Angiotensin II (AT1) Receptor Blockade Reduces Vascular Tissue Factor in Angiotensin II-Induced Cardiac Vasculopathy
2000; Elsevier BV; Volume: 157; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)64523-3
ISSN1525-2191
AutoresDominik N. Müller, Eero Mervaala, Ralf Dechend, Anette Fiebeler, Joon-Keun Park, Folke Schmidt, Jürgen Theuer, Volker Breu, Nigel Mackman, Thomas Luther, Wolfgang Schneider, Dietrich C. Gulba, Detlev Ganten, Hermann Haller, Friedrich C. Luft,
Tópico(s)Coagulation, Bradykinin, Polyphosphates, and Angioedema
ResumoTissue factor (TF), a main initiator of clotting, is up-regulated in vasculopathy. We tested the hypothesis that chronicin vivo angiotensin (ANG) II receptor AT1receptor blockade inhibits TF expression in a model of ANG II-induced cardiac vasculopathy. Furthermore, we explored the mechanisms by examining transcription factor activation and analyzing the TF promoter. Untreated transgenic rats overexpressing the human renin and angiotensinogen genes (dTGR) feature hypertension and severe left ventricular hypertrophy with focal areas of necrosis, and die at age 7 weeks. Plasma and cardiac ANG II was three- to fivefold increased compared to Sprague-Dawley rats. Chronic treatment with valsartan normalized blood pressure and coronary resistance completely, and ameliorated cardiac hypertrophy (P < 0.001). Valsartan prevented monocyte/macrophage infiltration, nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activation, and c-fos expression in dTGR hearts. NF-κB subunit p65 and TF expression was increased in the endothelium and media of cardiac vessels and markedly reduced by valsartan treatment. To analyze the mechanism of TF transcription, we then transfected human coronary artery smooth muscle cells and Chinese hamster ovary cells overexpressing the AT1 receptor with plasmids containing the human TF promoter and the luciferase reporter gene. ANG II induced the full-length TF promoter in both transfected cell lines. TF transcription was abolished by AT1 receptor blockade. Deletion of both AP-1 and NF-κB sites reduced ANG II-induced TF gene transcription completely, whereas the deletion of AP-1 sites reduced transcription. Thus, the present study clearly shows an aberrant TF expression in the endothelium and media in rats with ANG II-induced vasculopathy. The beneficial effects of AT1 receptor blockade in this model are mediated via the inhibition of NF-κB and AP-1 activation, thereby preventing TF expression, cardiac vasculopathy, and microinfarctions. Tissue factor (TF), a main initiator of clotting, is up-regulated in vasculopathy. We tested the hypothesis that chronicin vivo angiotensin (ANG) II receptor AT1receptor blockade inhibits TF expression in a model of ANG II-induced cardiac vasculopathy. Furthermore, we explored the mechanisms by examining transcription factor activation and analyzing the TF promoter. Untreated transgenic rats overexpressing the human renin and angiotensinogen genes (dTGR) feature hypertension and severe left ventricular hypertrophy with focal areas of necrosis, and die at age 7 weeks. Plasma and cardiac ANG II was three- to fivefold increased compared to Sprague-Dawley rats. Chronic treatment with valsartan normalized blood pressure and coronary resistance completely, and ameliorated cardiac hypertrophy (P < 0.001). Valsartan prevented monocyte/macrophage infiltration, nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activation, and c-fos expression in dTGR hearts. NF-κB subunit p65 and TF expression was increased in the endothelium and media of cardiac vessels and markedly reduced by valsartan treatment. To analyze the mechanism of TF transcription, we then transfected human coronary artery smooth muscle cells and Chinese hamster ovary cells overexpressing the AT1 receptor with plasmids containing the human TF promoter and the luciferase reporter gene. ANG II induced the full-length TF promoter in both transfected cell lines. TF transcription was abolished by AT1 receptor blockade. Deletion of both AP-1 and NF-κB sites reduced ANG II-induced TF gene transcription completely, whereas the deletion of AP-1 sites reduced transcription. Thus, the present study clearly shows an aberrant TF expression in the endothelium and media in rats with ANG II-induced vasculopathy. The beneficial effects of AT1 receptor blockade in this model are mediated via the inhibition of NF-κB and AP-1 activation, thereby preventing TF expression, cardiac vasculopathy, and microinfarctions. Tissue factor (TF), a 47-kd transmembrane protein, initiates the extrinsic pathway of coagulation via formation of an enzymatic complex with factor VII/factor VIIa. TF’s constitutive expression by mesenchymal cells residing in the adventitial lining of blood vessels normally precludes its interaction with factor VII in plasma, but allows activation of coagulation when the endothelium is damaged.1Edgington TS Mackman N Brand K Ruf W The structural biology of expression and function of tissue factor.Thromb Haemost. 1991; 66: 67-79Crossref PubMed Scopus (532) Google Scholar TF also possesses biological functions independent of the clotting cascade. TF is expressed by myocardial cells and plays an important role in embryogenesis2Bugge TH Xiao Q Kombrinck KW Flick MJ Holmback K Danton MJ Colbert MC Witte DP Fujikawa K Davie EW Degen JL Fatal embryonic bleeding events in mice lacking tissue factor, the cell-associated initiator of blood coagulation.Proc Natl Acad Sci USA. 1996; 93: 6258-6263Crossref PubMed Scopus (293) Google Scholar, 3Luther T Flossel C Mackman N Bierhaus A Kasper M Albrecht S Sage EH Iruela Arispe L Grossmann H Strohlein A Zhang Y Nawroth PP Carmeliet P Loskutoff DJ Muller M Tissue factor expression during human and mouse development.Am J Pathol. 1996; 149: 101-113PubMed Google Scholar, 4Carmeliet P Mackman N Moons L Luther T Gressens P Van Vlaenderen I Demunck H Kasper M Breier G Evrard P Muller M Risau W Edgington T Collen D Role of tissue factor in embryonic blood vessel development.Nature. 1996; 383: 73-75Crossref PubMed Scopus (589) Google Scholar, 5Toomey JR Kratzer KE Lasky NM Broze Jr, GJ Effect of tissue factor deficiency on mouse and tumor development.Proc Natl Acad Sci USA. 1997; 94: 6922-6926Crossref PubMed Scopus (82) Google Scholar and promotes vascularization of tumors,6Zhang Y Deng Y Luther T Muller M Ziegler R Waldherr R Stern DM Nawroth PP Tissue factor controls the balance of angiogenic and antiangiogenic properties of tumor cells in mice.J Clin Invest. 1994; 94: 1320-1327Crossref PubMed Scopus (469) Google Scholar cell adhesion, and cell migration.7Randolph GJ Luther T Albrecht S Magdolen V Muller WA Role of tissue factor in adhesion of mononuclear phagocytes to and trafficking through endothelium in vitro.Blood. 1998; 92: 4167-4177Crossref PubMed Google Scholar Inflammatory cell infiltration to extravascular sites is an important component of the host response to a variety of stimuli, such as ischemia, bacterial infection, tumor deposits, and atherosclerotic plaques. The surface TF expression as well as release of macrophage products serve to coordinate the local inflammatory responses. Fibrin deposition induced by macrophage TF8Clark EA Brugge JS Integrins and signal transduction pathways: the road taken.Science. 1995; 268: 233-239Crossref PubMed Scopus (2824) Google Scholar expression contributes to inflammation. Monocyte adherence to the endothelium stimulates TF expression. This process most likely contributes to local microvascular thrombosis.9Lo SK Cheung A Zheng Q Silverstein RL Induction of tissue factor on monocytes by adhesion to endothelial cells.J Immunol. 1995; 154: 4768-4777PubMed Google Scholar TF expression in cultured cells occurs in response to a variety of stimuli (eg, lipopolysaccharides, tumor necrosis factor-α, phorbol-12-myristate 13-acetate (PMA), and ANG II),10Cui MZ Parry GC Edgington TS Mackman N Regulation of tissue factor gene expression in epithelial cells. Induction by serum and phorbol 12-myristate 13-acetate.Arterioscler Thromb. 1994; 14: 807-814Crossref PubMed Scopus (42) Google Scholar, 11Bierhaus A Zhang Y Deng Y Mackman N Quehenberger P Haase M Luther T Muller M Bohrer H Greten J Martin E Baeuerle PA Waldherr R Kisiel W Ziegler R Stern DM Nawroth PP Mechanism of the tumor necrosis factor alpha-mediated induction of endothelial tissue factor.J Biol Chem. 1995; 270: 26419-26432Crossref PubMed Scopus (123) Google Scholar, 12Brisseau GF Dackiw AP Cheung PY Christie N Rotstein OD Posttranscriptional regulation of macrophage tissue factor expression by antioxidants.Blood. 1995; 85: 1025-1035Crossref PubMed Google Scholar, 13Hall AJ Vos HL Bertina RM Lipopolysaccharide induction of tissue factor in THP-1 cells involves Jun protein phosphorylation and nuclear factor kappaB nuclear translocation.J Biol Chem. 1999; 274: 376-383Crossref PubMed Scopus (57) Google Scholar, 14Orthner CL Rodgers GM Fitzgerald LA Pyrrolidine dithiocarbamate abrogates tissue factor (TF) expression by endothelial cells: evidence implicating nuclear factor-kappa B in TF induction by diverse agonists.Blood. 1995; 86: 436-443Crossref PubMed Google Scholar, 15Taubmam MB Marmur JD Rosenfield CL Guha A Nichtberger S Nemerson Y Agonist-mediated tissue factor expression in cultured vascular smooth muscle cells: role of Ca2+ mobilization and protein kinase C activation.J Clin Invest. 1993; 91: 547-552Crossref PubMed Scopus (163) Google Scholarbut until now no evidence has been presented that TF is generated in ANG II-induced cardiac vasculopathy in vivo. Because ANG II may use similar signaling pathways as lipopolysaccharides, tumor necrosis factor-α, and PMA in vivo, it is quite likely that TF is also induced by ANG II through the angiotensin II (AT1) receptor, followed by a subsequent activation of the transcription factors nuclear factor-κB (NF-κB) and activator protein-1 (AP-1).10Cui MZ Parry GC Edgington TS Mackman N Regulation of tissue factor gene expression in epithelial cells. Induction by serum and phorbol 12-myristate 13-acetate.Arterioscler Thromb. 1994; 14: 807-814Crossref PubMed Scopus (42) Google Scholar, 16Mackman N Morrissey JH Fowler B Edgington TS Complete sequence of the human tissue factor gene, a highly regulated cellular receptor that initiates the coagulation protease cascade.Biochemistry. 1989; 28: 1755-1762Crossref PubMed Scopus (187) Google Scholar Orthner et al14Orthner CL Rodgers GM Fitzgerald LA Pyrrolidine dithiocarbamate abrogates tissue factor (TF) expression by endothelial cells: evidence implicating nuclear factor-kappa B in TF induction by diverse agonists.Blood. 1995; 86: 436-443Crossref PubMed Google Scholar demonstrated that inhibition of NF-κB after stimulation with various agonists resulted in reduced TF activity in endothelial cells. We investigated the effect of AT1 receptor blockade on the binding activity of NF-κB and AP-1, as well as TF expression in a model of ANG II-induced cardiac vasculopathy. Our findings demonstrate that ANG II mediates its effect on vascular TF via the AT1 receptor, followed by the subsequent activation of NF-κB and AP-1. Four-week-old dTGR were divided into two groups, control (n = 26) and valsartan (n= 16) groups. Valsartan was given for 3 weeks by gavage once a day (10 mg/kg). Control dTGR and normotensive Sprague-Dawley (SD) rats (n = 15) rats received vehicle (1% sodium carboxymethylcellulose). The dTGR line and characteristics are described elsewhere.17Bohlender J Fukamizu A Lippoldt A Nomura T Dietz R Menard J Murakami K Luft FC Ganten D High human renin hypertension in transgenic rats.Hypertension. 1997; 29: 428-434Crossref PubMed Google Scholar The rats were purchased from Biological Research Laboratories Ltd (Füllinsdorf, Switzerland) and were allowed free access to standard 0.3% sodium rat chow (SSNIFF Spezialitäten GmbH, Soest, Germany) and drinking water. The procedures were approved by the local Council on Animal Care (permit no. G408/97), whose standards correspond to those of the American Physiological Society. Systolic blood pressure was measured weekly by tail cuff under light ether anesthesia, 20 hours after the last drug dose, starting at age 5 weeks. The rats were killed at age 7 weeks. Blood samples for hormone analysis were drawn by aortic puncture into pre-chilled tubes containing EDTA (6.25 mmol/L) and phenantroline (26 mmol/L) as anticoagulant and inhibitor of ANG II breakdown in vitro, respectively. Remikiren (10 μmol/L) was added to plasma samples for ANG II measurement to prevent ANG II formation in vitro. The hearts were washed with ice-cold saline, weighed, frozen in liquid nitrogen, and stored at −80°C until assayed. Transgenic rats (n = 5 or 6 in each group) were heparinized and anesthetized with thiopental (150 mg/kg rat, i.p.). Once the rat was deeply anesthetized, the heart was removed by sternectomy and placed in iced Krebs-Henseleit buffer. The heart was cannulated immediately via the aorta and retrograde perfusion was performed in a Langendorff apparatus under constant flow (10 ml/min) with a modified Krebs-Henseleit solution with the following composition: NaCl, 114.7 mmol/L; KCl, 4.7 mmol/L; MgSO4, 1.2 mmol/L; KH2PO4, 1.5 mmol/L; NaHCO3, 25 mmol/L; CaCl2, 2.5 mmol/L; and glucose, 11.1 mmol/L. The solution was gassed with 95% O2/5% CO2 and adjusted to pH 7.4. Coronary effluent was measured by an electromagnetic flow meter (Narcomatic RT 500, Narco BioSystems Inc., Houston, TX). A high fidelity microtip catheter was inserted via the aorta into the left ventricles to measure heart rate and left ventricular pressure. Protocols were started after 15 minutes’ equilibration perfusion. The coronary effluent was collected for 20 minutes into pre-chilled tubes containing the same inhibitor cocktail as was used for plasma ANG II measurements. The Ang II was extracted from the perfusate by reversible adsorption to octadecylsilyl-silica cartridges (Sep-Pak C18, Waters, Milford, MA) separated by high performance liquid chromatography and quantified by direct radioimmunoassay. For immunohistochemistry, the hearts were cut, snap-frozen in isopentane (−35°C), and stored at −80°C. Frozen specimens were cryosectioned at 6 μm thickness and air-dried. The sections were fixed with cold acetone, air-dried, and washed with Tris-buffered saline (TBS; 0.05 mol/L Tris buffer, 0.15 mol/L NaCl, pH 7.6). The sections were incubated for 60 minutes in a humid chamber at room temperature with primary monoclonal antibodies against rat monocytes/macrophages (ED1; Serotec, Oxford, UK), NF-κB subunit p65 (Roche Boehringer, Mannheim, Germany), VLA-4 (TA-4, Pharmingen, San Diego, CA), and the polyclonal tissue factor antibody, and fibronectin (Paesel & Lorei, Frankfurt, Germany). The p65 antibody recognizes an epitope overlapping the nuclear location signal of p65 subunit and therefore selectively stains released, activated NF-κB after dissociation of its inhibitor I-κBα.18Zabel U Henkel T Silva MS Baeuerle PA Nuclear uptake control of NF-kappa B by MAD-3, an I kappa B protein present in the nucleus.EMBO J. 1993; 12: 201-211Crossref PubMed Scopus (272) Google Scholar After washing with TBS, the sections were incubated with a bridging antibody (rabbit-anti-mouse IgG; Dako, Hamburg, Germany) for 30 minutes at room temperature and washed again with TBS. The alkaline phosphatase-anti-alkaline phosphatase complex (Dako, Hamburg, Germany) was applied, and the sections were incubated for 30 minutes at room temperature. The immunoreactivity was visualized by development in a mixture of naphtol-AS-BI-phosphate (Sigma, Deisenhofen, Germany) with neufuchsin (Merck, Darmstadt, Germany). Endogenous alkaline phosphatase was blocked by addition of 10 mmol/L levamisole (Sigma, Deisenhofen, Germany) to the substrate solution. The sections were slightly counter stained in Mayer’s hemalaun (Merck), blued in tap water, and mounted with GelTol (Coulter-Immunotech, Hamburg, Germany). Preparations were examined under a Zeiss Axioplan-2 microscope (Zeiss, Jena, Germany) and photographed using a color reversal film Agfa CTX 100. Semiquantitative scoring of ED-1-positive cells in the heart was performed using computerized cell count program (KS 300 3.0, Zeiss). Fifteen different areas of each heart samples (n = 5 in both groups) were analyzed. The heart samples were examined without knowledge of the rats’ identity. Tissue extracts and EMSA were performed as described earlier.19Dechend R Maass M Gieffers J Dietz R Scheidereit C Leutz A Gulba DC Chlamydia pneumoniae infection of vascular smooth muscle and endothelial cells activates NF-kappaB and induces tissue factor and PAI-1 expression: a potential link to accelerated arteriosclerosis.Circulation. 1999; 100: 1369-1373Crossref PubMed Scopus (228) Google Scholar Briefly, frozen total hearts were pulverized in liquid nitrogen with a pestle and mortar, and resuspended in 3 ml 50 mmol/L Tris, pH 7.4, containing a Complete protease inhibitor tablet (Roche Boehringer) and 1 mmol/L Na-ortho-vanadate (Sigma). The suspension was centrifuged (4000 × g, 5 minutes, 4°C). The pellet was resuspended and lysed for 30 minutes in whole cell lysate buffer (20 mmol/L Hepes pH 7.9, 350 mmol/L NaCl, 20% glycerol, 1 mmol/L MgCl2, 0.5 mmol/L EDTA, 0.1 mmol/L EGTA, and 1% NP-40) and again centrifuged (13,000 ×g, 10 minutes, 4°C). The supernatant was aliquoted and frozen in liquid nitrogen and stored at −80°C until use. The protein concentration for EMSA was quantified by the Bradford method.20Bradford MM A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.Anal Biochem. 1976; 72: 248-254Crossref PubMed Scopus (225068) Google Scholar For EMSA, total heart homogenates were incubated in binding reaction medium (2 μg poly-dI-dC, 1 μg bovine serum albumin, 1 mmol/L dithiothreitol, 20 mmol/L Hepes pH 8.4, 60 mmol/L KCl and 8% Ficoll) with 0.5 ng of32P-dATP end-labeled oligonucleotide, containing the NF-κB binding site from the MHC-enhancer (H2K, 5′-gatcCAGGGCTGGGGATTCCCCATCTCCACAGG) at 30°C for 30 minutes. The DNA-protein complexes were analyzed on a 5% polyacrylamide gel (0.5% Tris buffer), dried, and autoradiographed. NF-κB activity could be blocked by excess unlabeled NF-κB probe, suggesting specificity of the activation. After snap-freezing in liquid nitrogen, organs were kept at −80°C. Tissue was homogenized with mortar and pestle under liquid nitrogen. RNA was isolated following the TRIZOL protocol (Gibco Life Technology) and stored at −80°C. Reverse transcriptase-polymerase chain reaction (RT-PCR) primers and TaqMan-probe for GAPDH and TF were constructed with help of Primer Express (ABI Prism 7700 Sequence Detection System, Perkin Elmer, Foster City, CA): GAPDH forward: AAGCTGGTCATCAATGGGAAAC; GAPDH reverse: ACCCCATTTGATGTTAGCGG; GAPDH probe CATCACCATCTTCCAGGAGCGCGCGAT, FAM (6-carboxytetrafluorescein) and TAMRA (quencher) labeled; TF forward: CCACCTTTCTCGGCTTCCTT; TF reverse: CTTTCCCTGGAGGAGTGCC; TF probe: FAM-TCCTTCAGGTGGCCGTTGGTGC-TAMRA; c-fos forward: CCATGATGTTCTCGGGTTTCA, c-fos reverse: GCGCTACTGCAGCGGG, c-fos probe: FAM-CGCGGACTACGAGGCGTCATCC-TAMRA. oligonucleotides were synthesized by BioTez (Berlin-Buch, Germany). Manganese (Mn) and primer concentrations were optimized with a titration curve. The following concentrations were used: GAPDH Mn 3 mmol/L; TF 4 mmol/L, c-fos 4 mmol/L; GAPDH and TF: primer forward 200 nmol/L, primer reverse 600 nmol/L, probe 100 nmol/L, c-fos primer 200 nmol/L, probe 100 nmol/L. Real-time quantitative RT-PCR was performed using the TaqMan system (ABI’s Prism 7700 Sequence Detection System, Perkin Elmer, Foster City, CA) and following the instructions of TaqMan EZ RT-PCR TaqMan-kit protocol. 0.5–1μg total RNA was used for each PCR with the following time course: 50°C, 2 minutes; 60°C, 30 minutes; 95°C, 5 minutes; 40 cycles of 94°C, 20 seconds and 60°C, 1 minute. Each sample was tested twice. For quantification, gene expression of the target sequence was normalized in relation to the expressed housekeeping gene GAPDH. Thin sections (10 μm) of frozen tissue samples were homogenized with an Ultra Turrax in ice-cold extraction buffer, pH 7.5, containing 5 mmol/L n-octyl-b-D-glucopyranoside and 20 mmol/L HEPES saline (Sigma Chemie). For extraction, homogenates were gently agitated at 4°C for 6 hours followed by centrifugation (300 × g, 15 minutes). The supernatants were aliquoted and stored frozen at −80°C until use. Protein content was determined by the Micro BCA protein assay reagent kit (Pierce, Germany). The procoagulant activity (PCA) of left ventricle extracts was assayed in a one-stage clotting test. In this assay 25 μl of samples were incubated with 25 μl of citrated plasma from rats (Sigma) for 1 minute at 37°C. After addition of 25 μl of 25 mmol/L CaCl2, the clotting time was manually measured. The time recorded was converted to milliunits (mU) of PCA by reference to a TF standard curve derived from a preparation of rat brain acetone powder (Sigma). A clotting time of 50 seconds corresponded to 1000 mU of PCA. PCA was normalized in relation to the expressed total protein (mU/mg). Human coronary artery vascular smooth muscle cells (VSMC) were grown in SmGM2 (Clonetics, San Diego, CA) and Chinese hamster ovary (CHO) cells (cell lines were a kind gift of Dr. Wallukat, MDC, Berlin, Germany) stably overexpressing the AT 1 receptor (CHO-AT1) and CHO wild-type cells (CHO-WT) in DMEM/Ham’s F-12 containing geneticine (63 mg/L), 10% fetal calf serum, 0.1% penicillin/streptomycin, and glutamine to 75% confluence. The human TF luciferase promoters have been described previously.21Mackman N Fowler BJ Edgington TS Morrissey JH Functional analysis of the human tissue factor promoter and induction by serum.Proc Natl Acad Sci USA. 1990; 87: 2254-2258Crossref PubMed Scopus (79) Google Scholar For the promoter studies, 2 μg of the appropriate luciferase promoter construct per milliliter of medium were transfected with Fugene6 (Roche Boehringer) according to the manufacturer’s description. Transfected cells were stimulated for 15 minutes with 1×10−6, or 10−7 mol/L ANG II. AT1 receptor was blocked by a 30-minute preincubation with 10−6Zhang Y Deng Y Luther T Muller M Ziegler R Waldherr R Stern DM Nawroth PP Tissue factor controls the balance of angiogenic and antiangiogenic properties of tumor cells in mice.J Clin Invest. 1994; 94: 1320-1327Crossref PubMed Scopus (469) Google Scholar mol/L valsartan. Cells were harvested and lysed as described earlier.22Katz S Kowenz Leutz E Muller C Meese K Ness SA Leutz A The NF-M transcription factor is related to C/EBP beta and plays a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells.EMBO J. 1993; 12: 1321-1332Crossref PubMed Scopus (158) Google Scholar Luciferase activity assay was performed as described elsewhere.22Katz S Kowenz Leutz E Muller C Meese K Ness SA Leutz A The NF-M transcription factor is related to C/EBP beta and plays a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells.EMBO J. 1993; 12: 1321-1332Crossref PubMed Scopus (158) Google Scholar Relative luciferase units were calculated as percentage of basal luciferase activity of the nonstimulated cell line. The measurements were performed in duplicate. The data were confirmed in 3 to 5 independent transfections. Data are presented as means ± SE. Statistically significant differences in mean values were tested by two-way analysis of variance for repeated measures and the Scheffé test. A value ofP < 0.05 was considered statistically significant. The data were analyzed using Statview statistical software. dTGR featured hypertension and cardiac hypertrophy. Sections of myocardium from dTGR show hemorrhages and patchy areas of necrosis, as well as an interstitial fibrosis. Twelve of 26 untreated dTGR died before week 7. In contrast, none of the valsartan-treated rats died before the end of the study. Untreated dTGR vessels show signs of vasculopathy indicated by damaged lamina elastica interna and intimal proliferation. Valsartan reduced cardiac hypertrophy, prevented vascular injury, and inhibited extracellular matrix formation (Figure 1, A-D). Blood pressure, coronary resistance, cardiac hypertrophy, and left ventricular pressure were markedly increased in untreated dTGR. Valsartan normalized blood pressure, coronary resistance and prevented the development of cardiac hypertrophy (P < 0.0001, respectively, Figure 2, A-C). Plasma ANG II concentrations were fivefold higher in untreated dTGR compared to normotensive SD rats. Valsartan did not affect plasma ANG II levels. ANG II release from isolated perfused hearts was increased threefold in dTGR. Plasma lactic acid dehydrogenase (LDH) was significantly increased compared to valsartan-treated and nontransgenic rats (4651 ± 1268 U vs. 1574 ± 523 Uvs. 640 ± 162 U, P < 0.05). Monocyte adherence to fibronectin or engagement of VLA-4 has been demonstrated to stimulate TF. Therefore, we analyzed the infiltration monocyte/macrophage- and VLA-4-positive cells in cardiac perivascular space of dTGR. Semiquantitative cell count analysis showed significantly increased infiltration in dTGR with a 61% reduction for ED-1-positive mononuclear cells (Figure 3A), as well as a 69% reduction for VLA-4-positive cells (Figure 3B), after valsartan treatment (bothP < 0.0001). The localization of VLA-4 in the interstitium was in the proximity of ED-1-positive cells. dTGR hearts showed increased fibronectin, collagen I and IV, and laminin expression, which was prevented by AT1 receptor blockade (data not shown). We then investigated the activation of the transcription factors NF-κB and AP-1, which regulate TF gene expression. EMSA for the detection of NF-κB and AP-1 showed a greater binding activity in heart homogenates of dTGR compared to SD rats (Figure 4). Valsartan treatment reduced binding activity of NF-κB and AP-1 in the heart. The unrelated transcription factor, CAAT enhancer binding protein was used as control and showed no difference between dTGR and SD (data not shown). TaqMan analysis was performed to assess c-fos (Figure 5A)mRNA levels in dTGR hearts. Untreated dTGR show significantly increased c-fos mRNA levels. Valsartan reduced both c-fos expression. mRNA levels of the target gene was normalized for the housekeeping gene GAPDH.Figure 5Untreated dTGR show significantly increased c-fos (A) and TF (B) mRNA levels. Valsartan reduced both c-fos (*P < 0.05) and TF expression (P = 0.055). mRNA levels of the target genes were normalized for the housekeeping gene GAPDH. Results are expressed as mean ± SE of 5 to 8 animals per group.View Large Image Figure ViewerDownload Hi-res image Download (PPT) TaqMan analysis was performed to assess TF (Figure 5B) mRNA levels in left ventricle of dTGR. Untreated dTGR show significantly increased TF mRNA levels. Valsartan slightly reduced TF expression. mRNA levels of TF gene was normalized for the housekeeping gene GAPDH. However, PCA was not different between the groups when analyzed by ANOVA and Scheffé test. Analyzing median values untreated dTGR showed low levels of TF procoagulant activity per total protein 221 mU/mg (15–4286) compared to relative highest levels in SD rats (549 mU/mg; 25–3192). Valsartan-treated dTGR 280 mU/mg (54–954). These results are in agreement with relative low TF content in human myocardium with pressure-overloaded hearts. In the present study 6 out of 9 dTGR showed a lower PCA compared to the median of the non-transgenic group. Two untreated dTGR with signs of end stage organ damage showed extremely high PCA, indicating that the clotting hemostasis was impaired after microinfarctions. Whereas valsartan treatment inhibited p65 and TF in the vascular wall, valsartan mediated the reduction of hypertrophy, it rather increased PCA per total protein in extracts of the left ventricle. Fluctuation of PCA per total protein within the groups was relatively high, indicating an inhomogeneous distribution of TF in the left ventricle of dTGR. We also analyzed p65 and TF expression at the protein level (Figure 6). Immunohistochemical analysis (phase contrast resolution) showed increased expression of the NF-κB p65 subunit in the endothelium, and smooth muscles cells of dTGR vessels, which was reduced by valsartan (Figure 6, A and B). No immunoreaction was observed in the vessel wall of nontransgenic SD rats (Figure 6C). The antibody recognizes an epitope overlapping the nuclear location signal of p65 subunit and therefore selectively stains released, activated NF-κB after dissociation from its inhibitor I-κBα.18Zabel U Henkel T Silva MS Baeuerle PA Nuclear uptake control of NF-kappa B by MAD-3, an I kappa B protein present in the nucleus.EMBO J. 1993; 12: 201-211Crossref PubMed Scopus (272) Google Scholar Beside TF staining in the myocardium, TF expression was increased in the endothelium and smooth muscle cells in dTGR (Figure 6D). The staining pattern of TF resembles the localization of p65 in the vessel wall. AT1 receptor blockade reduced ANG II-induced TF expression (Figure 6E). No striking immunoreaction was observed in the vessel wall of nontransgenic SD rats (Figure 6F). Figure 7 shows a representative section of a dTGR heart with increased TF expression in the vessel wall and adventitia as well as infiltrated cells. TF immunostaining was markedly reduced by valsartan. To characterizes the effects of ANG II on human TF promoter activity, VSMC and CHO cells overexpressing the AT1 receptor were transfected with various truncations of plasmids containing the human TF promoter (−244 to 121 bp, relative to the transcription start site) cloned upstream of a firefly luciferase reporter gene. Luciferase activity of cells transfected with the full-length TF promoter was increased 12-fold in VSMC (Figure 8) and 11-fold in CHO-AT1 (Figure 9), but not in CHO-WT (Figure 9), after 10−7Randolph GJ Luther T Albrecht S Magdolen V Muller WA Role of tissue factor in adhesion of mononuclear phagocytes to and trafficking through endothelium in vitro.Blood. 1998; 92: 4167-4177Crossref PubMed Google Scholar mol/L ANG II. Preincubation with 10−6Zhang Y Deng Y Luther T Muller M Ziegler R Waldherr R Ste
Referência(s)