PDZ Domains Facilitate Binding of High Temperature Requirement Protease A (HtrA) and Tail-specific Protease (Tsp) to Heterologous Substrates through Recognition of the Small Stable RNA A (ssrA)-encoded Peptide
2002; Elsevier BV; Volume: 277; Issue: 42 Linguagem: Inglês
10.1074/jbc.m202790200
ISSN1083-351X
AutoresA Spiers, Heather K. Lamb, Simon Cocklin, Kerry A. Wheeler, Jo Budworth, A. Dodds, Mark J. Pallen, Duncan J. Maskell, Ian G. Charles, Alastair R. Hawkins,
Tópico(s)Heat shock proteins research
ResumoThe Escherichia coli protease HtrA has two PDZ domains, and sequence alignments predict that the E. coli protease Tsp has a single PDZ domain. PDZ domains are composed of short sequences (80–100 amino acids) that have been implicated in a range of protein:protein interactions. The PDZ-like domain of Tsp may be involved in binding to the extreme COOH-terminal sequence of its substrate, whereas the HtrA PDZ domains are involved in subunit assembly and are predicted to be responsible for substrate binding and subsequent translocation into the active site. E. coli has a system of protein quality control surveillance mediated by the ssrA-encoded peptide tagging system. This system tags misfolded proteins or protein fragments with an 11-amino acid peptide that is recognized by a battery of cytoplasmic and periplasmic proteases as a degradation signal. Here we show that both HtrA and Tsp are able to recognize the ssrA-encoded peptide tag with apparent K D values of ∼5 and 390 nm, respectively, and that their PDZ-like domains mediate this recognition. Fusion of the ssrA-encoded peptide tag to the COOH terminus of a heterologous protein (glutathioneS-transferase) renders it sensitive to digestion by Tsp but not HtrA. These observations support the prediction that the HtrA PDZ domains facilitate substrate binding and the differential proteolytic responses of HtrA and Tsp to SsrA-tagged glutathioneS-transferase are interpreted in terms of the structure of HtrA. The Escherichia coli protease HtrA has two PDZ domains, and sequence alignments predict that the E. coli protease Tsp has a single PDZ domain. PDZ domains are composed of short sequences (80–100 amino acids) that have been implicated in a range of protein:protein interactions. The PDZ-like domain of Tsp may be involved in binding to the extreme COOH-terminal sequence of its substrate, whereas the HtrA PDZ domains are involved in subunit assembly and are predicted to be responsible for substrate binding and subsequent translocation into the active site. E. coli has a system of protein quality control surveillance mediated by the ssrA-encoded peptide tagging system. This system tags misfolded proteins or protein fragments with an 11-amino acid peptide that is recognized by a battery of cytoplasmic and periplasmic proteases as a degradation signal. Here we show that both HtrA and Tsp are able to recognize the ssrA-encoded peptide tag with apparent K D values of ∼5 and 390 nm, respectively, and that their PDZ-like domains mediate this recognition. Fusion of the ssrA-encoded peptide tag to the COOH terminus of a heterologous protein (glutathioneS-transferase) renders it sensitive to digestion by Tsp but not HtrA. These observations support the prediction that the HtrA PDZ domains facilitate substrate binding and the differential proteolytic responses of HtrA and Tsp to SsrA-tagged glutathioneS-transferase are interpreted in terms of the structure of HtrA. post-synaptic density protein, disc large, andzo-1 resonance unit glutathioneS-transferase surface plasmon resonance dithiothreitol isopropyl-1-thio-β-d-galactopyranoside Escherichia coli has a system of quality control surveillance monitoring proteins located in the cytoplasm and periplasm. This system uses a series of proteases to target misfolded or damaged proteins by recognition of an 11-amino acid peptide tag, which is added to the COOH terminus by a mechanism that requires thessrA-encoded RNA. The ssrA RNA has 363 nucleotides and can form a tRNA-like structure that is chargeable with alanine. In a model proposed by Keiler et al. (1Keiler K.C. Silber K.R. Downard K.M. Papayannopoulos I.A. Biemann K. Sauer R.T. Protein Sci. 1995; 4: 1507-1515Crossref PubMed Scopus (57) Google Scholar), SsrA charged with alanine can bind to stalled ribosomes. After the contribution of the ssrA-encoded alanine, translation switches to a short open reading frame in ssrA that encodes the COOH-terminal peptide tag degradation signal. This system provides a general quality control mechanism to dispose of incomplete protein fragments and avoid the build-up of ribosomes stalled on defective mRNA molecules (2Keiler K.C. Sauer R.T. J. Biol. Chem. 1996; 271: 2589-2593Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 3Komine Y. Kitabatake M. Yokogawa T. Nishikawa K. Inokuchi H. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9223-9227Crossref PubMed Scopus (367) Google Scholar, 4Tu G.F. Reid G.E. Zhang J.G. Moritz R.L. Simpson R.J. J. Biol. Chem. 1995; 270: 9322-9326Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar, 5Williams K.P. Bartel D.P. RNA. 1996; 2: 1306-1310PubMed Google Scholar, 6Felden B. Himeno H. Muto A. McCutcheon J.P. Atkins J.F. Gesteland R.F. RNA. 1997; 3: 89-103PubMed Google Scholar, 7Gottesman S. Roche E. Zhou Y. Sauer R.T. Genes Dev. 1998; 12: 1338-1347Crossref PubMed Scopus (660) Google Scholar). Cytoplasmic proteases that respond to this system are largely ATP-dependent (e.g. the ClpXP and ClpAP proteases) whereas SsrA-tagged proteins with signal sequences are directed to the periplasm and degraded there by ATP-independent proteases. Tsp is a periplasmic serine protease of E. coli that was purified on the basis of its ability to degrade a variant of the NH2-terminal domain of the bacteriophage lambda repressor. The wild-type repressor domain, which is not degraded, contains the polar COOH-terminal sequence Arg-Ser-Glu-Tyr-Glu, whereas the variant repressor protein contains the apolar sequence Trp-Val-Ala-Ala-Ala, and it is this that allows degradation by Tsp (1Keiler K.C. Silber K.R. Downard K.M. Papayannopoulos I.A. Biemann K. Sauer R.T. Protein Sci. 1995; 4: 1507-1515Crossref PubMed Scopus (57) Google Scholar, 8Parsell D.A. Silber K.R. Sauer R.T. Genes Dev. 1990; 4: 277-286Crossref PubMed Scopus (102) Google Scholar, 9Silber K.R. Keiler K.C. Sauer R.T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 295-299Crossref PubMed Scopus (168) Google Scholar). Tsp preferentially degrades substrates that are not stably folded, by digestion at several sites that have broad primary sequence specificity (1Keiler K.C. Silber K.R. Downard K.M. Papayannopoulos I.A. Biemann K. Sauer R.T. Protein Sci. 1995; 4: 1507-1515Crossref PubMed Scopus (57) Google Scholar). Tsp is thought to bind to the COOH terminus of the protein in question, with no proteolysis occurring until spontaneous unfolding makes the polypeptide available to the protease active site (2Keiler K.C. Sauer R.T. J. Biol. Chem. 1996; 271: 2589-2593Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 10Karzai A.W. Roche E.D. Sauer R.T. Nat. Struct. Biol. 2000; 7: 449-455Crossref PubMed Scopus (350) Google Scholar). HtrA (also known as DegP) is a second periplasmic protease of E. coli, which can also act as a chaperone (11Hu S.I. Carozza M. Klein M. Nantermet P. Luk D. Crowl R.M. J. Biol. Chem. 1998; 273: 34406-34412Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar), and was originally identified as a heat shock-induced protein. It is located on the periplasmic side of the inner membrane and has the conserved triad of His, Ser, and Asp residues that is characteristic of the serine proteases. Homologues of HtrA have been found in a wide range of species including Gram-negative and Gram-positive bacteria, cyanobacteria, yeast, and humans. A natural substrate for HtrA is the periplasmic MalS protein, but HtrA is also able to use β-casein as a proteolytic substrate in vitro as the latter is largely unordered in solution (11Hu S.I. Carozza M. Klein M. Nantermet P. Luk D. Crowl R.M. J. Biol. Chem. 1998; 273: 34406-34412Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 12Pallen M.J. Wren B.W. Mol. Microbiol. 1997; 26: 209-221Crossref PubMed Scopus (332) Google Scholar). At low temperatures HtrA acts predominantly as a chaperone and in vitro is able to stimulate the refolding of chemically denatured proteins. The proteolytic activity associated with HtrA predominates at high temperatures. Null mutants in the htrA gene are thermosensitive and have a decreased ability to degrade abnormal periplasmic proteins. A mutant form of HtrA in which Ser210has been changed to Ala is correctly folded but proteolytically inactive, and has a reduced ability to suppress the thermosensitive phenotype in a strain deleted for the wild-type htrA gene. These observations link the loss of proteolytic activity with the thermosensitive phenotype (13Lipinska B. Fayet O. Baird L. Georgopoulos C. J. Bacteriol. 1989; 171: 1574-1584Crossref PubMed Google Scholar, 14Lipinska B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar, 15Strauch K.L. Johnson K. Beckwith J. J. Bacteriol. 1989; 171: 2689-2696Crossref PubMed Scopus (309) Google Scholar, 16Seol J.H. Woo S.K. Jung E.M. Yoo S.J. Lee C.S. Kim K.J. Tanaka K. Ichihara A., Ha, D.B. Chung C.H. Biochem. Biophys. Res. Commun. 1991; 176: 730-736Crossref PubMed Scopus (48) Google Scholar, 17Bass S., Gu, Q. Christen A. J. Bacteriol. 1996; 178: 1154-1161Crossref PubMed Scopus (135) Google Scholar, 18Kolmar H. Waller P.R. Sauer R.T. J. Bacteriol. 1996; 178: 5925-5929Crossref PubMed Scopus (120) Google Scholar, 19Skorko-Glonek J. Wawrzynow A. Krzewski K. Kurpierz K. Lipinska B. Gene (Amst.). 1995; 163: 47-52Crossref PubMed Scopus (86) Google Scholar, 20Skorko-Glonek J. Krzewski K. Lipinska B. Bertoli E. Tanfani F. J. Biol. Chem. 1995; 270: 11140-11146Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 21Speiss C. Beil A. Ehrmann M. Cell. 1999; 97: 339-347Abstract Full Text Full Text PDF PubMed Scopus (642) Google Scholar). This mutant HtrA retains chaperone activity (21Speiss C. Beil A. Ehrmann M. Cell. 1999; 97: 339-347Abstract Full Text Full Text PDF PubMed Scopus (642) Google Scholar). Transcription of the htrA gene is highly regulated by a complex interaction with inner membrane proteins and a more global system of phosphoprotein phosphatases (22Missiakas D. Raina S. Trends Biochem. Sci. 1997; 22: 59-63Abstract Full Text PDF PubMed Scopus (56) Google Scholar). The crystal structure of a protease-deficient mutant HtrA has been determined, and is a hexamer formed by staggered association of trimeric rings; the proteolytic sites are located in a central cavity that is only accessible laterally (23Krojer T. Garrido-Franco M. Huber R. Ehrmann M. Clausen T. Nature. 2002; 416: 455-459Crossref PubMed Scopus (338) Google Scholar). HtrA monomers are composed of three domains, an NH2-terminal protease/chaperonin domain and two PDZ1 domains (PDZ1 and 2). PDZ domains are composed typically of 80–100 amino acids and have been reported in many proteins involved in a range of protein:protein interactions. The acronym PDZ derives from three eukaryotic proteins (post-synaptic density (PSD) protein,disc large and zo-1 (zonula occludens)) in which they were first described (24Itoh M. Nagafuchi A. Yonemura S. Kitani-Yasuda T. Tsukita S. J. Cell Biol. 1993; 121: 491-502Crossref PubMed Scopus (511) Google Scholar). In the HtrA multimer, 12 PDZ domains form mobile side walls, with PDZ1 domains interacting with one another suggesting they function as the main gatekeeper to the inner chamber (23Krojer T. Garrido-Franco M. Huber R. Ehrmann M. Clausen T. Nature. 2002; 416: 455-459Crossref PubMed Scopus (338) Google Scholar). Tsp contains a single PDZ-like domain (1Keiler K.C. Silber K.R. Downard K.M. Papayannopoulos I.A. Biemann K. Sauer R.T. Protein Sci. 1995; 4: 1507-1515Crossref PubMed Scopus (57) Google Scholar), and is a member of a family of proteases (clan SF, family 41; Ref. 25Rawlings N.D. Barrett A.J. Hopsu-Havu V.K. Jarvinen M. Kirscke H. Proteolysis in Cell Functions. IOS Press, Amsterdam1997: 13-21Google Scholar) that includes the Scenedesmus obliquus D1 COOH-terminal processing protease (D1P). The structure of the S. obliquusD1P has been determined, and its β-domain shows a high degree of similarity at the secondary and tertiary structural level with the PDZ domains of the human homologue of the Drosophila discs large tumor suppressor gene product (D1gA), nitric-oxide synthase, and the third PDZ domain of PSD-95 (26Ponting C.P. Protein Sci. 1997; 6: 464-468Crossref PubMed Scopus (196) Google Scholar, 27Liao D.I. Qian J. Chisholm D.A. Jordan D.B. Diner B.A. Nat. Struct. Biol. 2000; 7: 749-753Crossref PubMed Scopus (114) Google Scholar). It has been proposed that the PDZ domains of HtrA are also involved in substrate binding, thereby directly coupling substrate binding and translocation within the HtrA multimer. It is speculated that this coupled binding and translocation may be facilitated by the PDZ domains acting as tentacular arms capturing substrates and transferring them into the inner cavity (23Krojer T. Garrido-Franco M. Huber R. Ehrmann M. Clausen T. Nature. 2002; 416: 455-459Crossref PubMed Scopus (338) Google Scholar). To address the prediction that the HtrA PDZ domains facilitate substrate binding, we tested the ability of HtrA and a protease (Tsp) with no chaperonin activity to bind to the ssrA-encoded peptide. Here we show that Tsp and HtrA bind to the isolatedssrA-encoded peptide via their PDZ-like domains. Tsp and HtrA bind the SsrA peptide with different affinities (K D for Tsp = 390 nm;K D for HtrA = 4.9 nm) and fusion of this peptide to the GST protein enhances proteolysis by Tsp but not HtrA. Chemicals and solvents were purchased from local suppliers and were of AnalaR or greater purity. Enzyme substrates were purchased from Sigma, and molecular biology reagents (which were used in accordance with the manufacturer recommendations) were purchased from Invitrogen, Amersham Biosciences, or BCL. Three peptides of sequence Ala-Ala-Asn-Asp-Glu-Asn-Tyr-Ala-Leu-Ala-Ala (peptide 1; wild-type SsrA sequence tag), Tyr-Asn-Ala-Leu-Asn-Ala-Asp-Ala-Ala-Ala-Glu (peptide 2; randomized SsrA sequence tag), and Ala-Ala-Asn-Asp-Glu-Asn-Trp-Val-Ala-Ala-Ala (peptide 3; a modified SsrA sequence with the Trp-Val-Ala-Ala-Ala motif used to identify the Tsp protease), all containing a biotin molecule linked via standard carbodiimide condensation, were synthesized in the University of Newcastle upon Tyne Facility for Molecular Biology. A fourth peptide of wild-type SsrA sequence, but lacking the biotin molecule, was also synthesized. The complete coding regions of the E. coli and Salmonella typhimurium htrA genes, the E. coli tspgene, and the sequences encoding the PDZ domains were amplified by the polymerase chain reaction (PCR) and subcloned into E. coliexpression vectors (see Table I). PCR amplification was performed according to the following conditions: cycle 1, 94 °C for 2 min, 50 °C for 2 min, and 72 °C for 4 min; cycles 2–30, 94 °C for 1 min, 50 °C for 2 min, and 72 °C for 4 min. All PCR reactions used the Expand high fidelity Taq polymerase (Roche Molecular Biochemicals). Similarly, the gene encoding the GST protein was amplified by the PCR with COOH-terminal extensions of either Ala-Ala-Asn-Asp-Glu-Asn-Tyr-Ala-Leu-Ala-Ala or Tyr-Asn-Ala-Leu-Asn-Ala-Asp-Ala-Ala-Ala-Glu. Site-directed mutagenesis, as previously described (28Hemsley A. Arnheim N. Toney M.D. Cortopassi G. Galas D.J. Nucleic Acids Res. 1989; 17: 6545-6551Crossref PubMed Scopus (446) Google Scholar), using a mutagenic oligonucleotide of sequence AACCGTGGTACCGCCGGTGGTGCGCTG and a non-mutagenic oligonucleotide of sequence GATCGCTGCATCGGTCTGGAT and plasmid pTR130 as template were used to generate the HtrA Ser210 → Ala mutant. A mutagenic oligonucleotide of sequence GAACCGACGTTTGGCGCCGGCACCGTTCAG and a non-mutagenic oligonucleotide of sequence ACCCACAACCAGCGCACGACCGTAATC and plasmid pTR147 as template were used to generate the Tsp Lys455 → Ala mutant. The amino acids encoded by the various plasmid constructs and the oligonucleotides used in each PCR are shown in Table I. The correct sequences and the absence of PCR-generated artifacts in the cloned sequences were verified by directly sequencing the double-stranded plasmid DNA on an ABI/PerkinElmer Life Sciences 377 automated DNA sequencer.Table IThe plasmids used in this studyPlasmidProtein encodedAmino acid residuesSsrA peptide?VectorGST fusion?His6 fusion?Sense oligonucleotideAntisense oligonucleotidepTR130HtrA1–474NopTrc99aNoNoCGAGACTGAAATTCATGAAAAAAACCGGAGTTGTGGTGGGATCCACAGATTGTAAGpTR141HtrA (Ser210 → Ala)1–474NopTrc99aNoNoCGAGACTGAAATTCATGAAAAAAACCGGAGTTGTGGTGGGATCCACAGATTGTAAGpTR129S. typhimuriumHTRA1–475NopTrc99aNoNoCGAGATTGAAACTCATGAAAAAAACGAAGGGGGACAAGGATCCTTACTGCATCAGpXF44HtrA PDZ 1+2274–471NopGEX4T3YesNoATCCCGAGTAACGGATCCAAAAACCTGACCGGAAGGGGTTGAGTCGACTTACTGCATTAApXF39HtrA PDZ 1274–376NopGEX4T3YesNoATCCCGAGTAACGGATCCAAAAACCTGACCCTGCTGCAGTTCTCAGTCGACGTTAACCTGCpXF41HtrA PDZ 2383–470NopGEX4T3YesNoAACCTGGAACTGGGATCCAGCAGCCAGAATCGGGAGATTACTGTCAGTCGACGTAGATGGTGCpXF46HtrA PDZ 2378–474NopGEX4T3YesNoAAGCAGGTTAACGGATCCCTGGAACTGCAGGGAAGGGGTTGAGTCGACTTACTGCATTAApXF50GST1–240Yes, nativepGEX4T3YesNoAATTCCCGGGTCGACGCTGCCAATGACGAAAACTATGCCC TTGCAGCGTAAGCGGCCGCTTACGCTGCAAGGGCATAGTTTTCGTCATTGGCA GCGTCGACCCGGGpXF51GST1–240Yes, randompGEX4T3YesNoAATTCCCGGGTCGACTATAATGCTCTTAACGCCGATGCC GCAGCGGAATAAGCGGCCGCTTATTCCGCTGCGGCATCGGCGTTAAGAGCATTAT AGTCGACCCGGGpTR147Tsp1–683NopTrc99aNoYesGGCCGGGCCAGCCATGGACATGTTTTTTAGGCCTGTTAAAAAATCAGGCTCTAGATTAGTGATGGTGATGGT GATGCTTGACGGGApTR163Tsp (Lys455 _ Ala)1–683NopTrc99aNoYesGAACCGACGTTTGGCGCCGGCACCGTTCAGACCCACAACCAGCGCACGACCGTAATCpXF47Tsp PDZ228–335NopGEX4T3YesNoCGACCCGCATGGATCCTATCTTTCCCTTCGAGACGCTCGAGTTAACGGGTCAACpXF42S. typhimurium HTRA PDZ 1275–377NopGEX4T3YesNoATCCCCAGTAACGGATCCAAAAACCTGACGGCTCTGCTGCAGTCAGCTCGAGACCGTAATCGCTpXF43S. typhimurium HTRA PDZ 2384–471NopGEX4T3YesNoCTGGAACTGCAGGGATCCAGCCAGAGTCAAAGGTGATTACTGTCAGTCGACATAAATAGAACThe relevant details of the recombinant proteins encoded by the plasmids are listed with the oligonucleotides (shown 5′ to 3′) used for their PCR amplification. The numbering of the encoded amino acid sequences refers to the precursor proteins before cleavage of the signal sequence. The DNA sequences encoding the HtrA protease domain and the Tsp protein both had an additional sequence encoding 6 histidine residues attached to their 3′ end facilitating protein purification by immobilized metal affinity chromatography. Yes or No in the columns marked SsrA peptide?, GST fusion?, and His6 fusion? indicates whether the recombinant protein encoded has these heterologous sequences attached. Open table in a new tab The relevant details of the recombinant proteins encoded by the plasmids are listed with the oligonucleotides (shown 5′ to 3′) used for their PCR amplification. The numbering of the encoded amino acid sequences refers to the precursor proteins before cleavage of the signal sequence. The DNA sequences encoding the HtrA protease domain and the Tsp protein both had an additional sequence encoding 6 histidine residues attached to their 3′ end facilitating protein purification by immobilized metal affinity chromatography. Yes or No in the columns marked SsrA peptide?, GST fusion?, and His6 fusion? indicates whether the recombinant protein encoded has these heterologous sequences attached. Recombinant plasmids designated pTR129 and130 were used to transform the E. coli expression strain BL21 (DE3) to screen for E. coliand S. typhimurium HtrA overproduction in the presence of 0.2 mg ml−1 IPTG. Soluble overproduction of both HtrA proteins was achieved, and analysis by SDS-PAGE showed that greater than 90% of HtrA was processed by removal of the signal peptide. For a typical purification of native HtrA, 4 liters of cells grown at 37 °C in 500-ml batches in rich medium were induced by the presence of 0.2 mg ml−1 IPTG when the cells were in mid logarithmic growth and harvested by centrifugation at 2,500 × g. Following disruption by sonication in 450 ml of 50 mmpotassium phosphate, pH 7.2, 1 mm DTT, 5 mmEDTA (buffer 1), the cell suspension was clarified by centrifugation at 2,500 × g for 30 min at 4 °C. The clarified supernatant was applied to a DEAE-Sephacel column and eluted with 500 ml of the same buffer. The HtrA-containing column flow-through was combined, made 1.0 m with ammonium sulfate, and applied to a phenyl-Sepharose column. After washing with buffer 1 containing 1.0m ammonium sulfate, the phenyl-Sepharose column was eluted with a 1-liter gradient consisting of 500 ml of 1.0 mammonium sulfate in buffer 1 connected to 500 ml of 10 mmpotassium phosphate buffer, pH 7.2, 1 mm DTT (buffer 2). HtrA protein was then eluted from the column in a single batch wash of 500 ml of buffer 2 after completion of the ammonium sulfate gradient. The HtrA pool was applied to a hydroxyapatite column and washed with 500 ml of buffer 2. The column was then eluted with an 800-ml gradient consisting of 400 ml of buffer 2 connected to 400 ml of 400 mm potassium phosphate, pH 7.2, 1 mm DTT (buffer 3). At the end of the gradient, purified HtrA was eluted with a batch wash of 400 ml of 400 mm potassium phosphate buffer, pH 6.6, 1 mm DTT (buffer 4). Typical yields from this procedure were 150 mg of HtrA from 4 liters of original culture. The same procedure was used in conjunction with plasmid pTr141 to purify the Ser210 → Ala mutant HtrA. Plasmids encoding GST fusion proteins (see TableI) were used to transform the E. coli strain BL21 DE3 leading to the IPTG-inducible soluble overproduction of the appropriate proteins. Typically the cells from two 500-ml cultures, grown at 37 °C and induced in mid-logarithmic growth with 0.2 mg ml−1 IPTG, were harvested by centrifugation at 2,500 × g and sonicated in 200 ml of 0.1 m Tris-HCl, pH 8.0, 1 mm DTT (buffer 5). Following clarification by centrifugation at 2,500 ×g, the supernatant was applied to a glutathione-substituted Sepharose column, and the column washed with 500 ml of buffer 5. Fusion proteins were eluted by a batch wash of 100 ml of buffer 5 containing 10 mm glutathione and dialyzed into 20 mmTris-HCl, pH 8.0, prior to use in surface plasmon resonance measurements. Proteins containing a His6 COOH-terminal tag were purified by immobilized metal affinity chromatography as described above but with the following modifications; harvested cells were sonicated in 50 mm potassium phosphate, pH 7.2, 0.5 m NaCl, 1 mm DTT, 1 mm benzamidine (buffer 6) and the clarified supernatant applied to a 21-ml chelating Sepharose column charged to 30% capacity with zinc. Following a 100-ml wash with buffer 6 containing 2.0 m glycine, the column was equilibrated with 100 ml of buffer 6 to remove residual glycine. The column was then eluted with a 100-ml 50 mm potassium phosphate linear pH 6.0 to 4.0 gradient. Following analysis by SDS-PAGE, fractions containing the desired protein were dialyzed into 20 mmTris-HCl, pH 8.0. Protease assays using HtrA and Tsp with β-casein or GST as the substrate were carried out according to the following protocol; 0.1 μm protease was added to 3.7 μm substrate (β-casein or GST) in a final volume of 100 μl of 20 mm Tris-HCl, pH 8.0. The reaction was incubated at 37 °C with Tsp for 2.5 h and at 42 °C with HtrA for 4 h, using a Hybaid thermal reactor. Control experiments (data not shown) demonstrated that HtrA had greater proteolytic activity at 42 °C than at 37 °C. The fragments produced by the proteolysis were analyzed by SDS-PAGE using a 12% separating gel (31Ladbury J.E. Lemmon M.A. Zhou M. Green J. Botfield M.C. Schlessinger J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3199-3203Crossref PubMed Scopus (246) Google Scholar). Prior to digestion GST proteins were unfolded by heating at 90 °C for 10 min using a Hybaid Thermal Reactor. The interactions among HtrA, Tsp, and their PDZ subfragments with three synthetic peptides were monitored by SPR measurements using the BIAcoreTM 2000 from Amersham Biosciences. The synthetic peptides were used as the ligand and the HtrA, Tsp, and PDZ subfragments as the analyte. The concentrations of purified proteins and the synthetic peptides were determined spectrophotometrically from their calculated molar extinction co-efficients. For HtrA binding, peptides in the range of 7–30 resonance units (RUs) were immobilized by linkage via a biotin molecule to the streptavidin layer of a SA biosensor chip. Because of the lower affinity of Tsp binding to the peptides, 250 RUs of peptide were bound to facilitate a measurable signal. This immobilization was performed at pH 7.4 in HBS buffer (10 mm HEPES, pH 7.4, 150 mm NaCl, 3.4 mm EDTA, 0.005% v/v P20 surfactant). GST proteins with and without the wild-type and scrambled SsrA peptide tag were immobilized via amine groups to the surface of CM5 chips at pH 7.4 in HBS buffer in the range 160–180 RUs. The modified biosensor chips were then equilibrated at 25 °C with a running buffer consisting of 20 mm Tris-HCl, pH 8.0. Using the BIAcore KINJECT function, 15 μl of the desired analyte was injected at 5 μl min−1at varying concentrations. Previous experiments using a range of flow rates showed no evidence of mass transport limitation effects. The regeneration buffer, HBS, was injected at 5 μl min−1 for 60 s. For HtrA, a data set of 30 points was obtained by using concentrations of 5, 10, 20, 30, 40, and 50 nm and repeating this for a total of five times. For Tsp, concentrations of 600, 650, 700, 750, and 800 nm were used six times to generate a data set of 30 points. The base lines of the sensorgrams for the experimental and reference flow cells were adjusted to zero immediately prior to injection and the specific changes in the experimental sensorgram measured by subtracting the values from the reference cell containing peptide 2 (the randomized SsrA sequence). Kinetic analysis was performed using BIAevaluation 3.0 software (BIAcore AB) following the recommendations of the manufacturer for acceptable χ2 values, and fitting the to 1:1 Langmuir model (29Langmuir I. J. Am. Chem. Soc. 1918; 40: 1361-1403Crossref Scopus (18399) Google Scholar). This analysis showed that the analyte failed to give interpretable sensorgrams with peptide 2 (randomized SsrA sequence), indicating that the proteases did not recognize this peptide. Initially the data were fitted to a range of models supplied in the BIAevaluation software package, and the 1:1 Langmuir model adequately described the experimental data for peptides 1 and 3. HtrA and Tsp proteases were purified according to the protocol under "Experimental Procedures," and their biological activity confirmed by their ability to digest β-casein in vitro (see Fig. 2). To test directly the hypothesis that HtrA and Tsp could bind to the ssrA-encoded peptide tag, we monitored the interactions between the proteins and various peptides related to the SsrA peptide by SPR measurements. The proteases were used as the analytes and three different peptides as the ligands: the wild-type SsrA peptide (COOH-terminal sequence Tyr-Ala-Leu-Ala-Ala), a variant with the COOH-terminal sequence Trp-Val-Ala-Ala-Ala (the sequence originally used to identify and purify Tsp), and a variant consisting of wild-type amino acid composition but randomly assembled sequence. The randomized sequence was used as a control to check that any protease:peptide interactions were sequence related, and the Trp-Val-Ala-Ala-Ala variant was included as a positive control for the Tsp protease. Fig. 1 shows typical sensorgrams for the binding of Tsp (panel A) andE. coli HtrA (panel B) to the wild-type SsrA peptide, and Table IIsummarizes the kinetic data.Figure 1Sensorgrams showing the binding of Tsp and HtrA to the SsrA peptide. Panel A shows the binding response of SsrA peptide as the ligand to 600, 650, 700, 750, and 800 μm Tsp; panel B shows the binding response of SsrA peptide as the ligand to 5, 10, 20, 30, 40, and 50 μm HtrA. Plots of the residuals associated with each data set are shown beneath the sensorgrams.View Large Image Figure ViewerDownload (PPT)Table IIThe apparent association rate constant (ka), dissociation rate constant (kd), and the apparent equilibrium association (KA) and dissociation (KD) constants for the binding of Tsp and HtrA to the SsrA peptide and a GST protein with the SsrA peptide fused to its COOH terminusProteinSsrA peptideGST plus SsrA peptidekaM−1s−1S.D.KdS.D.KDMNo. of data pointsE. coliHtrAWild-type7.2 × 1054.8 × 1053.5 × 10−31.4 × 10−34.9 × 10−930E. coli HtrATrp-Val-Ala-Ala variant2.1 × 1051.2 × 1055.2 × 10−32.8 × 10−324.8 × 10−930E. coli HtrA Ser210 _ AlaWild-type4.4 × 1055 × 10511.1 × 10−34.0 × 10−325.2 × 10−930E. coli HtrA Ser210 → AlaTrp-Val-Ala-Ala variant5.5 × 1056.2 × 10510.1 × 10−35.2 × 10−318.3 × 10−930S. typhimuriumHtrAWild-type5.3 × 1053.4 × 1051.7 × 10−35.7 × 10−43.2 × 10−930TspWild-type8.9 × 1032.0 × 1033.5 × 10−36.4 × 10−43.9 × 10−730Tsp Lys455 → AlaWild-type1.3 × 1050.7 × 1053.9 × 10−33.5 × 10−33.0 × 10−830TspTrp-Val-Ala-Ala variant1.4 × 1032.7 × 1035.4 × 10−31.0 × 10−338.0 × 10−735E. coliHtrAWild-type2.6 × 1056.5 × 1059.7 × 10−31.2 × 10−237.3 × 10−930S. typhimuriumHtrAWild-type4.5 × 1052.4 × 1051.3 × 10−36.8 × 10−42.9 × 10−930TspWild-type4.0 × 1041.6 × 1041.0 × 10−57.5 × 10−62.5 × 10−1030Tsp Lys455 → AlaWild-type1.4 × 1050.8 × 1052.4 × 10−34.8 × 10−31.7 × 10−830S. typhimurium HtrA PDZ 1Wild-type5.8 × 1034.1 × 1035.1 × 10−31.3 × 10−38.8 × 10−730S. typhimurium HtrA PDZ 2Wild-type9.0 × 1033.3 × 1031.1 × 10−23.6 × 10−312.2 × 10−730Tsp PDZWild-type6.1 × 1033.9 × 1031.0 × 10−25.0 × 10−316.4 × 10−730The respective apparent kinetic parameters ka, kd, kA, and KD for the binding of E. coli HtrA, HtrA Ser210 _ Ala, and Tsp proteases to the wild-type and WVAA variant SsrA peptides and the GST protein modified with these peptides are shown. The columns marked S.D. show the standard deviations for the measurements of the ka and kdvalues. ND, not determined. Open table in a new tab
Referência(s)