A High-throughput Assay for Phosphoprotein-specific Phosphatase Activity in Cellular Extracts
2012; Elsevier BV; Volume: 12; Issue: 3 Linguagem: Inglês
10.1074/mcp.o112.024059
ISSN1535-9484
AutoresAnjun K. Bose, Kevin A. Janes,
Tópico(s)Glycosylation and Glycoproteins Research
ResumoProtein phosphatases undo the post-translational modifications of kinase-signaling networks, but phosphatase activation in cells is difficult to measure and interpret. Here, we report the design of a quantitative and high-throughput assay platform for monitoring cellular phosphatase activity toward specific phosphoprotein targets. Protein substrates of interest are purified recombinantly, phosphorylated in vitro using the upstream kinase, and adsorbed to 96-well plates. Total phosphatase extracts from cells are then added to trigger a solid-phase dephosphorylation reaction. After stopping the reaction, phosphoprotein levels are quantified by ELISA with a phospho-specific antibody, and the loss of phospho-specific immunoreactivity is used as the readout of phosphatase activity. We illustrate the generality of the method by developing specific phosphatase-activity assays for the three canonical mitogen-activated protein phospho-kinases: ERK, JNK, and p38. The assays capture changes in activity with a dynamic range of 25–100-fold and are sensitive to a limit of detection below 25,000 cells. When applied to cytokine-induced signaling, the assays revealed complex and dynamic regulation of phosphatases suggesting cross-communication and a means for cellular memory. Our assay platform should be beneficial for phosphoproteomic surveys and computational-systems models of signaling, where phosphatases are known to be important but their activities are rarely measured. Protein phosphatases undo the post-translational modifications of kinase-signaling networks, but phosphatase activation in cells is difficult to measure and interpret. Here, we report the design of a quantitative and high-throughput assay platform for monitoring cellular phosphatase activity toward specific phosphoprotein targets. Protein substrates of interest are purified recombinantly, phosphorylated in vitro using the upstream kinase, and adsorbed to 96-well plates. Total phosphatase extracts from cells are then added to trigger a solid-phase dephosphorylation reaction. After stopping the reaction, phosphoprotein levels are quantified by ELISA with a phospho-specific antibody, and the loss of phospho-specific immunoreactivity is used as the readout of phosphatase activity. We illustrate the generality of the method by developing specific phosphatase-activity assays for the three canonical mitogen-activated protein phospho-kinases: ERK, JNK, and p38. The assays capture changes in activity with a dynamic range of 25–100-fold and are sensitive to a limit of detection below 25,000 cells. When applied to cytokine-induced signaling, the assays revealed complex and dynamic regulation of phosphatases suggesting cross-communication and a means for cellular memory. Our assay platform should be beneficial for phosphoproteomic surveys and computational-systems models of signaling, where phosphatases are known to be important but their activities are rarely measured. Phosphatases (PPases) 1The abbreviations used are:PPasephosphataseMAPKmitogen activated protein kinaseERKextracellular regulated kinaseJNKc-Jun N-terminal kinaseTXYThr-X-TyrDUSPdual-specificity PPaseGSTglutathione S-transferaseEGFepidermal growth factorTNFtumor necrosis factor4PLfour-parameter logisticCHXcycloheximide. 1The abbreviations used are:PPasephosphataseMAPKmitogen activated protein kinaseERKextracellular regulated kinaseJNKc-Jun N-terminal kinaseTXYThr-X-TyrDUSPdual-specificity PPaseGSTglutathione S-transferaseEGFepidermal growth factorTNFtumor necrosis factor4PLfour-parameter logisticCHXcycloheximide. reset post-translational modifications by kinases and thus help to sculpt the phosphoproteome (1Tonks N.K. Protein tyrosine phosphatases: from genes, to function, to disease.Nat. Rev. Mol. Cell Biol. 2006; 7: 833-846Crossref PubMed Scopus (1253) Google Scholar, 2Ingebritsen T.S. Cohen P. Protein phosphatases: properties and role in cellular regulation.Science. 1983; 221: 331-338Crossref PubMed Scopus (477) Google Scholar, 3Keyse S.M. Dual-specificity MAP kinase phosphatases (MKPs) and cancer.Cancer Metastasis Rev. 2008; 27: 253-261Crossref PubMed Scopus (368) Google Scholar). Once thought of as global attenuators of phosphorylation (2Ingebritsen T.S. Cohen P. Protein phosphatases: properties and role in cellular regulation.Science. 1983; 221: 331-338Crossref PubMed Scopus (477) Google Scholar), PPases are now known to recognize specific subsets of phosphoprotein targets (4Roy J. Cyert M.S. Cracking the phosphatase code: docking interactions determine substrate specificity.Science signaling. 2009; 2: re9Crossref PubMed Scopus (140) Google Scholar, 5Shi Y. Serine/threonine phosphatases: mechanism through structure.Cell. 2009; 139: 468-484Abstract Full Text Full Text PDF PubMed Scopus (1053) Google Scholar, 6Virshup D.M. Shenolikar S. From promiscuity to precision: protein phosphatases get a makeover.Mol. Cell. 2009; 33: 537-545Abstract Full Text Full Text PDF PubMed Scopus (493) Google Scholar, 7Farooq A. Zhou M.M. Structure and regulation of MAPK phosphatases.Cell. Signal. 2004; 16: 769-779Crossref PubMed Scopus (380) Google Scholar). Cellular PPase activity toward these phosphoprotein subsets is regulated at multiple levels. PPases can be induced transcriptionally (8Keyse S.M. Emslie E.A. Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase.Nature. 1992; 359: 644-647Crossref PubMed Scopus (569) Google Scholar, 9Sun H. Charles C.H. Lau L.F. Tonks N.K. MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo.Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1025) Google Scholar, 10Brondello J.M. Brunet A. Pouysségur J. McKenzie F.R. The dual specificity mitogen-activated protein kinase phosphatase-1 and -2 are induced by the p42/p44MAPK cascade.J. Biol. Chem. 1997; 272: 1368-1376Abstract Full Text Full Text PDF PubMed Scopus (318) Google Scholar), for example, and their catalytic efficiency is further controlled by diverse post-translational modifications (11Saxena M. Williams S. Taskén K. Mustelin T. Crosstalk between cAMP-dependent kinase and MAP kinase through a protein tyrosine phosphatase.Nat Cell Biol. 1999; 1: 305-311Crossref PubMed Scopus (185) Google Scholar, 12Blanco-Aparicio C. Torres J. Pulido R. A novel regulatory mechanism of MAP kinases activation and nuclear translocation mediated by PKA and the PTP-SL tyrosine phosphatase.J. Cell Biol. 1999; 147: 1129-1136Crossref PubMed Scopus (143) Google Scholar, 13Dickinson R.J. Delavaine L. Cejudo-Marin R. Stewart G. Staples C.J. Didmon M.P. Trinidad A.G. Alonso A. Pulido R. Keyse S.M. Phosphorylation of the kinase interaction motif in mitogen-activated protein (MAP) kinase phosphatase-4 mediates cross-talk between protein kinase A and MAP kinase signaling pathways.J. Biol. Chem. 2011; 286: 38018-38026Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar, 14Brondello J.M. Pouysségur J. McKenzie F.R. Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation.Science. 1999; 286: 2514-2517Crossref PubMed Scopus (365) Google Scholar, 15Meng T.C. Fukada T. Tonks N.K. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo.Mol. Cell. 2002; 9: 387-399Abstract Full Text Full Text PDF PubMed Scopus (889) Google Scholar). Notably, misregulation of PPases has been implicated in various inherited disorders (16Tartaglia M. Mehler E.L. Goldberg R. Zampino G. Brunner H.G. Kremer H. van der Burgt I. Crosby A.H. Ion A. Jeffery S. Kalidas K. Patton M.A. Kucherlapati R.S. Gelb B.D. Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome.Nat. Genet. 2001; 29: 465-468Crossref PubMed Scopus (1326) Google Scholar, 17Bottini N. Musumeci L. Alonso A. Rahmouni S. Nika K. Rostamkhani M. MacMurray J. Meloni G.F. Lucarelli P. Pellecchia M. Eisenbarth G.S. Comings D. Mustelin T. A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes.Nat. Genet. 2004; 36: 337-338Crossref PubMed Scopus (1124) Google Scholar) and in diseases such as cancer (18Bulavin D.V. Demidov O.N. Saito S. Kauraniemi P. Phillips C. Amundson S.A. Ambrosino C. Sauter G. Nebreda A.R. Anderson C.W. Kallioniemi A. Fornace Jr., A.J. Appella E. Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity.Nat. Genet. 2002; 31: 210-215Crossref PubMed Scopus (360) Google Scholar, 19Zhang L. Zhou W. Velculescu V.E. Kern S.E. Hruban R.H. Hamilton S.R. Vogelstein B. Kinzler K.W. Gene expression profiles in normal and cancer cells.Science. 1997; 276: 1268-1272Crossref PubMed Scopus (1228) Google Scholar). phosphatase mitogen activated protein kinase extracellular regulated kinase c-Jun N-terminal kinase Thr-X-Tyr dual-specificity PPase glutathione S-transferase epidermal growth factor tumor necrosis factor four-parameter logistic cycloheximide. phosphatase mitogen activated protein kinase extracellular regulated kinase c-Jun N-terminal kinase Thr-X-Tyr dual-specificity PPase glutathione S-transferase epidermal growth factor tumor necrosis factor four-parameter logistic cycloheximide. Multiple computational studies have indicated that PPases are especially important for the system-level properties of a signaling network (20Heinrich R. Neel B.G. Rapoport T.A. Mathematical models of protein kinase signal transduction.Mol. Cell. 2002; 9: 957-970Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 21Bhalla U.S. Ram P.T. Iyengar R. MAP kinase phosphatase as a locus of flexibility in a mitogen-activated protein kinase signaling network.Science. 2002; 297: 1018-1023Crossref PubMed Scopus (523) Google Scholar, 22Haugh J.M. Schneider I.C. Lewis J.M. On the cross-regulation of protein tyrosine phosphatases and receptor tyrosine kinases in intracellular signaling.J. Theor. Biol. 2004; 230: 119-132Crossref PubMed Scopus (13) Google Scholar, 23Blüthgen N. Legewie S. Kielbasa S.M. Schramme A. Tchernitsa O. Keil J. Solf A. Vingron M. Schäfer R. Herzel H. Sers C. A systems biological approach suggests that transcriptional feedback regulation by dual-specificity phosphatase 6 shapes extracellular signal-related kinase activity in RAS-transformed fibroblasts.FEBS J. 2009; 276: 1024-1035Crossref PubMed Scopus (42) Google Scholar). However, mathematically encoding explicit PPase species is problematic, because many PPases act on multiple substrates (2Ingebritsen T.S. Cohen P. Protein phosphatases: properties and role in cellular regulation.Science. 1983; 221: 331-338Crossref PubMed Scopus (477) Google Scholar, 3Keyse S.M. Dual-specificity MAP kinase phosphatases (MKPs) and cancer.Cancer Metastasis Rev. 2008; 27: 253-261Crossref PubMed Scopus (368) Google Scholar), and each phosphosite can often be dephosphorylated by multiple PPases (24Saxena M. Mustelin T. Extracellular signals and scores of phosphatases: all roads lead to MAP kinase.Semin. Immunol. 2000; 12: 387-396Crossref PubMed Scopus (110) Google Scholar, 25Mustelin T. A brief introduction to the protein phosphatase families.Methods Mol. Biol. 2007; 365: 9-22PubMed Google Scholar). Consequently, PPases are often modeled as generic species that are tonically active, although some models include transcriptional regulation in an effort to capture feedback control (21Bhalla U.S. Ram P.T. Iyengar R. MAP kinase phosphatase as a locus of flexibility in a mitogen-activated protein kinase signaling network.Science. 2002; 297: 1018-1023Crossref PubMed Scopus (523) Google Scholar, 23Blüthgen N. Legewie S. Kielbasa S.M. Schramme A. Tchernitsa O. Keil J. Solf A. Vingron M. Schäfer R. Herzel H. Sers C. A systems biological approach suggests that transcriptional feedback regulation by dual-specificity phosphatase 6 shapes extracellular signal-related kinase activity in RAS-transformed fibroblasts.FEBS J. 2009; 276: 1024-1035Crossref PubMed Scopus (42) Google Scholar, 26Nakakuki T. Birtwistle M.R. Saeki Y. Yumoto N. Ide K. Nagashima T. Brusch L. Ogunnaike B.A. Okada-Hatakeyama M. Kholodenko B.N. Ligand-specific c-Fos expression emerges from the spatiotemporal control of ErbB network dynamics.Cell. 2010; 141: 884-896Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 27Chen W.W. Schoeberl B. Jasper P.J. Niepel M. Nielsen U.B. Lauffenburger D.A. Sorger P.K. Input-output behavior of ErbB signaling pathways as revealed by a mass action model trained against dynamic data.Mol Syst Biol. 2009; 5: 239Crossref PubMed Scopus (303) Google Scholar, 28Cirit M. Wang C.C. Haugh J.M. Systematic quantification of negative feedback mechanisms in the extracellular signal-regulated kinase (ERK) signaling network.J. Biol. Chem. 2010; 285: 36736-36744Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). The unfortunate result of this simplification is a model whose generic PPases cannot be constrained by experimental observations. Thus, for network modeling of phosphorylation cascades, there is a need for measurement platforms that capture total PPase activity toward key signaling transducers. The activity of purified PPases is readily measured with artificial colorimetric substrates (29Bessey O.A. Lowry O.H. Brock M.J. A method for the rapid determination of alkaline phosphates with five cubic millimeters of serum.J. Biol. Chem. 1946; 164: 321-329Abstract Full Text PDF PubMed Google Scholar) or chromogenic indicators of released inorganic phosphate (30Geladopoulos T.P. Sotiroudis T.G. Evangelopoulos A.E. A malachite green colorimetric assay for protein phosphatase activity.Anal. Biochem. 1991; 192: 112-116Crossref PubMed Scopus (321) Google Scholar, 31Baykov A.A. Evtushenko O.A. Avaeva S.M. A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay.Anal. Biochem. 1988; 171: 266-270Crossref PubMed Scopus (688) Google Scholar). Yet, neither of these detection strategies is compatible with total cellular extracts. Improved selectivity can be achieved with fluorescently labeled peptide substrates (32Lutz M.P. Pinon D.I. Miller L.J. A nonradioactive fluorescent gel-shift assay for the analysis of protein phosphatase and kinase activities toward protein-specific peptide substrates.Anal. Biochem. 1994; 220: 268-274Crossref PubMed Scopus (18) Google Scholar, 33Zhang Z.Y. Maclean D. Thieme-Sefler A.M. Roeske R.W. Dixon J.E. A continuous spectrophotometric and fluorimetric assay for protein tyrosine phosphatase using phosphotyrosine-containing peptides.Anal. Biochem. 1993; 211: 7-15Crossref PubMed Scopus (117) Google Scholar), but these peptides still lack the structural requirements important for specific recognition by PPases (4Roy J. Cyert M.S. Cracking the phosphatase code: docking interactions determine substrate specificity.Science signaling. 2009; 2: re9Crossref PubMed Scopus (140) Google Scholar, 5Shi Y. Serine/threonine phosphatases: mechanism through structure.Cell. 2009; 139: 468-484Abstract Full Text Full Text PDF PubMed Scopus (1053) Google Scholar, 6Virshup D.M. Shenolikar S. From promiscuity to precision: protein phosphatases get a makeover.Mol. Cell. 2009; 33: 537-545Abstract Full Text Full Text PDF PubMed Scopus (493) Google Scholar, 7Farooq A. Zhou M.M. Structure and regulation of MAPK phosphatases.Cell. Signal. 2004; 16: 769-779Crossref PubMed Scopus (380) Google Scholar). One can work around the promiscuity of such substrates by gel electrophoresis of crude extracts and then enzyme renaturation (34Kameshita I. Baba H. Umeda Y. Sueyoshi N. In-gel protein phosphatase assay using fluorogenic substrates.Anal. Biochem. 2010; 400: 118-122Crossref PubMed Scopus (23) Google Scholar, 35Burridge K. Nelson A. An in-gel assay for protein tyrosine phosphatase activity: detection of widespread distribution in cells and tissues.Anal. Biochem. 1995; 232: 56-64Crossref PubMed Scopus (85) Google Scholar), although this focuses on the PPases rather than the phosphosubstrates. Perhaps the clearest way to measure specific PPase activity is with the phosphosubstrate itself. However, previous assays have used radiolabeled substrates that are short-lived and must be precipitated away from the released 32P signal (36Mitsuhashi S. Shima H. Kikuchi K. Igarashi K. Hatsuse R. Maeda K. Yazawa M. Murayama T. Okuma Y. Nomura Y. Development of an assay method for activities of serine/threonine protein phosphatase type 2B (calcineurin) in crude extracts.Anal. Biochem. 2000; 278: 192-197Crossref PubMed Scopus (20) Google Scholar, 37Cohen P. Alemany S. Hemmings B.A. Resink T.J. Strålfors P. Tung H.Y. Protein phosphatase-1 and protein phosphatase-2A from rabbit skeletal muscle.Methods Enzymol. 1988; 159: 390-408Crossref PubMed Scopus (387) Google Scholar), which reduces throughput. More recently, nonradioactive ELISA formats have been explored using broad phospho-motif antibodies (38Chuman Y. Iizuka K. Honda T. Onoue H. Shimohigashi Y. Sakaguchi K. Phosphatase assay for multi-phosphorylated substrates using phosphatase specific-motif antibody.J Biochem. 2011; 150: 319-325Crossref PubMed Scopus (1) Google Scholar), but the crossreactivity of such antibodies precludes their use for monitoring specific dephosphorylation events on key signaling proteins. Despite many decades of research on PPases, an assay has not been developed that is quantitative, high-throughput, sensitive, and specific for the conversion of phosphosubstrates. Here, we report the general design of such an assay and its proof-of-principle application to the PPases deactivating the three canonical mitogen-activated protein kinases (MAPKs): extracellular-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38. MAPK pathways are critical signal-transduction modules that control proliferation, death-survival, differentiation, and stress responses throughout eukaryotes (39Kyriakis J.M. Avruch J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation.Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2877) Google Scholar, 40Widmann C. Gibson S. Jarpe M.B. Johnson G.L. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human.Physiol. Rev. 1999; 79: 143-180Crossref PubMed Scopus (2263) Google Scholar). MAPKs are all regulated by phosphorylation of a Thr-X-Tyr (TXY) motif in their activation loop, which is catalyzed by dual-specificity MAPK kinases (MAP2Ks). Complete TXY dephosphorylation is catalyzed by dual-specificity PPases (DUSPs) called MAPK PPases (MKPs) (3Keyse S.M. Dual-specificity MAP kinase phosphatases (MKPs) and cancer.Cancer Metastasis Rev. 2008; 27: 253-261Crossref PubMed Scopus (368) Google Scholar, 7Farooq A. Zhou M.M. Structure and regulation of MAPK phosphatases.Cell. Signal. 2004; 16: 769-779Crossref PubMed Scopus (380) Google Scholar). The TXY motif can also be deactivated by the joint action of serine-threonine PPases and tyrosine PPases (41Barr A.J. Knapp S. MAPK-specific tyrosine phosphatases: new targets for drug discovery?.Trends Pharmacol. Sci. 2006; 27: 525-530Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 42Alessi D.R. Gomez N. Moorhead G. Lewis T. Keyse S.M. Cohen P. Inactivation of p42 MAP kinase by protein phosphatase 2A and a protein tyrosine phosphatase, but not CL100, in various cell lines.Curr. Biol. 1995; 5: 283-295Abstract Full Text Full Text PDF PubMed Scopus (321) Google Scholar, 43Westermarck J. Li S.P. Kallunki T. Han J. Kähäri V.M. p38 mitogen-activated protein kinase-dependent activation of protein phosphatases 1 and 2A inhibits MEK1 and MEK2 activity and collagenase 1 (MMP-1) gene expression.Mol. Cell. Biol. 2001; 21: 2373-2383Crossref PubMed Scopus (177) Google Scholar, 44Takekawa M. Maeda T. Saito H. Protein phosphatase 2Calpha inhibits the human stress-responsive p38 and JNK MAPK pathways.EMBO J. 1998; 17: 4744-4752Crossref PubMed Scopus (239) Google Scholar). For our assay development and validation, bisphosphorylated MAPKs provide a prototypical phosphosubstrate under complex negative regulation that changes dynamically in response to environmental stimuli (8Keyse S.M. Emslie E.A. Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase.Nature. 1992; 359: 644-647Crossref PubMed Scopus (569) Google Scholar, 9Sun H. Charles C.H. Lau L.F. Tonks N.K. MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo.Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1025) Google Scholar, 10Brondello J.M. Brunet A. Pouysségur J. McKenzie F.R. The dual specificity mitogen-activated protein kinase phosphatase-1 and -2 are induced by the p42/p44MAPK cascade.J. Biol. Chem. 1997; 272: 1368-1376Abstract Full Text Full Text PDF PubMed Scopus (318) Google Scholar, 11Saxena M. Williams S. Taskén K. Mustelin T. Crosstalk between cAMP-dependent kinase and MAP kinase through a protein tyrosine phosphatase.Nat Cell Biol. 1999; 1: 305-311Crossref PubMed Scopus (185) Google Scholar, 12Blanco-Aparicio C. Torres J. Pulido R. A novel regulatory mechanism of MAP kinases activation and nuclear translocation mediated by PKA and the PTP-SL tyrosine phosphatase.J. Cell Biol. 1999; 147: 1129-1136Crossref PubMed Scopus (143) Google Scholar, 13Dickinson R.J. Delavaine L. Cejudo-Marin R. Stewart G. Staples C.J. Didmon M.P. Trinidad A.G. Alonso A. Pulido R. Keyse S.M. Phosphorylation of the kinase interaction motif in mitogen-activated protein (MAP) kinase phosphatase-4 mediates cross-talk between protein kinase A and MAP kinase signaling pathways.J. Biol. Chem. 2011; 286: 38018-38026Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar, 14Brondello J.M. Pouysségur J. McKenzie F.R. Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation.Science. 1999; 286: 2514-2517Crossref PubMed Scopus (365) Google Scholar). However, the format described here should generalize to any phosphoprotein that can be prepared in vitro and can be monitored with a high-quality phosphospecific antibody. Recombinant MAPKs and their upstream constitutively active MAP2Ks were cloned by PCR into pGEX-4T-1 glutathione S-transferase (GST) fusion plasmids containing triple epitope tags for Flag or HA. Rat ERK2 (Addgene, Cambridge, MA; plasmid #8974) (45Dimitri C.A. Dowdle W. MacKeigan J.P. Blenis J. Murphy L.O. Spatially separate docking sites on ERK2 regulate distinct signaling events in vivo.Curr. Biol. 2005; 15: 1319-1324Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×Flag) by PCR with the primers gcgcggatccatggcggcggcggcggcggcggg (forward) and gcgcgtcgacttaagatctgtatcctggctgg (reverse) followed by digestion with BamHI and SalI. Human JNK1 (Addgene plasmid #13798) (46Dérijard B. Hibi M. Wu I.H. Barrett T. Su B. Deng T. Karin M. Davis R.J. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.Cell. 1994; 76: 1025-1037Abstract Full Text PDF PubMed Scopus (2954) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×Flag) by PCR with the primers gcgcaggatccatgagcagaagcaagcgtgac (forward) and gcgcgtcgactcactgctgcacctgtgc (reverse) followed by digestion with BamHI and SalI. Murine p38α (Addgene plasmid #20351) (47Enslen H. Raingeaud J. Davis R.J. Selective activation of p38 mitogen-activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6.J. Biol. Chem. 1998; 273: 1741-1748Abstract Full Text Full Text PDF PubMed Scopus (471) Google Scholar) was cloned into the BamH1 and Xho1 sites of pGEX-4T-1 (3×Flag) by PCR with the primers gcgcggatccatgtcgcaggagaggccc (forward) and gcgcctcgagtcaggactccatttcttcttgg (reverse) followed by digestion with BamHI and XhoI. Murine MEK1-DD (Addgene plasmid #15268) (48Boehm J.S. Zhao J.J. Yao J. Kim S.Y. Firestein R. Dunn I.F. Sjostrom S.K. Garraway L.A. Weremowicz S. Richardson A.L. Greulich H. Stewart C.J. Mulvey L.A. Shen R.R. Ambrogio L. Hirozane-Kishikawa T. Hill D.E. Vidal M. Meyerson M. Grenier J.K. Hinkle G. Root D.E. Roberts T.M. Lander E.S. Polyak K. Hahn W.C. Integrative genomic approaches identify IKBKE as a breast cancer oncogene.Cell. 2007; 129: 1065-1079Abstract Full Text Full Text PDF PubMed Scopus (484) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×HA) by PCR with the primers gcgcggatccatgcccaagaagaagccgacg (forward) and gcgcgtcgactcagatgctggcagcgtgg (reverse) followed by digestion with BamHI and SalI. Human MKK4-EE (Addgene plasmid #14813) (49Whitmarsh A.J. Shore P. Sharrocks A.D. Davis R.J. Integration of MAP kinase signal transduction pathways at the serum response element.Science. 1995; 269: 403-407Crossref PubMed Scopus (880) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×HA) by PCR with the primers gcgcggatccatgcagggtaaacgcaaagc (forward) and gcgcgtcgactcaatcgacatacatgggagagc (reverse) followed by digestion with BamHI and SalI. Murine MKK7a1-EE (Addgene plasmid #14540) (50Tournier C. Whitmarsh A.J. Cavanagh J. Barrett T. Davis R.J. Mitogen-activated protein kinase kinase 7 is an activator of the c-Jun NH2-terminal kinase.Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 7337-7342Crossref PubMed Scopus (340) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×HA) by PCR with the primers gcgcggatccatgctggggctcccatcaac (forward) and gcgcgtcgacctacctgaagaagggcagatg (reverse) followed by digestion with BamHI and SalI. MKK4-EE and MKK7a1-EE were subcloned sequentially into pCDFDuet-1 (Novagen, Madison, WI) for coexpression with pGEX-4T-1 3xFlag-JNK1. Human MKK6-EE (Addgene plasmid #13518) (51Raingeaud J. Whitmarsh A.J. Barrett T. Dérijard B. Davis R.J. MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway.Mol. Cell. Biol. 1996; 16: 1247-1255Crossref PubMed Scopus (1143) Google Scholar) was cloned into the BamHI and SalI sites of pGEX-4T-1 (3×HA) by PCR with the primers gcgcagatctatgtctcagtcgaaaggcaag (forward) and gcgcgtcgacttagtctccaagaatcagttttac (reverse) followed by digestion with BglII and SalI. The ligation products were transformed into electrocompetent E. coli (DH10B; Invitrogen, Grand Island, NY) and ampicillin-resistant clones were screened by endonuclease digestion and sequencing. Sequence-verified clones were transformed into low-copy E. coli (C41 DE3; Avidis, Saint-Beauzire, France) and grown at 37 °C until an optical density of 0.6–0.8 was achieved. The GST-fusion proteins were induced with isopropyl β-d-1-thiogalactopyranoside (IPTG) at 37 °C under the following conditions: GST-3xFlag-ERK2—2 mm IPTG for 5 h, GST-3xFlag-JNK1—0.4 mm IPTG for 4.5 h, GST-3xFlag-p38α—0.4 mm IPTG for 4 h, GST-3xHA-MEK1-DD—2 mm IPTG for 3 h, GST-3xHA-MKK4-EE—0.4 mm IPTG for 5 h, GST-3xHA-MKK7-EE—1 mm IPTG for 5 h, and GST-3xHA-MKK6-EE—0.4 mm IPTG for 4.5 h. Cells were harvested by centrifugation, resuspended in 7.5 ml TNE lysis buffer (50 mm Tris pH 7.4, 150 mm NaCl, 1 mm EDTA, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 μg/ml pepstatin) per 250 ml cell culture, and lysed with lysozyme and deoxycholate. Bacterial extracts were clarified by centrifugation and incubated overnight at 4 °C with glutathione-coated agarose beads (Sigma, St. Louis, MO). The bead-bound proteins were washed three times with ice-cold PBS + 0.5% Triton X-100 and then twice with PBS. MAP2Ks were eluted from the beads with 10 mm glutathione in 50 mm Tris pH 8.0 and concentrated with ultrafiltration columns (Millipore, Billerica, MA) before phosphorylation of MAPKs. Phosphorylation of the bead-bound MAPKs was accomplished by incubating the beads with their corresponding, concentrated MAP2Ks diluted in kinase assay buffer (10 mm Tris pH 7.5, 1 mm ATP, 15 mm MgCl2, 2.5 mm beta-glycerophosphate, 0.5 mm Na3VO4, 0.5 mm EGTA, 0.2 mm DTT) for 24 h at 37 °C. The phosphorylation reactions were halted by the addition of excess EDTA and the beads were washed three times with PBS. The phosphorylated MAPKs were purified by thrombin digest and quantified by SDS-PAGE with Coomassie staining. To verify phosphospecificity of the ELISAs, 0.5–1 μg of pMAPK was dephosphorylated with 1250 units lambda PPase (New England Biolabs, Ipswich, MA) in 50 mm HEPES (pH 7.5), 0.1% 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate, 100 mm NaCl, 1 mm MnCl2 for 2 h at 30 °C. HT-29 cells (ATCC, Manassas, VA) were cultured according to the manufacturer's specifications. For the cytokine time courses, HT-29 cells were seeded at 50,000 cells/cm2, grown for 24 h, then treated with 200 U/ml interferon gamma (IFNγ) for an additional 24 h (52Janes K.A. Albeck J.G. Peng L.X. Sorger P.K. Lauffenburger D.A. Yaffe M.B. A high-throughput quantitative multiplex kinase assay for monitoring information flow in signaling networks: application to sepsis-apoptosis.Mol Cell Proteomics. 2003; 2: 463-473Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). IFNγ-sensitized cells were then treated with 100 ng/ml epidermal growth factor (EGF), 100 ng/ml tumor necrosis factor (TNF), or both for the indicated times. Cells were washed once with ice-cold PBS and then lysed in a PPase lysis buffer (50 mm HEPES (pH 7.5), 0.05% saponin, 50 mm 2-mercaptoethanol (βME), 1 mm dithiothreitol (DTT), 2 mm MgCl2, 20 μg/ml aprotinin, 20 μg/ml leupeptin, 1 μg/ml pepstatin). Whole cell lysates were incubated on ice for 15 min then clarified by centrifugation at 16,000 × g for 15 min at 4 °C. Clarified lysates were frozen as single-use aliquots at −80 °C. For the EGF prestimulation experiment, cells were seeded and sensitized as described above, then treated with 100 ng/ml EGF for 2 h followed by 100 ng/ml TNF for 15 min. Cells were washed once with ice-cold PBS then lysed in radioimmunoprecipitation assay (RIPA) buffer
Referência(s)