic skin disease or hematopoietic malignancies (eg, leukemias).6Zouboulis CC Orfanos CE Retinoids.in: Millikan LE Drug Therapy in Dermatology. Marcel Dekker, New York2000: pp 171-233Google Scholar Retinoids act via specific nuclear retinoic acid (RAR) and retinoid X (RXR) receptors, with α, β, and γ subtypes. These receptors are broadly expressed in the rat and human kidney7Yang T Michele DE Park J Smart AM Lin Z Brosius III, FC Schnermann JB Briggs JP Expression of peroxisomal proliferator-activated receptors and retinoid X receptors in the kidney.Am J Physiol. 1999; 277: F966-F973PubMed Google Scholar as well as by immunocompetent cells such as B and T cells and monocytes/macrophages.8Orosz CG Zinn NE Bishop DK Leppink DL Faherty D Ferguson RM Analysis of retinoid-mediated immunosuppression in vivo. Effects of Ro-23-6457 on cellular alloimmune responses.Immunopharmacology. 1991; 22: 49-58Crossref PubMed Scopus (7) Google Scholar, 9Kreutz M Fritsche J Ackermann U Krause S Andreesen R Retinoic acid inhibits monocyte to macrophage survival and differentiation.Blood. 1998; 91: 4796-4802PubMed Google Scholar The retinoid receptors regulate expression of target genes either by direct binding to retinoic acid response elements or indirectly by influencing other transcription factors such as AP-1 (activator protein-1),10Simonson MS Anti-AP-1 activity of all-trans retinoic acid in glomerular mesangial cells.Am J Physiol. 1994; 267: F805-F815PubMed Google Scholar NF-κB (nuclear factor-κB),11Na SY Kang BY Chung SW Han SJ Ma X Trinchieri G Im SY Lee JW Kim TS Retinoids inhibit interleukin-12 production in macrophages through physical associations of retinoid X receptor and NFκB.J Biol Chem. 1999; 274: 7674-7680Crossref PubMed Scopus (220) Google Scholar and CREB (cAMP-responsive element binding protein).12Chakravarti D LaMorte VJ Nelson MC Nakajima T Schulman IG Juguilon H Montminy M Evans RM Role of CBP/P-300 in nuclear receptor signalling.Nature. 1996; 383: 99-103Crossref PubMed Scopus (851) Google Scholar In experimental models of glomerulonephritis, retinoids have recently been shown to inhibit the proliferation of mesangial cells, lower the number of infiltrating monocytes, and reduce extracellular matrix deposition without signs of vitamin A toxicity.13Schaier M Lehrke I Schade K Morath CH Shimizu F Kawachi H Gröne HJ Ritz E Wagner J Isotretinoin alleviates renal damage in rat chronic glomerulonephritis.Kidney Int. 2001; 60: 2222-2234Crossref PubMed Scopus (34) Google Scholar, 14Lehrke I Schaier M Schade K Morath C Waldherr R Ritz E Wagner J Retinoid receptor-specific agonists alleviate experimental glomerulonephritis.Am J Physiol. 2002; 282: F741-F751Google Scholar In addition, retinoids have been shown to positively influence arterial remodeling after balloon catheter injury by reducing neointimal formation.15Miano JM Kelly LA Artacho CA Nuckolls TA Piantedosi R Blaner WS All-trans-retinoic acid reduces neointimal formation and promotes favorable geometric remodeling of the rat carotid artery after balloon withdrawal injury.Circulation. 1998; 98: 1219-1227Crossref PubMed Scopus (83) Google Scholar In an animal model of vein grafting, intimal hyperplasia was inhibited by a retinoid derivative.16Leville CD Dassow MS Seabrook GR Jean-Claude JM Towne JB Cambria RA All-trans retinoic acid decreases vein graft intimal hyperplasia and matrix metalloproteinase activity in vivo.J Surg Res. 2000; 90: 183-190Abstract Full Text PDF PubMed Scopus (24) Google Scholar We have previously observed that 13-cis-retinoic acid (13cRA) ameliorated rejection phenomena and preserved graft function in acute models of renal transplantation.17Kiss E Adams J Grone HJ Wagner J Isotretinoin ameliorates renal damage in experimental acute renal allograft rejection.Transplantation. 2003; 76: 480-489Crossref PubMed Scopus (36) Google Scholar Based on these results we postulated that retinoids could prevent or moderate CAN. In addition, the potent anti-proliferative actions of retinoids led us to propose that early stages of CAN might be reversed through treatment. We examined the effects of two doses of 13cRA, a retinoic acid derivative currently in clinical use,6Zouboulis CC Orfanos CE Retinoids.in: Millikan LE Drug Therapy in Dermatology. Marcel Dekker, New York2000: pp 171-233Google Scholar in chronic models of rat renal transplantation. Using doses of 13cRA that correspond to those used in humans significant preservation of renal function, morphology, inhibition of immune cell infiltration and proliferation, and reduction in intragraft, inflammatory cytokine/chemokine expression was observed. Male inbred Lewis (LEW, RT11Häyry P Aavik E Savolainen H Mechanisms of chronic rejection.Transplant Proc. 1999; 31: 5S-8SAbstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar) and Fisher (F344, RT11v1) rats were purchased from Charles River GmbH, Sulzfeld, Germany. Lewis rats were used as recipients of Fisher kidney allografts. The donors as well as the recipients weighed ∼200 to 220 g at time of renal transplantation. Animal experimentation was performed according to German laws on animal protection. Transplantation was performed under ether drop anesthesia. The left kidney of the donor rat was isolated, perfused with ice-cold isotonic sodium chloride solution, excised, and transplanted orthotopically into a weight-matched Lewis recipient. In the recipient, the left renal vein and artery were mobilized and clamped, the ureter was cut and the left kidney was excised. End-to-end anastomosis of renal vessels and of ureter, without ureteral stenting, were performed with 10-0 nonabsorbable nylon sutures. Total ischemic time of the donor kidney varied between 30 and 45 minutes. All transplant kidneys with hydronephrosis, which was evaluated both macroscopically and by light microscopy, were excluded from the experimental groups. In a first set of experiments, animals were randomly allocated to five experimental groups. Two placebo groups—placebo-14 days (n = 9) and placebo-56 days (n = 17), Fisher to Lewis allografts fed with standard rat cow for 2 and 8 weeks, respectively; two prevention groups: LD-8 weeks group (n = 11) and HD-8 weeks group (n = 10), in which animals were treated with low-dose (LD) and high-dose (HD), respectively, 13cRA for 8 weeks starting at the day of renal transplantation and two therapy groups: LD-6 weeks group (n = 8) and HD-6 weeks group (n = 9), in which rats were treated with low, respectively, HD-13cRA for 6 weeks starting at day 14 after transplantation, when chronic damage could already be seen. The LD of isotretinoin was 2 mg/kg body weight/day and the HD 20 mg/kg body weight/day, administered orally. None of the recipients was treated with any other immunosuppressant. In the first set of experiments the native contralateral (right) kidney was kept in situ as an internal control for the renal effects of 13cRA. The experimental set-up is schematically shown in Figure 1. In the second set of experiments, performed for determination of graft function the native contralateral (right) kidney was excised at day 49, and renal function tests were performed at day 56 after renal transplantation; three groups were compared placebo group (n = 5), LD-8 weeks group (n = 5), and HD-8 weeks group (n = 5). To improve homogeneity and oxidative stability, 13cRA (F. Hoffmann-La Roche, Basel, Switzerland) was first incorporated into a lactose-gelatin granular carrier substance including 5% ascorbic acid (Sigma-Aldrich, Deisenhofen, Germany) using a wet granulation method.13Schaier M Lehrke I Schade K Morath CH Shimizu F Kawachi H Gröne HJ Ritz E Wagner J Isotretinoin alleviates renal damage in rat chronic glomerulonephritis.Kidney Int. 2001; 60: 2222-2234Crossref PubMed Scopus (34) Google Scholar Rats were fed after 6 p.m. when lights were turned off. Animals were pair-fed to ascertain comparable calorie intake in placebo- and 13cRA-treated animals. The rats had free access to tap water. Systolic blood pressure was determined at weeks 2, 4, and 6 after renal transplantation by tail cuff plethysmography under light ether anesthesia.18Gröne HJ Helmchen U Impairment and recovery of the clipped kidney in two kidney, one clip hypertensive rats during and after antihypertensive therapy.Lab Invest. 1986; 54: 645-655PubMed Google Scholar Blood samples were obtained at the time of sacrifice and serum creatinine (enzymatic method), urea nitrogen, calcium, glutamic oxaloacetic transaminase, glutamic pyruvic transaminase, and alkaline phosphatase were determined with a Hitachi 911 autoanalyzer (Roche, Mannheim, Germany). Under dimmed yellow light, isopropanol (1.5 ml) was added to plasma samples (0.5 ml, 3:1 v:v).16Leville CD Dassow MS Seabrook GR Jean-Claude JM Towne JB Cambria RA All-trans retinoic acid decreases vein graft intimal hyperplasia and matrix metalloproteinase activity in vivo.J Surg Res. 2000; 90: 183-190Abstract Full Text PDF PubMed Scopus (24) Google Scholar After vortexing for 5 minutes at room temperature and centrifugation (5000 rpm, 10 minutes), the supernatant was diluted 1:3 (v:v) with 2% ammonium acetate. Samples were loaded on C2 cartridges (ICT, Bad Homburg, Germany) that were preconditioned with 3.4 ml of methanol followed by 0.6 ml of 2% ammonium acetate solution. After loading, the cartridges were washed with 3 ml of 15% acetonitril/85% in 0.5% ammonium acetate. Samples were extracted in 250 μl of methanol and stored in amber light glass tubes at −20°C until used for high performance liquid chromatography analysis.19Collins MD Eckhoff C Chahoud I Bochert G Nau H 4-Methylpyrazole partially ameliorated the teratogenicity of retinol and reduced the metabolic formation of all-trans-retinoic acid in the mouse.Arch Toxicol. 1992; 66: 652-659Crossref PubMed Scopus (92) Google Scholar, 20Tsukada M Schröder M Roos TC Chandraratna RAS Reichert U Merk HF Orfanos CE Zouboulis CHC 13-cis retinoic acid exerts its specific activity on human sebocytes through selective intracellular isomerization to all-trans retinoic acid and binding to retinoid acid receptors.J Invest Dermatol. 2000; 115: 321-327Crossref PubMed Scopus (166) Google Scholar At sacrifice organs (kidneys, heart, lung, thymus, liver, spleen, pancreas, femur) were quickly blotted free of blood, weighed (with the exception of lung, thymus, pancreas), and processed as needed for histology, immunohistology, and molecular analysis. For histology the organs were cut into 1-mm slices and either immersion-fixed in 4% formaldehyde in phosphate-buffered saline (PBS) pH 7.35 (PBS: 99 mmol/L NaH2PO4, 108 mmol/L NaH2PO4, and 248 mmol/L NaCl) for 24 hours at 4°C, or fixed in Methacarn (60% methanol, 30% chloroform, 10% acetic acid) for 8 hours and then embedded in paraffin. In addition tissue slices were frozen in liquid nitrogen and stored at −80°C, until used for immunohistology or RNA isolation. Light microscopy was performed on 3-μm sections stained by periodic acid-Schiff, hematoxylin and eosin, and Goldner trichrome. Morphometric evaluation of acute rejection and chronic damage was done according to the Banff classification.21Racusen LC Solez K Colvin RB Bonsib SM Castro MC Cavallo T Croker BP Demetris AJ Drachenberg CB Fogo AB Furness P Gaber LW Gibson IW Glotz D Goldberg JC Grande J Halloran PF Hansen HE Hartley B Hayry PJ Hill CM Hoffman EO Hunsicker LG Lindblad AS Yamaguchi Y The Banff 97 working classification of renal allograft pathology.Kidney Int. 1999; 55: 713-723Crossref PubMed Scopus (2783) Google Scholar In addition results were corroborated by a different evaluation scheme as has been described.17Kiss E Adams J Grone HJ Wagner J Isotretinoin ameliorates renal damage in experimental acute renal allograft rejection.Transplantation. 2003; 76: 480-489Crossref PubMed Scopus (36) Google Scholar, 22Hermann M Shaw S Kiss E Camici G Buhler N Chenevard R Luscher TF Grone HJ Ruschitzka F Selective COX-2 inhibitors and renal injury in salt-sensitive hypertension.Hypertension. 2005; 45: 193-197Crossref PubMed Scopus (54) Google Scholar, 23Scheuer H Gwinner W Hohbach J Grone EF Brandes RP Malle E Olbricht CJ Walli AK Grone HJ Oxidant stress in hyperlipidemia-induced renal damage.Am J Physiol. 2000; 278: F63-F74PubMed Google Scholar Glomerulosclerosis was defined as 0, no sclerosis; 0.5, sclerosis of less than 25% of capillary loops; 1, sclerosis of 26 to 50% of the capillary loops; 2, sclerosis of 51 to 75% of the capillary loops; 3, sclerosis of more than 75% of the capillary loops. Glomerulosclerosis score was calculated as the sum of all specific injury indices, whereby the index of glomeruli with degree 0.5 was multiplied by 0.5, that of degree 1 × 1, that of degree 2 × 2, that of degree 3 × 3 (see Supplemental Table A and Supplemental Figures A-E at http://ajp.amjpathol.org). Chronic tubulointerstitial damage was defined as broadening of the basement membrane of the tubuli with flattened epithelium, tubular atrophy, and interstitial matrix increase. It was evaluated as 0.5, focal chronic damage and 1, diffuse chronic damage. Tubulointerstitial damage was judged in 20 high-power fields of cortex (objective, ×40), and the tubulointerstitial damage score was calculated as described for the glomerulosclerosis score. In addition, morphometric analysis was performed using a semiautomatic image analyzing system (Leica Q600; Qwin, Cambridge, UK), to evaluate the chronic changes in preglomerular vessels, glomeruli, and tubulointerstitium. All cross-section of arteries from each kidney were examined (×40 objective). To measure fibrointimal changes a ratio was calculated between the surface having as outline the lamina elastica interna and the free luminal area. Mesangial matrix increases were determined by point-counting method. The results were expressed as a fraction of glomerular surface area in 50 glomeruli. Chronic tubulointerstitial changes were expressed as a percentage of the total tubulointerstitial area, obtained after exclusion of glomeruli in 20 fields (objective, ×20) of cortex and outer stripe of outer medulla. Immunohistochemical staining was performed on 3-μm sections of paraffin-embedded tissue, using mouse anti-rat monoclonal antibodies against ED1 (Serotec, Oxford, UK) to demonstrate monocytes/macrophages in Methacarn-fixed tissues, CD8 (Serotec) to define cytotoxic T cells, Ki67-clone MIP 5 (Dianova, Hamburg, Germany) for the detection of proliferating cells. The last two antibodies were applied to formaldehyde-fixed and microwave-treated tissue sections. An alkaline phosphatase anti-alkaline phosphatase detection system was applied for visualization (DAKO, Hamburg, Germany). Glomerular-positive cells were counted in at least 50 glomerular cross sections and given as the mean per glomerular section; interstitial-positive cells were counted in 20 high-power fields (×40) of cortex and outer medulla and recorded as mean per high-power field. To localize collagens, streptavidin-biotin-enhanced horseradish peroxidase immunostaining was performed, using rabbit anti-rat polyclonal antibodies against collagen I (Biogenesis, Poole, UK) and collagen III (Chemicon, Temecula, CA). The extent of the staining was evaluated as 0, no staining detectable; 1, faint; 2, moderate; and 3, intense staining. A degree-specific staining index was defined as the percentage of the fields with the respective degree of staining in 20 high-power fields of cortex and outer medulla. The staining score was calculated as the sum of the specific staining indices, whereby the index of the fields with degree 1 was multiplied by 1, that of degree 2 × 2, that of degree 3 × 3. Controls, omitting the first antibody or replacing the first antibody by a respective mouse or rabbit nonimmune IgG, for each paraffin block tested were negative. Total RNA was extracted by the method of Chomczynski and Sacchi.24Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63232) Google Scholar RNA quality was monitored by agarose electrophoresis. Ten μg of the total RNA were used for the first-strand cDNA synthesis with Superscript II reverse transcriptase and oligo d(T)12–18 primer (LifTechnologies, Karlsruhe, Germany). RT-PCR products from three animals per group were obtained: 1, control group, nontransplanted Fisher344 rat kidneys; 2, placebo; and 3, LD-8 weeks groups from the first set of experiments. Real-time PCR was performed by LightCycler using the LightCycler-FastStart DNA Master SYBR Green I kit (Roche Diagnostics, Mannheim, Germany). The primer sequences for target genes used in this study are shown in Table 1. Gene expression of 12 genes was investigated by LightCycler as described.25Porubsky S Schmid H Bonrouhi M Kretzler M Malle E Nelson PJ Grone HJ Influence of native and hypochlorite-modified low-density lipoprotein on gene expression in human proximal tubular epithelium.Am J Pathol. 2004; 164: 2175-2187Abstract Full Text Full Text PDF PubMed Scopus (42) Google ScholarTable 1Sequences of Primers Used in This StudyGene:Gene bank accession numberSense (5′ → 3′)Anti-sense (5′ → 3′)Amplicon (bp)IP-10/CXCL10(U22520)AAAGCGGTGAGCCAAAGAAGAGGAGAAACAGGGACAGTTAGG150MCP-1/CCL2(M57441)GCTGACCCCAATAAGGAATGGTTGTGGAAAAGAGAGTGGATG176RANTES/CCL5(U06436)TGCTGCTTTGCCTACCTCTCCTTGAACCCACTTCTTCTCTGG151MIP-1α/CCL3(U06435)CTATGGACGGCAAATTCCACAGGCATTCAGTTCCAGCTC167TGF-β1(X52498)GCAACACGTAGAACTCTACCCCCTGTATTCCGTCTCCTTG153HO-1(J02722)AACACAAAGACCAGAGTCCCACTGAGTGTGAGGACCCATC158PAI-1(M24067)TTTGTGTTCCAGTCACACTCATCTGTCTATCTGCTGCCC153GAPDH(M17701)AACATCATCCCTGCATCCACCTGCTTCACCACCTTCTTG180Collagen I(Z78279)GCAACATGGAGACAGGTCAGCCTTCGCTTCCATACTCGAAC154Collagen III(X70369)GCCTCCCAGAACATTACATACCTGCAGCCATCCTCTAGAAC162Interferon-γ(AF010466)GCGTCTTGGTTTTGCAGCTCACCGTCCTTTTGCCAGTTCC170IL-10(X60675)AAAGCAAGGCAGTGGAGCAGCGCCGGGTGGTTCAATTTTTC145 Open table in a new tab Thioglycolate (3%, w/v; 10 ml) was injected intraperitoneally in two groups of Lewis rats (n = 6 rats/group), pretreated for 14 days with 13cRA (2 mg/kg body weight/day) and placebo, respectively. After 72 hours peritoneal macrophages were harvested with 40 ml of RPMI containing 10% fetal calf serum. Cells were seeded at 1 × 106 per well and incubated for 6 hours in RPMI medium containing 1% streptomycin/penicillin, 1% l-glutamine, and 25 mmol/L Hepes without stimuli. Cells and supernatants were then harvested for protein analyses. Protein expressions of IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-10, GM-CSF (granulocyte-macrophage colony-stimulating factor), tumor necrosis factor-α (TNF-α), and IFN-γ were determined by Bio-Plex cytokine assay (Bio-Rad Laboratories, Munich, Germany) according to the manufacturer's instructions. Supernatant values were referred to the total cellular protein as determined by Lowry and colleagues.26Lowry OH Rosebrough NJ Farr AL Randall RJ Protein measurement with the folin phenol reagent.J Biol Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar Normal adult human dermal fibroblasts (NHDF6447; BioWhittaker, Europe) and the cell line K4 (cell line of fibroblasts immortalized with SV40 virus) were incubated in Dulbecco's modified Eagle's medium (Life Technologies, Inc., Grand Island, NY) with 10% heat-inactivated fetal calf serum. Cells were used between passages 3 to 9. For induction of RANTES/CCL5 production the cells were trypsinized and seeded in a 96-well plate (enzyme-linked immunosorbent assay) or a 6-well plate (TaqMan RT-PCR) for 24 hours in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Then the medium was replaced with fetal calf serum-free medium, followed by further incubation of the cells for 48 hours. After this time the stimulation of both fibroblasts and K4 cells was performed. In dose-response experiments, maximal stimulation was found at 25 or 50 ng/ml TNF-α and 50 ng/ml IFN-γ (Peprotech, Inc.) (data not shown). Real-time RT-PCR was performed on a TaqMan ABI 7700 sequence detection system (PE Biosystems, Weiterstadt, Germany) using the procedure as described.27Cohen CD Grone HJ Gröne EF Nelson PJ Schlöndorff D Kretzler M Laser microdissection and gene expression analysis on formaldehyde-fixed archival tissue.Kidney Int. 2002; 61: 125-132Crossref PubMed Scopus (88) Google Scholar Sequences with following gene bank accession numbers served for the design of a predeveloped TaqMan assay: AF043341 (human RANTES/CCL5), F439522 (human IP-10/CXCL10), and M33197 (human GAPDH) as housekeeping gene. All of these assay reagents did not amplify genomic DNA samples. Controls consisting of ddH2O were negative in all runs. Measurement of RANTES/CCL5 protein was performed using the Duo Set ELISA development system (R&D). This assay uses the quantitative sandwich immunoassay technique. The minimum detectable concentration of RANTES/CCL5 was 32.5 pg/ml. Deletions and site-specific mutants of the human RANTES/CCL5 promoter sequence were based on previously described pGL3-based plasmid constructs (pGL3; Promega, Madison, WI).27Cohen CD Grone HJ Gröne EF Nelson PJ Schlöndorff D Kretzler M Laser microdissection and gene expression analysis on formaldehyde-fixed archival tissue.Kidney Int. 2002; 61: 125-132Crossref PubMed Scopus (88) Google Scholar, 28Fessele S Boehlk S Mojaat A Miyamoto NG Werner T Nelson EL Schlondorff D Nelson PJ Molecular and in silico characterization of a promoter module and C/EBP element that mediate LPS-induced RANTES/CCL5 expression in monocytic cells.FASEB J. 2001; 15: 577-579PubMed Google Scholar, 29Boehlk S Fessele S Mojaat A Miyamoto NG Werner T Nelson EL Schlöndorff D Nelson PJ ATF and Jun transcription factors, acting through an Ets/CRE promoter module mediate lipopolysaccharide inducibility of the chemokine RANTES in monocytic Mono Mac 6 cells.Eur J Immunol. 2000; 30: 1102-1112Crossref PubMed Scopus (55) Google Scholar The tk-Renilla plasmid (Promega) was used to normalize transfection data. Per data point, 5 × 105 of proliferating K4 cells were transfected using Superfect Reagent (Qiagen, Hilden, Germany). Three hours after transfection, the cells were stimulated with TNF-α (Peprotech, Inc.) for 24 hours, with or without 10−5 mol/L 13cRA. The Dual-Luciferase reporter assay (Promega) was performed as described. The results are presented as a ratio of Photinus/Renilla-Luciferase and are representative of more than three experiments. Dermal fibroblasts were stimulated with TNF-α (25 ng/ml) and/or IFN-γ (50 ng/ml) for 2 and 12 hours, and nuclear protein was isolated by using the high-salt extraction method with small modifications.28Fessele S Boehlk S Mojaat A Miyamoto NG Werner T Nelson EL Schlondorff D Nelson PJ Molecular and in silico characterization of a promoter module and C/EBP element that mediate LPS-induced RANTES/CCL5 expression in monocytic cells.FASEB J. 2001; 15: 577-579PubMed Google Scholar, 29Boehlk S Fessele S Mojaat A Miyamoto NG Werner T Nelson EL Schlöndorff D Nelson PJ ATF and Jun transcription factors, acting through an Ets/CRE promoter module mediate lipopolysaccharide inducibility of the chemokine RANTES in monocytic Mono Mac 6 cells.Eur J Immunol. 2000; 30: 1102-1112Crossref PubMed Scopus (55) Google Scholar For EMSA, 2.5 μg of nuclear protein were incuba
Referência(s)